Articles on this page are available in 1 other language: Spanish (11) (learn more)

Overview

Brief Summary

Biology

Golden eagles hunt in a range of ways; they may soar and search for prey from on high, or sit in a tree on the look-out. They have also been seen flying low and then ambushing their prey. Food items taken include a range of small mammals including hares, rabbits, young foxes and rodents, as well as gamebirds and carrion (2).  Pairs mate for life, and the huge nest (or 'eyrie') built in a tree or on a cliff-ledge will be used year after year providing it is not disturbed (2). Furthermore, these nests may be used by successive generations (6). Display flights occur during courtship in which the pair performs plunging and looping flights (6). Two eggs are laid following mating, and these are incubated for up to 45 days. The chicks fledge after 65-70 days. Golden eagles may live for as long as 32 years (6).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 1 person

Average rating: 4.0 of 5

Aquila chrysaetos

An extremely large (30-40 inches) raptor, the Golden Eagle is much larger than the largest North American hawk and is only marginally smaller than the Bald Eagle (Haliaeetus leucocephalus). With its dark brown body, dull yellow legs, and yellow bill, the Golden Eagle may be difficult to separate at a distance from an immature Bald Eagle, which has these same field marks and lacks the white head and tail of adults. With a good view, however, it is possible to identify a Golden Eagle by looking for a golden wash to the back of its neck. Male and female Golden Eagles are similar to one another in all seasons, although females are slightly larger. The Golden Eagle may be found across the northern hemisphere. In North America, this species breeds primarily in the mountain west from Alaska to central Mexico. In winter, Golden Eagles breeding in Canada and Alaska move south, while those in the Rocky Mountains move to lower altitudes. Golden Eagles were formerly more numerous in eastern North America, but have retracted their range westward in response to increasing pressure from humans. Small numbers of Golden Eagles breed in eastern Canada and winter locally in the northeastern U.S.and Mid-Atlantic region. In Eurasia, the Golden Eagle inhabits much of northern Eurasia, with isolated populations further south, especially at higher latitudes in southern Europe, Asia Minor, and the Himalayas. In summer, the Golden Eagle breeds in a variety of habitats, including tundra, grasslands, and coniferous forests. Winter habitats are similar to breeding habitats, but may also include wetlands. Golden Eagles primarily hunt small mammals, including rabbits, hares, and squirrels, and marmots, but may scavenge carrion when available. Golden Eagles may be most easily observed soaring on long, broad wings held flat (as opposed to vultures, which soar with their wings in a “v” shape). Individuals may also be observed perching in trees or other prominent locations, and adults may be seen entering nests to feed chicks. Golden Eagles are primarily active during the day.

Threat Status: Least concern

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Unknown

Supplier: DC Birds

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Description

Although the majestic golden eagle is not Britain's largest raptor (the white-tailed eagle exceeds it in size) nor is it the rarest, it has a certain powerful resonance in the British psyche as an enduring symbol of strength and wildness (4) (5). This huge bird of prey can be identified by its very long wings and long tail. When gliding or soaring it typically holds its wings in a shallow 'V' (2). The plumage is dark brown rather than golden and the massive talons are bright yellow. The feathers of the head and nape of the neck are typically light yellowish or reddish-brown, giving the appearance of a 'shawl'. Males and females are similar in appearance, but juveniles can be distinguished by the presence of white patches on the undersides of the wings and on both surfaces of the tail (2). This raptor rarely makes sound, although a thin whistle is occasionally produced in flight (2).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Comprehensive Description

Longueur 75-88 cm, envergure 2,05-2,20 m, poids moyen 2,8-4,6 kg pour le mâle, 3,8-6,7 kg pour la femelle.

Il vit dans les grands espaces ouverts, parfois les zones humides mais le plus souvent les zones montagneuses, loin des activités humaines. L’absence de spécialisation alimentaire (et de forte compétition interspécifique) et sa capacité à chasser sur de grandes distances lui permettent de survivre même avec une densité et une biomasse de proies relativement faibles.

L’Aigle royal se nourrit principalement de mammifères et d’oiseaux vivants ou morts, parfois aussi de reptiles et même de poissons et d’insectes. Il chasse habituellement d’un vol bas, parcourant méthodiquement le terrain et capturant ses proies par surprise. La plupart sont prises au sol mais un oiseau dérangé, un Lagopède par exemple, peut être poursuivi sur quelque distance. L’éventail de proies est très large : les mammifères vont du petit rongeur jusqu’aux Cervidés, tandis que les oiseaux vont de l’Alouette jusqu’à l’Oie ou la Grue. Ses préférences vont toutefois vers les animaux pesant entre 0,5 et 2 kg. Les proies les plus grosses ne sont consommées qu’à l’état de cadavre ou si elles sont affaiblies, et sont notamment attaquées par des individus spécialisés ou inexpérimentés. Il arrive que le couple chasse de concert, le premier oiseau pouvant ainsi disperser les groupes familiaux d’Ongulés et le second, suivant à une centaine de mètres, se concentrant alors sur un jeune isolé.

Les jeunes aigles se dispersent parfois sur de grandes distances, mais les adultes restent sur leur territoire. Même en hiver, ils gardent le contact avec leur site de nid, à moins que la famine ou les conditions météorologiques ne les forcent à s’éloigner. Les oiseaux solitaires, jeunes ou adultes, sont généralement erratiques mais certains s’établissent sur un territoire, parfois même inclus dans celui d’un couple nicheur. L’Aigle royal est monogame et les couples sont fidèles. Ils sont territoriaux et les aires des différents couples sont largement séparées (au moins 4 km et en général 10 à 20 km). Les parades aériennes sont peu fréquentes ; elles comprennent des plongées vertigineuses depuis de grandes hauteurs, suivies de remontées en chandelle.

La ponte de 1 à 3 œufs est déposée à partir de février-mars. L’aire est construite sur une paroi rocheuse ou un arbre. C’est un énorme assemblage de branchettes, couvert d’herbes, de laine et de feuillage. Les plus gros atteignent plusieurs mètres d’épaisseur. L’incubation dure 43-45 jours et les jeunes s’envolent à l’âge de 65-80 jours. En général, seul le 1er aiglon éclos survit, car il cause la mort des autres jeunes, plus petits. Il est chassé par ses parents entre septembre et novembre.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Muséum national d'Histoire naturelle. Service du Patrimoine naturel

Source: Inventaire National du Patrimoine Naturel

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Distribution

Golden eagles (Aquila chrysaetos) have a Holarctic distribution. They occur throughout Eurasia, in northern Africa, and in North America. In North America, golden eagles are found in the western half of the continent, from Alaska to central Mexico, with small numbers in eastern Canada and scattered pairs in the eastern United States.

Biogeographic Regions: nearctic (Native ); palearctic (Native ); ethiopian (Native )

Other Geographic Terms: holarctic

  • Kochert, M., K. Steenhof, C. McIntyre, E. Craig. 2002. Golden Eagle (Aquila chrysaetos). Pp. 1-44 in A Poole, F Gill, eds. The Birds of North America, Vol. 684. Philadelphia: The Birds of North America.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Global Range: (>2,500,000 square km (greater than 1,000,000 square miles)) In North America, breeding occurs from western and northern Alaska eastward through Northwest Territories to Labrador, and south to northern Mexico, Texas, western Oklahoma, and western Kansas, and in eastern North America southward to New York and northern New England (rare). See Lee and Spofford (1990) for a review of nesting records from the central and southern Appalachians (most nesting records south of the Adirondacks are doubtful). Golden eagles breed also in the Palearctic. The winter range in North America extends from south-central Alaska and southern Canada southward through the breeding range, and casually farther southward. In the United States, the species is most numerous in winter in the Rocky Mountain states, Great Basin, and western edge of the Great Plains (Root 1988). See Milsap and Vana (1984) for information on winter range in the eastern United States. Northernmost populations in Eurasia winter south to northern Africa (Sibley and Monroe 1990).

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Geographic Range

Golden eagles (Aquila_chrysaetos) have a Holarctic distribution. They occur throughout Eurasia, in northern Africa, and in North America. In North America, golden eagles are found in the western half of the continent, from Alaska to central Mexico, with small numbers in eastern Canada and scattered pairs in the eastern United States.

Biogeographic Regions: nearctic (Native ); palearctic (Native ); ethiopian (Native )

Other Geographic Terms: holarctic

  • Kochert, M., K. Steenhof, C. McIntyre, E. Craig. 2002. Golden Eagle (Aquila chrysaetos). Pp. 1-44 in A Poole, F Gill, eds. The Birds of North America, Vol. 684. Philadelphia: The Birds of North America.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: BioKIDS Critter Catalog

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

In North America the golden eagle breeds from northern and western
Alaska east to Labrador and south to southern Alaska, Baja California,
western and central Texas, western Oklahoma, western Kansas, and the
highlands of northern Mexico (south to Durango, Guanauato, and Nuevo
Leon) [1,8]. A remnant eastern population of golden eagles extends from
Quebec into the Appalachian Mountains [9]. The golden eagle has never
been common in the eastern United States. Fewer than 30 historical
breeding territories are documented in the Northeast, primarily in New
York, New Hampshire, and Maine [26].

The golden eagle winters from south-central Alaska and the southern
portions of the Canadian provinces south throughout the breeding range
to Mexico, rarely to coastal South Carolina [8,9].
  • 1. American Ornithologists' Union. 2004. The A.O.U. check-list of North American birds, 7th edition, [Online]
  • 8. DeGraaf, Richard M.; Scott, Virgil E.; Hamre, R. H.; [and others]
  • 9. Dunstan, Thomas C. 1989. The golden eagle. In: Audubon wildlife report: 1989/1990: 499-511. On file with: U.S. Department of Agriculture, Forest Service, Intermountain Research Station, Fire Sciences Laboratory, Missoula, MT. [22392]
  • 26. Todd, Charles S. 1989. Golden eagle. In: Northeast raptor management symposium and workshop: Proceedings; 1989 May 16-18; Syracuse, NY. National Wildlife Federation Scientific and Technical Series 13. Washington, DC: National Wildlife Federation: 65-70. [22176]

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Regional Distribution in the Western United States

More info on this topic.

This species can be found in the following regions of the western United States (according to the Bureau of Land Management classification of Physiographic Regions of the western United States):

1 Northern Pacific Border
2 Cascade Mountains
3 Southern Pacific Border
4 Sierra Mountains
5 Columbia Plateau
6 Upper Basin and Range
7 Lower Basin and Range
8 Northern Rocky Mountains
9 Middle Rocky Mountains
10 Wyoming Basin
11 Southern Rocky Mountains
12 Colorado Plateau
13 Rocky Mountain Piedmont
14 Great Plains
15 Black Hills Uplift
16 Upper Missouri Basin and Broken Lands

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Occurrence in North America

AL AK AZ AR CA CO CT DE FL GA ID IL IN IA KS KY LA ME MD MA MI MN MS MO MT NE NV NH NJ NM NY NC ND OH OK OR PA RI SC SD TN TX UT VT VA WA WV WI WY AB BC MB NB NF NT NS ON PE PQ SK YT MEXICO

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Range

This eagle has probably never been particularly common in Britain, as pairs require enormous territories (5). The British population is thought to number around 400 pairs at present (3). Most of these pairs are found in the Scottish Highlands, although more recently a few birds have returned to the Lake District, Cumbria (6). The species is extinct in Ireland, following persecution (3). The golden eagle's world range spreads through the Palaearctic region including mountainous parts of Europe as far south as northern Africa and south-east Asia. It also occurs in North America (3).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

National Distribution

Canada

Origin: Native

Regularity: Regularly occurring

Currently: Present

Confidence: Confident

Type of Residency: Year-round

United States

Origin: Native

Regularity: Regularly occurring

Currently: Present

Confidence: Confident

Type of Residency: Year-round

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 1 person

Average rating: 2.0 of 5

occurs (regularly, as a native taxon) in multiple nations

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 1 person

Average rating: 1.0 of 5

Physical Description

Morphology

Golden eagles are North America's largest predatory bird. They are dark brown raptors with long, broad wings. Their length ranges from 70 to 84 cm, and their wingspan ranges from 185 to 220 cm. Males and females are similar in appearance, but females are much larger than males. Female weight ranges from 3940 to 6125 g whereas male weight ranges from 3000 to 4475 g. Adults are largely dark brown, except for a golden area near the crown, nape and sides of the neck and face. The tail is grayish brown. From below, the large flight feathers of the wings appear to be brownish gray, while the head, body and smaller feathers on the forepart of the open wings are blackish. The eyes of adults are dark brown. The bills and claws are black, while the cere and feet are yellow. The legs are feathered all the way down to the toes.

Juvenile golden eagles appear similar to adults, except for light patches on the tips of the wings, and a wide white band on the tail and a terminal band of black. This plumage is sometimes referred to as its "ringtail" plumage as a result of these bands. Juveniles attain adult plumage between ages 4 and 6 years.

There are 5 or 6 recognized subspecies of the golden eagle. These subspecies are differentiated by geographic distribution, size and coloration. Only one subspecies, Aquila chrysaetos canadensis is found in North America.

Range mass: 3000 to 6125 g.

Range length: 70 to 84 cm.

Range wingspan: 185 to 220 cm.

Other Physical Features: endothermic ; bilateral symmetry ; polymorphic

Sexual Dimorphism: female larger

Average basal metabolic rate: 4.9929 W.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Physical Description

Golden eagles are North America's largest predatory bird. They are dark brown raptors with long, broad wings. Their length ranges from 70 to 84 cm, and their wingspan ranges from 185 to 220 cm. Males and females look similar, but females are much larger than males. Females weigh from 3940 to 6125 g. Males weigh from 3000 to 4475 g. Adults are mostly dark brown. They have a grayish brown tail and golden brown on their heads. Adults have dark brown eyes. Their bills and claws are black and their ceres and feet are yellow. Their legs are covered in feathers all the way down to the toes.

Juvenile golden eagles look similar to adults, but they have light patches on the tips of their wings, and a wide white band on their tails. They begin to look like adults when they are 4 to 6 years old.

There are 5 or 6 subspecies of the golden eagle. Only one subspecies, Aquila chrysaetos canadensis is found in North America.

Range mass: 3000 to 6125 g.

Range length: 70 to 84 cm.

Range wingspan: 185 to 220 cm.

Other Physical Features: endothermic ; bilateral symmetry ; polymorphic

Sexual Dimorphism: female larger

Average basal metabolic rate: 4.9929 W.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: BioKIDS Critter Catalog

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Size

Length: 102 cm

Weight: 4692 grams

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Diagnostic Description

This species differs from the bald eagle in lacking a white head in adults and in lacking white spotting on the underwing coverts in immatures.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Ecology

Habitat

Sierra Madre Occidental Pine-oak Forests Habitat

This taxon is found in the Sierra Madre Occidental pine-oak forests ecoregion, which boasts some of the richest biodiversity anywhere in North America, and contains about two thirds of the standing timber in Mexico. Twenty-three different species of pine and about 200 species of oak reside within the Sierra Madre Occidental pine-oak forests ecoregion.

Pine-oak forests here typically grow on elevations between approximately 1500 and 3300 meters, and occur as isolated habitat islands in northern areas within the Chihuahuan Desert. Soils are typically deep, where the incline allows soil build-up and derived from igneous material, although metamorphic rocks also form part of the soils in the west and northwest portions of the sierra. Steep-sloped mountains have shaped some portions of the Sierra, while others are dominated by their deep valleys, tall canyons and cliffs. These steep-sided cliffs have thinner soils limiting vegetation to chaparral types; characterized by dense clumps of Mexican Manzanita (Arctostaphylos pungens), Quercus potosina and Netleaf Oak (Q. rugosa). There are also zones of natural pasture, with grasses from the genera Arisitida, Panicum, Bromus and Stevis.

The pine-oak forests gradually transform into an oak-grassland vegetative association. Such communities represent an ecological transition between pine-oak forests and desert grasslands..  Here, species such as Chihuahuan Oak (Quercus chihuahuensis), Shin Oak (Q. grisea),  Q. striatula and Emory Oak (Q. emoryi), mark a transition zone between temperate and arid environments, growing in a sparse fashion and with a well-developed herbaceous stratum resembling xeric scrub. Cacti are also part of these transition communities extending well into the woodlands. Some cacti species such as the Little Nipple Cactus (Mammillaria heyderi macdougalii), Greenflower Nipple Cactus (M. viridiflora), Mojave Mound Cactus (Echinocereus triglochidiatus), and Leding's Hedgehog Cactus (E. fendleri var. ledingii) are chiefly centered in these biotic communities. The dominant vegetation in the northernmost part of the ecoregion in the Madrean Sky Islands includes Chihuahua Pine (Pinus leiophylla), Mexican Pinyon (P. cembroides), Arizona Pine (P. arizonica), Silverleaf Oak (Quercus hypoleucoides), Arizona White Oak (Q. arizonica), Emory Oak (Q. emoryi), Netleaf Oak (Q. rugosa), Alligator Juniper (Juniperus deppeana), and Mexican Manzanita (Arctostaphylos pungens).

This ecoregion is an important area for bird richness and bird endemism. Likewise, virtually all of the ecoregion is included in the Sierra Madre Occidental and trans-mexican range Endemic Bird Area. Endemic bird species include the Thick-billed Parrot (Rhynchopsitta pachyrhyncha EN) which is in danger of extinction, with population estimates as low as 500 pairs; the Tufted Jay (Cyanocorax dickeyi NT), Eared Quetzal (Euptilptis neoxenus NT) and the Green-striped Brush Finch (Buarremon virenticeps). Temperate and tropical influences converge in this ecoregion, forming a unique and rich complex of flora and fauna. Many other birds are found in this ecoregion including the Green Parakeet (Aratinga holochlora), Eared Trogon (Euptilotis neoxenus NT), Coppery-tailed Trogon (Trogon elegans), Grey-breasted Jay (Aphelocoma ultramarina), Violet-crowned Hummingbird (Amazilia violiceps), Spotted Owl (Strix occidentalis NT), and Golden Eagle (Aguila chryaetos).  Some species found only in higher montane areas are the Gould's Wild Turkey (Meleagris gallopavo mexicana), Band-tailed Pigeon (Patagioenas fasciata), Mexican Chickadee (Poecile sclateri) and Hepatic Tanager (Piranga flava).

The Sierra Madre Mantled Ground Squirrel (Spermophilus madrensis NT) is an endemic to the Sierra Madre Occidental pine-oak forests, restricted to southwestern Chihuahua, Mexico. The Mexican Gray Wolf (Canis lupus baileyi) and Mexican Grizzly Bear (Ursus horribilis), although considered by most to be extinct from this ecoregion, once roamed these mountains. Mammals also present include White-tailed Deer (Odocoileus virginianus), American Black Bear (Ursus americanus), Buller’s Chipmunk (Tamias bulleri), endemic Zacatecan Deer Mouse (Peromyscus difficilis), rock Squirrel (Spernophilis variegatus), Zacatecas Harvest Mouse (Reithrodontomys zacatecae) and Coati (Nasua nasua), to set forth a subset of mammals present.

Reptiles are also numerous in this ecoregion. Fox´s Mountain Meadow Snake (Adelophis foxi) is an endemic taxon to the ecoregion, only observed at the type locality at four kilometers east of  Mil Diez, about  3.2 kilometers west of El Salto, in southwestern Durango, Mexico. There are at least six species of rattlesnakes including the Mexican Dusky Rattlesnake (Crotalis triseriatus), Mojave Rattlesnake (C. scutulatus), Rock Rattlesnake (C. lepidus), Western Diamondback Rattlesnake (C. atrox), Twin-spotted Rattlesnake (C. pricei), and Ridgenose Rattlesnakes (C. willardi).  Clark's Spiny Lizard (Sceloporus clarkii) and Yarrow's Spiny Lizard (S. jarrovii), Bunchgrass Lizard (S. scalaris), and Striped Plateau Lizard (S. virgatus) are several of the lizards found in the Sierra Madre Occidental pine-oak forests.

Along springs and streams the Western Barking Frog (Craugastor augusti) and the Tarahumara Frog (Rana tamahumarae) are two anuran taxa occurring in the ecoregion. Other anuran taxa found here include: Bigfoot Leopard Frog (Lithobates megapoda), Northwest Mexico Leopard Frog (Lithobates magnaocularis) and the Blunt-toed Chirping Frog (Eleutherodactylus modestus VU). The Sacramento Mountains Salamander (Aneides hardii) is an endemic salamander found in the Sierra Madre Occidental pine-oak forests, restricted to the Sacramento Mountains, Capitan Mountains, and Sierra Blanca in Lincoln and Otero Counties within southern New Mexico, USA.

Creative Commons Attribution Share Alike 3.0 (CC BY-SA 3.0)

© World Wildlife Fund & C. Michael Hogan

Supplier: C. Michael Hogan

Trusted

Article rating from 1 person

Average rating: 5.0 of 5

Sierra de la Laguna Pine-oak Forests Habitat

This taxon is found in the Sierra de la Laguna pine-oak forest, a mountainous ecoregion which rises from the arid Baja California Sur, creating islands of unique vegetative communities. There are approximately 694 plant species, approximately 85 of which are endemic to this ecoregion. Overall species richness is low to moderate, with a total of only 231 vertebrate taxa. The ecoregion is classified in the Tropical and Subtropical Coniferous Forests biome. Much of the pine-oak association remains intact due to the inaccessibility of the rugged and inaccessible terrain.

The topographical features and geological events that gave rise to this particular region are responsible for the diversity of climates and vegetation in the same area. The highest strata of mountains, situated at 1600 to 2000 metres (m) in elevation, are composed of pine-oak forests that transform into oak-pine forests (1200 m) and oak forests (800 m) as elevation decreases. The climate is temperate sub-humid with summer rains and occasional winter rains.

These pine-oak forests constitute the wettest portions in the state of Baja California Sur (760 millimetres of precipitation annually). Slight variations in climatic conditions make up three different vegetation assemblages in the temperate forest. Pine forests at the highest elevations are dominated by Pinus cembroides ssp. lagunae, and understory taxa such as Muhlenbergia spp. and Festuca spp. Pine-oak forests dominated by associations of Pinus cembroides subsp. lagunae with Quercus devia, Arbutus peninsularis, and Quercus tuberculata, and a variety of trees of smaller stature such as Calliandra peninsularis and Mimosa tricephala, with associated shrubs to complement the landscape.

Some of the endemic reptiles are the Southern Alligator Lizard (Elgaria multicarinata) and the Yucca Night Lizard (Xantusia vigilis). Other reptilian taxa found in the Sierra de la Laguna pine-oak forests include the Baja California Rock Lizard (Petrosaurus thalassinus), Baja California Rattlesnake (Crotalus enyo) and the Baja California Brush Lizard (Urosaurus nigricaudus).

Only two amphibian taxa are found in the Sierra de la Laguna pine-oak forests. The Red-spotted Toad (Anaxyrus punctatus) is one anuran found here. The widely distributed California Chorus Frog (Pseudacris cadaverina) is another resident of the ecoregion. One other anuran,  Pseudacris regilla,  was previously recognized in the ecoregion, but erecent DNA analysis has rendered this taxon of unclear distribution.

Of the approximately 30 mammalian species of mammals present, one of them (an endemic bat) lives only in pine-oak forests. The level of endemism is high, and this is well demonstrated by the proportion of endemic species with respect to total recorded species. More than ten percent of the mammalian species found at Sierra de la Laguna are  endemic. One notable mammal found along the far west coast, including California and Baja, is the Ornate Shrew (Sorex ornatus). There are several threatened mammals found in the Sierra de la Laguna pine-oak forests, including: the Mexican Long-tongued Bat (Choeronycteris mexicana NT). The isolation of this region has contributed to the scarcity of predators, and to the poor competitive ability of some animals. Rodents and lagomorphs are virtually absent from the region

The avifauna inhabiting these pine-oak forests is important because half of the bird species breeding at Sierra de la Laguna only utilize pine-oak forests as breeding habitat. The endemic Baja Pygmy Owl (Glaucidium gnoma hoskinsii),  along with the White-winged Dove (Zenaida asiatica) and Golden Eagle (Aquila chrysaetos) are only a few of the avian species found in this ecoregion. Other notable birds in this and the Gulf of California xeric scrub ecoregion include the Xantus's Hummingbird (Hylocharis xantusii) and the endangered Peninsular Yellowthroat (Geothlypis beldingi EN)..

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© C. Michael Hogan & World Wildlife Fund

Supplier: C. Michael Hogan

Trusted

Article rating from 1 person

Average rating: 5.0 of 5

Baja California Desert Habitat

This taxon is found in the Baja California Desert ecoregion, located on most of the western side of the Baja Peninsula, containing varied habitats such as mountains, plains and coastal dunes. This desert is one of the largest and best preserved in Mexico, and due to its isolation, contains a high level of species richness and endemism. A series of ophiolytes  (formations of gabrum, ultramafic rocks, and volcanic lava) surround the most prominent orographic feature: The San Andres mountain range. Overall, the climate is arid with variable temperature. The isolated nature of the peninsula, and its proximity to the sea, maintains a measure of humidity, and creates a stable diurnal temperature.

The predominant vegetation associations are composed of xeric scrub, which have been subdivided in diverse categories according to dominant species and the ecological conditions in which they occur. Thick-stemmed trees and shrubs, growing on rocky volcanic soils, cover the highest parts of the mountain ranges. Dominant plant species are Ambrosia camphorata, Common Stork's-bill (Erodium cicutarium), and Astragalus prorifer.  The Boojumtree (Fouquieria columnaris) can be also found at elevations up to 1200m. Many species of cacti are present. Dominant species within the Baja California Desert vary with elevation. Epiphytes such as Small Ballmoss (Tillandsia recurvata) and Cudbear (Rocella tinctoria) grow in low elevation, humid areas, and account for a majority of the perennial vegetation. Areas previously submerged under the sea (in the Miocene era) are now covered by highly saline and alkaline-tolerant species, such as Ambrosia magdalenae, El Vizcaino Agave (Agave vizcainoensis), Datilillo (Yucca valida), Pitaya Agria (Stenocereus gummosus), and Porter's Muhly (Muhlenbergia porteri). Dune vegetation includes Creosote Bush (Larrea tridentata), Barclay's Saltbush (Atriplex barclayana), Rush Milkweed (Asclepias subulata) and Nicolletia trifida.

There are a number of reptilian taxa found in the Baja California Desert including the endemic Baja California Brush Lizard (Urosaurus lahtelai). The Baja California Legless Lizard (Anniella geronimensis EN) is also endemic to the ecoregion, and is restricted to a narrow strip around 87 kilometres (km) long, ranging from about six km north of Colonia Guerrero, southerly to a point south of Punta Baja at the northern edge of Bahia El Rosario. This legless lizard extends to at most four km inland in the Arroyo Socorro, but otherwise found only in the coastal zone; A. geronimensis also occurs on Isla San Gerónimo. Also found here is the San Lucan Leaf-toed Gecko (Phyllodactylus unctus NT), a species not endemic to the ecoregion, but restricted to the southern Baja Peninsula and the Gulf of California islands of Partida Sur, Gallo, Espiritu Santo, Ballena, Gallina and Cerralvo.

There are only a few amphibians found in the ecoregion. Anuran taxa occurring here include: California Chorus Frog (Pseudacris cadaverina); Pacific Chorus Frog (Pseudacris regilla); and Canyon Treefrog (Hyla arenicolor). Also found here is the Plateau Toad (Anaxyrus compactilis), an endemic to the lower central Mexican Plateau and Baja California Desert; another toad occurring in the ecoregion is the Western Toad (Anaxyrus boreas NT). The Channel Islands Slender Salamander (Batrachoseps pacificus) was earlier thought to occur in this ecoregion, but genetic data shows that this taxon is strictly endemic to the Channel Islands of California.

Endemic mammals include San Quintín Kangaroo Rat (Dipodomys gravipes CR), and Baja California Rock Squirrel (Spermophilus atricapillus EN). Other mammals that are classified as special status are the Lesser Long-nosed Bat (Leptonycteris yerbabuenae VU). Some shallow coastal saltwater lagoons protruding into the Baja California Desert along the Pacific Ocean provide key breeding habitat for the Grey Whale (Eschrichtius robustus CR). One of the largest such breeding waters is the remote San Ignacio Lagoon, extending many kilometres inland and rarely exceeding fifteen metres in depth.

Important sites for avian conservation include the Ojo de Liebre lagoon, along the Pacific coast, which is home to millions of overwintering ducks and geese. Bird species in the Baja California Desert include such notable raptor taxa as Golden Eagle (Aquila chrysaetos), Peregrine Falcon (Falco peregrinus), Southern Crested Caracara (Caracara plancus), Osprey (Pandion haliaeutus), and Burrowing Owl (Athene cunicularia).

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© C. Michael Hogan & World Wildlife Fund

Supplier: C. Michael Hogan

Trusted

Article rating from 1 person

Average rating: 5.0 of 5

Golden eagles are found in open and semi-open habitats from sea level to 3600 m elevation. Habitat types that they inhabit include tundra, shrublands, grasslands, woodland-brushlands, and coniferous forests. Most golden eagles are found in mountainous areas, but they also nest in wetland, riparian and estuarine habitats.

Range elevation: 0 to 3600 m.

Habitat Regions: temperate ; polar ; terrestrial

Terrestrial Biomes: tundra ; taiga ; savanna or grassland ; chaparral ; forest ; mountains

Wetlands: marsh

Other Habitat Features: suburban ; agricultural ; riparian ; estuarine

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Habitat and Ecology

Habitat and Ecology

Behaviour This is the most widespread of the Aquila eagles, ranging across the Nearctic and Palearctic (70°N to 20°S), and fringing Indomalaya and the Afrotropics. It is uncommon to scarce across its range. In general, the species is sedentary, with juveniles dispersing as far as 1000km in their first few years. Birds occupying the mostly northerly regions (>65°N), such as Alaska, northern Canada, Fennoscandia and northern Russia, migrate south. In the Nearctic there are southwards movements to southern Alaska and southwest USA in September, via regular flyways, in particular through southwest Alberta. In the Palearctic, movements occur in a broad front to wintering areas in southeast Europe, the Russian steppes, Mongolia, northern China and Japan. Juveniles and immatures will go as far as North Africa (Ferguson- Lees and Christie, 2001). Habitat The species occupies a wide range of flat or mountainous, largely open habitats, often above the tree line, from sea level to 4000m. In the Himalayas it has been recorded as high as 6200m (Watson, 2010). Diet The species’ diet is very broad, taking mammals, birds, reptiles, fish, amphibians, insects and carrion variously, depending on the regional prey availability. Prey taken are usually 0.5-4.0 kg and the species can hunt in pairs or small groups (Ferguson- Lees and Christie, 2001). Breeding Site Nesting occurs on cliff ledges and where these are not available, in large trees or similar artificial structures. Nests are constructed from sticks and are added to in successive years, growing to 2m in diameter. The breeding season spans March – August throughout the majority of its range, and in southern areas begins as early as November; whilst in the most northerly regions it will start as late as April (Ferguson- Lees and Christie, 2001).


Systems
  • Terrestrial
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Habitat Type: Terrestrial

Comments: Golden eagles generally inhabit open and semi-open country such as prairies, sagebrush, arctic and alpine tundra, savannah or sparse woodland, and barren areas, especially in hilly or mountainous regions, in areas with sufficient mammalian prey base and near suitable nesting sites. In Nevada, the only habitats routinely avoided by golden eagles are forests, large agricultural areas, and urban areas (GBBO 2010).

Nests are most often on rock ledges of cliffs but sometimes in large trees (e.g., oak or eucalytus in California, white pine in eastern North America), on steep hillsides, or on the ground. Nesting cliffs may face any direction and may be close to or distant from water. In Elko County, Nevada, 93 percent of nests were on cliffs, 71 percent were at elevations between 5,000 feet and 6,500 feet, and 43 percent faced east; 84 percent of nests were within two miles of water with desert riparian habitat (Page and Seibert 1973).

A pair may have multiple alternate nests; the pair may use the same or alternate nests in consecutive years.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Golden eagles live in open and semi-open habitats from sea level to 3600 m elevation. They can be found in habitats such as tundra, shrublands, grasslands, woodland-brushlands, and coniferous forests. Most golden eagles are found in mountainous areas, but they also nest in wetland, riparian and estuarine habitats.

Range elevation: 0 to 3600 m.

Habitat Regions: temperate ; polar ; terrestrial

Terrestrial Biomes: tundra ; taiga ; savanna or grassland ; chaparral ; forest ; mountains

Wetlands: marsh

Other Habitat Features: suburban ; agricultural ; riparian ; estuarine

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: BioKIDS Critter Catalog

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Cover Requirements

More info for the terms: cover, shrub, tree

Golden eagles use elevated nest sites, especially sheltered ledges on
secluded cliffs, that are isolated from human disturbance and are close
to hunting areas [8,24]. Golden eagles are most efficient predators in
open areas where winds and thermal updrafts aid flying. They are less
efficient where shrub and/or tree cover increases. Abundant shrub cover
provides hiding and escape cover for prey. Physical obstructions close
to the ground make hunting difficult [18].
  • 8. DeGraaf, Richard M.; Scott, Virgil E.; Hamre, R. H.; [and others]
  • 18. Matchett, Marc R.; O'Gara, Bart W. 1991. Golden eagles and the livestock industry: an emotionally charged issue. Western Wildlands. 17(1): 18-24. [22519]
  • 24. Spofford, Walter R. 1971. The golden eagle--rediscovered. Conservationist. 26(1): 6-8. [22516]

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Preferred Habitat

More info for the term: tundra

The golden eagle inhabits open country from barren areas to open
coniferous forests. They are primarily in hilly and mountainous
regions, but also in rugged deserts, on the plains, and in tundra. The
golden eagle prefers cliffs and large trees with large horizontal
branches and for roosting and perching [8].

Nesting habitat - The golden eagle nests on cliff ledges, preferably
overlooking grasslands; 10 to 100 feet (3-30 m) above ground in dead or
live trees; in artifical structures; or on the ground [8,7,27]. In
western mountains, golden eagles nest at elevations of 4,000 to 10,000
feet (1,219-3,048 m). Pairs may use the same nest year after year or
use alternate nests in successive years [8].

Golden eagles are most likely to use trees for nesting if cliff sites
are unavailable. In the Powder River Basin of Wyoming, 67 percent of
golden eagle nests were found in deciduous trees; 22 percent in
ponderosa pine (Pinus ponderosa); and 4 percent on the ground [19].
Near Medicine Bow, Wyoming, 60 percent of golden eagle nests were on
cliffs [17]. In Campbell and Converse counties, Wyoming, 57 percent of
occupied nests were found in deciduous trees along drainages and 25
percent were in ponderosa pine trees. The remaining nests were on rock
outcrops and peaks (8%), artifical structures (7%), and creekbanks (3%).
In Campbell and Converse counties golden eagles preferred to nest in
large pines when both cottonwoods and pines were available. Large dense
stands of both cottonwoods and pines were avoided as nest areas.
Isolated or scattered trees were preferred [22]. In the Coast Ranges
of California, the golden eagle nests almost exclusively in trees [21].

Foraging habitat - The golden eagle generally forages in open habitats
where rabbits and small rodents are available. During the nesting
season the golden eagle usually forages within 4.4 miles (7 km) of the
nest [7]. Trees, live or dead, are often used for perches if they are
near open areas where prey can be easily seen [30].

Winter habitat - Winter habitat requirements for the golden eagle are
very similar to nesting habitat requirements. In the East the golden
eagle generally winters on coastal plains and wetlands [7].
  • 7. Cooperrider, Allen Y.; Boyd, Raymond J.; Stuart, Hanson R., eds. 1986. Inventory and monitoring of wildlife habitat. Denver, CO: U.S. Department of the Interior, Bureau of Land Management, Service Center. 858 p. [3441]
  • 8. DeGraaf, Richard M.; Scott, Virgil E.; Hamre, R. H.; [and others]
  • 17. MacLaren, Patricia A.; Anderson, Stanley H.; Runde, Douglas E. 1988. Food habits and nest characteristics of breeding raptors in southwestern Wyoming. Great Basin Naturalist. 48(4): 548-553. [22268]
  • 19. Menkens, George E.; Anderson, Stanley H. 1983. How selective are golden eagles when choosing a nest site?. Journal of the Colorado-Wyoming Academy of Science. 15(1): 55-56. Abstract. [22518]
  • 21. Palmer, Ralph S., editor. 1988. Handbook of North American birds. Volume 5. New Haven, CT: Yale University Press. 463 p. [22303]
  • 22. Phillips, Robert L.; Beske, Alan E. 1990. Distribution and abundance of golden eagles and other raptors in Campbell and Converse Counties, Wyoming. Fish and Wildlife Technical Report 27. Washington, DC: U.S. Department of the Interior, Fish and Wildlife Service. 31 p. [15473]
  • 27. Verner, Jared; Boss, Allan S., tech. coords. 1980. California wildlife and their habitats: western Sierra Nevada. Gen. Tech. Rep. PSW-37. Berkeley, CA: U.S. Department of Agriculture, Forest Service, Pacific Southwest Forest and Range Experiment Station. 439 p. [10237]
  • 30. McClelland, B. R. 1994 [pers. comm.]

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Associated Plant Communities

The golden eagle occupies a variety of plant communities including
tundra, alpine meadows, coniferous forests, shortgrass prairies and
other grasslands, sagebrush (Artemisia spp.) plateaus, sagebrush steppe
with scattered ponderosa pine (Pinus ponderosa) and cottonwoods (Populus
spp.), shrublands, oak (Quercus spp.) woodlands, pinyon-juniper (Pinus
spp.-Juniperus spp.) woodlands, and semidesert canyons [6,7,21,27,28].
In California the golden eagle favors grasslands, shrublands with tree
saplings, and open-canopy blue oak (Quercus douglasii) woodlands. In
late summer the golden eagle is often seen above timberline in
California [27]. Major vegetation types occupied by the golden eagle
during the nesting season in the Snake River Birds of Prey Area, Idaho,
from 1977 through 1979 include big sagebrush (Artemisia tridentata),
grassland (Poa and Bromus spp.), and shadscale (Atriplex confertifolia) [6].
  • 6. Collopy, Michael W. 1984. Parental care and feeding ecology of golden eagle nesting. Auk. 101(4): 753-760. [22283]
  • 7. Cooperrider, Allen Y.; Boyd, Raymond J.; Stuart, Hanson R., eds. 1986. Inventory and monitoring of wildlife habitat. Denver, CO: U.S. Department of the Interior, Bureau of Land Management, Service Center. 858 p. [3441]
  • 21. Palmer, Ralph S., editor. 1988. Handbook of North American birds. Volume 5. New Haven, CT: Yale University Press. 463 p. [22303]
  • 27. Verner, Jared; Boss, Allan S., tech. coords. 1980. California wildlife and their habitats: western Sierra Nevada. Gen. Tech. Rep. PSW-37. Berkeley, CA: U.S. Department of Agriculture, Forest Service, Pacific Southwest Forest and Range Experiment Station. 439 p. [10237]
  • 28. Wassink, Jan. 1991. Birds of the central Rockies. Missoula, MT: Mountain Press Publishing. 179 p. [22307]

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Habitat: Cover Types

More info on this topic.

This species is known to occur in association with the following cover types (as classified by the Society of American Foresters):

More info for the term: cover

occurs in most SAF cover types

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Habitat: Plant Associations

More info on this topic.

This species is known to occur in association with the following plant community types (as classified by Küchler 1964):

occurs in most Kuchler Plant Associations

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Habitat: Ecosystem

More info on this topic.

This species is known to occur in the following ecosystem types (as named by the U.S. Forest Service in their Forest and Range Ecosystem [FRES] Type classification):

FRES10 White-red-jack pine
FRES11 Spruce-fir
FRES12 Longleaf-slash pine
FRES13 Loblolly-shortleaf pine
FRES14 Oak-pine
FRES15 Oak-hickory
FRES16 Oak-gum-cypress
FRES17 Elm-ash-cottonwood
FRES18 Maple-beech-birch
FRES19 Aspen-birch
FRES20 Douglas-fir
FRES21 Ponderosa pine
FRES22 Western white pine
FRES23 Fir-spruce
FRES24 Hemlock-Sitka spruce
FRES25 Larch
FRES26 Lodgepole pine
FRES27 Redwood
FRES28 Western hardwoods
FRES29 Sagebrush
FRES30 Desert shrub
FRES31 Shinnery
FRES32 Texas savanna
FRES33 Southwestern shrubsteppe
FRES34 Chaparral-mountain shrub
FRES35 Pinyon-juniper
FRES36 Mountain grasslands
FRES37 Mountain meadows
FRES38 Plains grasslands
FRES39 Prairie
FRES40 Desert grasslands
FRES41 Wet grasslands
FRES42 Annual grasslands
FRES44 Alpine

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Breeds in mountainous areas and upland forests (2). In the UK it occurs mainly in uplands, but a handful of pairs are found in coastal habitats (3).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Migration

Non-Migrant: Yes. At least some populations of this species do not make significant seasonal migrations. Juvenile dispersal is not considered a migration.

Locally Migrant: Yes. At least some populations of this species make local extended movements (generally less than 200 km) at particular times of the year (e.g., to breeding or wintering grounds, to hibernation sites).

Locally Migrant: Yes. At least some populations of this species make annual migrations of over 200 km.

Migratory populations may exist in areas where the species is present throughout the year, so specific migration patterns may be obscure. Northernmost populations withdraw southward for winter (some individuals may remain in north); these migrants may migrate farther south than do birds from breeding populations to the south; migrants return to northern breeding areas mainly in March-April. Most vacate hot deserts during summer.

In predatory bird surveys over 12 months in the eastern Mohave Desert, San Bernardino County, California, Knight et al. (1999) observed golden eagles only during November and December, despite the species being a regular nesting bird in the Mohave Desert. The low number of observations may have reflected a naturally low density of eagles, lack of overlap of survey routes with eagle territories, or seasonal migrations of eagles between summer nesting areas in desert mountains and wintering areas in desert basins (Knight et al. 1999). See Palmer (1988) for discussion of seasonal movements.

A juvenile from Denali National Park, Alaska, migrated through Yukon Territory and interior British Columbia to a wintering site in east-central Idaho; another juvenile migrated through the Yukon, Alberta, and Saskatchewan to northeastern Montana (Britten et al. 1995).

Territory size in several areas of the western United States averaged 57-142 sq km (Palmer 1988). In desert regions, territories may be much larger (e.g., 258-310 sq km; see Wildlife Research Institute 2010).

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Trophic Strategy

The diet of golden eagles is composed primarily of small mammals such as rabbits, hares, ground squirrels, prairie dogs, and marmots. They also eat birds, reptiles and fish in smaller numbers. Golden eagles occasionally capture large prey, including seals (Phocoidea), ungulates, coyotes and badgers. They have also been known to capture large flying birds such as geese or cranes. A pair of eagles will often hunt together; one chases the prey to exhaustion, and the other swoops down for the kill. Golden eagles rarely cache prey for later consumption.

Animal Foods: birds; mammals; reptiles; fish

Primary Diet: carnivore (Eats terrestrial vertebrates)

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Comments: The diet consists promarily of small mammals (e.g., rabbits, marmots, ground squirrels) but sometimes also includes large insects, snakes, birds, juvenile ungulates, and carrion. In the western Great Basin, the four most frequent prey species were black-tailed jackrabbit, mountain cottontail, yellow-bellied marmot, and chukar; Lagomorpha accounted for 91 percent of the prey biomass (Bloom and Hawks 1982). Golden eagles rarely attack large, healthy mammals (e.g., pigs, sheep, deer) (Terres 1980). Individual can fast for days between feedings. They hunt while soaring or from a perch (the latter especially used by young), and individuals may hunt cooperatively. See Palmer (1988) for further details.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Food Habits

Golden eagles mostly eat small mammals such as Leporidae, Sciuridae. They also eat some birds, reptiles and fish. Sometimes, golden eagles capture large prey, including seals (Phocoidea), ungulates, Canis latrans and Taxidea taxus. They have also been known to capture large flying birds such as geese or Gruidae.

A pair of eagles will often hunt together. One chases the prey until it is exhausted, then the other swoops down to kill it. Golden eagles don’t usually store prey to eat later.

Animal Foods: birds; mammals; reptiles; fish

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: BioKIDS Critter Catalog

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Food Habits

The golden eagle feeds primarily on mammals. It feeds mainly on
lagomorphs and small rodents, but also on marmots (Marmota spp.),
prairie dogs (Cynomys spp.), ground squirrels (Spermophilus spp.),
weasels (Mustela spp.), woodrats (Neotoma spp.), skunks, mice, and
rarely, large mammals. The golden eagle also eats grouse, pheasants
(Phasianus spp.), owls, hawks, rock dove (Columba livia), magpies (Pica
spp.), and other birds as well as rattlesnakes, frogs, carrion, and
occasionally, fish [4,8,9,21,27].
  • 4. Brown, Bryan T. 1992. Golden eagles feeding on fish. Journal of Raptor Research. 26(1): 36-37. [22173]
  • 8. DeGraaf, Richard M.; Scott, Virgil E.; Hamre, R. H.; [and others]
  • 9. Dunstan, Thomas C. 1989. The golden eagle. In: Audubon wildlife report: 1989/1990: 499-511. On file with: U.S. Department of Agriculture, Forest Service, Intermountain Research Station, Fire Sciences Laboratory, Missoula, MT. [22392]
  • 21. Palmer, Ralph S., editor. 1988. Handbook of North American birds. Volume 5. New Haven, CT: Yale University Press. 463 p. [22303]
  • 27. Verner, Jared; Boss, Allan S., tech. coords. 1980. California wildlife and their habitats: western Sierra Nevada. Gen. Tech. Rep. PSW-37. Berkeley, CA: U.S. Department of Agriculture, Forest Service, Pacific Southwest Forest and Range Experiment Station. 439 p. [10237]

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Associations

Golden eagles impact the local populations of the animals that they prey on. They may also compete with other species for prey and habitat. For example, golden eagles may compete with bald eagles, coyotes, California condors, and white-tailed eagles for prey items. They most likely also compete with common ravens, gyrfalcons, peregrine falcons, rough-legged hawks and other species for territories.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Golden eagles have few predators. There is no record of predation of golden eagle eggs, and few records of adult or nestling predation. Wolverines and grizzly bears are the only recorded predators of golden eagle nestlings.

Known Predators:

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Ecosystem Roles

Golden eagles impact the populations of the animals that they prey on. They may also compete with other species for prey and habitat, including Haliaeetus leucocephalus, Canis latrans, Gymnogyps californianus, and Haliaeetus albicilla. They also probably compete with other large birds for habitat. These other birds Corvus corax, Falco rusticolus, Falco peregrinus, Buteo lagopus and other species.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: BioKIDS Critter Catalog

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Predation

Golden eagles have few predators. There is no record of predation of golden eagle eggs, and few records of adult or nestling predation. Gulo gulo and Ursus arctos are the only recorded predators of golden eagle nestlings.

Known Predators:

  • wolverines (Gulo_gulo)
  • grizzly bears (Ursus_arctos)

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: BioKIDS Critter Catalog

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Known prey organisms

Aquila chrysaetos preys on:
Marmota
Lepus californicus
Lepus townsendii
Sylvilagus
Spermophilus
Mammalia
Aves
Serpentes
Anser anser
Larus californicus
Tyto alba
Corvus corax
Nucifraga columbiana
Spermophilus beecheyi
Spermophilus washingtoni
Capra ibex
Marmota bobak
Marmota caudata

Based on studies in:
USA: Montana (Tundra)
USA: California, Cabrillo Point (Grassland)
USA: California, Coachella Valley (Desert or dune)

This list may not be complete but is based on published studies.
  • L. D. Harris and L. Paur, A quantitative food web analysis of a shortgrass community, Technical Report No. 154, Grassland Biome. U.S. International Biological Program (1972), from p. 17.
  • D. L. Pattie and N. A. M. Verbeek, Alpine birds of the Beartooth Mountains, Condor 68:167-176 (1966); Alpine mammals of the Beartooth Mountains, Northwest Sci. 41(3):110-117 (1967).
  • Polis GA (1991) Complex desert food webs: an empirical critique of food web theory. Am Nat 138:123–155
  • Myers, P., R. Espinosa, C. S. Parr, T. Jones, G. S. Hammond, and T. A. Dewey. 2006. The Animal Diversity Web (online). Accessed February 16, 2011 at http://animaldiversity.org. http://www.animaldiversity.org
Creative Commons Attribution 3.0 (CC BY 3.0)

© SPIRE project

Source: SPIRE

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Population Biology

Number of Occurrences

Note: For many non-migratory species, occurrences are roughly equivalent to populations.

Estimated Number of Occurrences: 81 to >300

Comments: The global number of occurrences has not been precisely determined using standardized criteria, but this species clearly is represented by a large number of occurrences (subpopulations).

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Global Abundance

10,000 to >1,000,000 individuals

Comments: North American population in the mid-1980s was estimated at about 70,000; perhaps about 20,000 breeding pairs occur in the western United States. De Smet (1987 COSEWIC report) gave an estimate of 50,000-100,000 for North America. Kirk et al. (1995) reported that the estimated number of breeding pairs in Canada was 1,000-5,000. Rich et al. (2004) estimated global population size at 170,000, with approximately half of the total in the United States and Canada.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

General Ecology

Habitat-related Fire Effects

The golden eagle occurs in the following six major fire-dependent plant
associations in the western United States: grassland, semidesert
grassland-shrub, sagebrush-grassland, pinyon-juniper woodland, and
ponderosa pine and Douglas-fir (Pseudotsuga menziesii) forests [29].

In addition to potentially affecting nest trees, fire may kill perch and
roosting trees. These snags are used by golden eagles for nesting,
perching and/or roosting. Use of trees probably depends more on
proximity to prey than condition (live or dead). Migrating golden
eagles use fire-killed snags near openings for perching and roosting in
subalpine areas of Glacier National Park, Montana [30].

Fires probably enhance the prey base and hunting efficiency of golden
eagles. Regular burning helps to keep habitats in a suitable condition
for many prey species of the golden eagle and increases hunting
efficiency [15]. In forested areas of the East, golden eagles forage on
burns, though they may prefer bogs [21]. Golden eagles were seen using
recently burned sites in the Lincoln National Forest, New Mexico.
Golden eagles there were probably taking advantage of abundant prey
associated with the growth of new vegetation on the burned site [29].
Fire suppression in this century has contributed to the loss of golden
eagle breeding pairs in the Appalachian Mountains of the eastern United
States. Historically, open areas used by golden eagles for foraging in
those mountains were maintained by fire. After full suppression
policies began, the openings reverted to brush and eventually to
forest. Today, there are few openings in the Appalachian Mountains; as
a result, the golden eagle has almost disappeared [24].
  • 15. Landers, J. Larry. 1987. Prescribed burning for managing wildlife in southeastern pine forests. In: Dickson, James G.; Maughan, O. Eugene, eds. Managing southern forests for wildlife and fish: a proceedings; [Date of conference unknown]
  • 21. Palmer, Ralph S., editor. 1988. Handbook of North American birds. Volume 5. New Haven, CT: Yale University Press. 463 p. [22303]
  • 24. Spofford, Walter R. 1971. The golden eagle--rediscovered. Conservationist. 26(1): 6-8. [22516]
  • 29. Lehman, Robert N.; Allendorf, John W. 1989. The effects of fire, fire exclusion and fire management on raptor habitats in the western United States. In: Proceedings of the western raptor management symposium and workshop; 1987 October 26-28; Boise, ID. Scientific and Technical Series No. 12. Washington, DC: National Wildlife Federation: 236-244. [22324]
  • 30. McClelland, B. R. 1994 [pers. comm.]

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Timing of Major Life History Events

More info for the term: cohort

Age at sexual maturity - Golden eagles are sexually mature at
4 or more years of age [16].

Breeding season - The golden eagle breeding season generally occurs from
mid-January to mid-September, but varies according to geographic area
[22,27].

Clutch size and incubation - The golden eagle lays one to three eggs,
with two eggs most common [9,21,27]. The eggs are incubated for 35 to
45 days [9].

Fledging - Nestlings fledge at 9 to 10 weeks and remain in the vicinity
of the nest. The parents provide food for the fledglings until they are
about 14 weeks old or older [9].

Migration - Migration varies with population and cohort and is a
function of both food supply and climate. Golden eagles in the
subarctic and at least some golden eagles of all ages in northern boreal
areas migrate. They travel south along high ridges in the Intermountain
West during September and October. In the East they traverse the ridges
of the Appalachians to the southern highlands from September through
November. In a zone near the United States-Canada boundary, resident
breeders and older prebreeders migrate short distances in severe winters
and/or when food is scarce [21]. In the mountainous West, golden eagles
often move down from the mountains onto the plains and valleys during
the winter [8]. Breeding golden eagles prefer to maintain their
nesting-hunting territories or travel the shortest distance necessary to
survive prolonged cold or heat, while older prebreeders may be less tied
to specific locations. Birds of the youngest cohort are often
migratory. In the arid Southwest, golden eagles move to high elevations
after breeding [21].

Longevity - Golden eagles in captivity have lived 41 to 48 years, but it
is unlikely that many live that long in the wild [9].
  • 8. DeGraaf, Richard M.; Scott, Virgil E.; Hamre, R. H.; [and others]
  • 9. Dunstan, Thomas C. 1989. The golden eagle. In: Audubon wildlife report: 1989/1990: 499-511. On file with: U.S. Department of Agriculture, Forest Service, Intermountain Research Station, Fire Sciences Laboratory, Missoula, MT. [22392]
  • 16. Lee, David S.; Spofford, Walter R. 1990. Nesting of golden eagles in the central and southern Appalachians. Wilson Bulletin. 102(4): 693-698. [22325]
  • 21. Palmer, Ralph S., editor. 1988. Handbook of North American birds. Volume 5. New Haven, CT: Yale University Press. 463 p. [22303]
  • 22. Phillips, Robert L.; Beske, Alan E. 1990. Distribution and abundance of golden eagles and other raptors in Campbell and Converse Counties, Wyoming. Fish and Wildlife Technical Report 27. Washington, DC: U.S. Department of the Interior, Fish and Wildlife Service. 31 p. [15473]
  • 27. Verner, Jared; Boss, Allan S., tech. coords. 1980. California wildlife and their habitats: western Sierra Nevada. Gen. Tech. Rep. PSW-37. Berkeley, CA: U.S. Department of Agriculture, Forest Service, Pacific Southwest Forest and Range Experiment Station. 439 p. [10237]

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Life History and Behavior

Behavior

Golden eagles are mostly silent, except during the breeding season. They use nine different calls to communicate. Most calls appear to be associated with food delivery to nestlings and begging by the nestlings.

Golden eagles don't appear to use vocalizations to mark their territory. Instead, they use an undulating flight to defend the boundaries of their territory.

Communication Channels: visual ; acoustic

Perception Channels: visual ; tactile ; acoustic ; chemical

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Communication and Perception

Golden eagles are mostly silent, except during the breeding season. They use nine different calls to communicate. Most calls appear communicate about food. Golden eagles don't use vocalizations to mark their territory. Instead, they mark the edges of their territory by flying around them.

Communication Channels: visual ; acoustic

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: BioKIDS Critter Catalog

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Cyclicity

Comments: Foraging commonly occurs in early morning and early evening.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Life Expectancy

The oldest known golden eagle lived to 46 years in captivity. In the wild, golden eagles have been known to live up to 32 years.

Range lifespan

Status: wild:
48 (high) years.

Range lifespan

Status: captivity:
46 (high) years.

Average lifespan

Status: wild:
340 months.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Lifespan/Longevity

The oldest known golden eagle lived to 46 years in captivity. In the wild, golden eagles have been known to live up to 32 years.

Range lifespan

Status: wild:
48 (high) years.

Range lifespan

Status: captivity:
46 (high) years.

Average lifespan

Status: wild:
340 months.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: BioKIDS Critter Catalog

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Lifespan, longevity, and ageing

Maximum longevity: 48 years (captivity) Observations: In captivity, these animals have been reported to live up to 48 years (http://www.fs.fed.us/database/feis/).
Creative Commons Attribution 3.0 (CC BY 3.0)

© Joao Pedro de Magalhaes

Source: AnAge

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Reproduction

Golden eagles are monogamous, and may maintain pair bonds for several years. In non-migrant populations, pairs appear to stay together year round. For migratory golden eagles, pair formation and courtship begin when the eagles return to the breeding grounds, between February and mid-April. There is no information available regarding whether pair bonds are maintained year-round in migratory populations. Courtship activities in this species include undulating flight by one or both members of the pair, chases, dives, mock attacks, presenting talons, soaring together and circling.

Mating System: monogamous

Golden eagles breed from March through August, depending on their geographic location. Golden eagle pairs in much of the range are sedentary, remaining in the same territory year round. These pairs may begin nest-building and courtship as early as December. For migratory golden eagles, pair formation and courtship begin when the eagles return to the breeding grounds, between February and mid-April. Pairs may have several nests in their breeding territory and often re-use nests year after year, refurbishing them before each breeding season. Golden eagles usually build their nests on cliffs, but may also use trees, riverbanks and man-made structures, such as windmills, observation towers, nest platforms, and electrical towers. Nests are built 0 to 107 m off the ground. Both the male and female of a pair refurbish or build the nest, which may take 4 to 6 weeks. Nests are constructed of sticks and local vegetation and lined with soft vegetation, including shredded yucca, grasses, dry yucca leaves, inner bark, dead and green leaves, mosses and lichens. Nests may be huge if the site allows. The largest nest on record measured 6.1 m tall and 2.59 m wide.

The female lays 1 to 4 (usually 2) eggs, with 3 to 4 day intervals between each egg. The female begins incubating after the first egg is laid, and is responsible for most of the incubation, though the male often takes part. The eggs are dull white and spotted or blotched with brown or reddish brown. Incubation lasts for 35 to 45 days (average 42 days). The young hatch several days apart, and are altricial. The older nestlings are usually much larger than the younger nestlings, and the older, stronger eaglets often kill their smaller siblings. The chicks are brooded by the female with decreasing frequency for the first 45 days or so. Both parents bring food to the nestlings. The nestlings begin to leave the nest between 45 and 81 days of age by walking, hopping or falling out of the nest. They begin to fly around 10 weeks of age, and become independent from the parents 32 to 80 days after fledging. Juveniles do not breed until age 4 to 7 years, after attaining adult plumage.

Breeding interval: Golden eagles breed once yearly.

Breeding season: Golden eagles breed from March through August, depending on their geographic location.

Range eggs per season: 1 to 4.

Average eggs per season: 2.

Range time to hatching: 35 to 45 days.

Average time to hatching: 42 days.

Range fledging age: 45 to 81 days.

Range time to independence: 32 to 80 days.

Range age at sexual or reproductive maturity (female): 4 to 7 years.

Range age at sexual or reproductive maturity (male): 4 to 7 years.

Key Reproductive Features: iteroparous ; seasonal breeding ; gonochoric/gonochoristic/dioecious (sexes separate); sexual ; oviparous

Average eggs per season: 2.

Female golden eagles are primarily responsible for incubation, though males may do some of the incubation. The female also broods the chicks for much of the time in the first 45 days after hatching. Both parents bring food to the nest, though the male provides the majority of food, especially in the first few weeks after hatching.

Parental Investment: altricial ; pre-fertilization (Provisioning, Protecting: Female); pre-hatching/birth (Protecting: Male, Female); pre-weaning/fledging (Provisioning: Male, Female, Protecting: Male, Female); pre-independence (Provisioning: Male, Female, Protecting: Male, Female)

  • Kochert, M., K. Steenhof, C. McIntyre, E. Craig. 2002. Golden Eagle (Aquila chrysaetos). Pp. 1-44 in A Poole, F Gill, eds. The Birds of North America, Vol. 684. Philadelphia: The Birds of North America.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Egg dates: by late April in northern Alaska (later if snow persists); peak in late February-March in the region from California to Texas (but earlier nesting may yield young ready to fly as early as March 1 in Texas); late February-early March in Utah; March-April in northeastern United States. Clutch size is 1-3, rarely 4 (usually 2). Incubation, mostly by the female, lasts about 43-45 days. Young can fly at 60-77 days (fledging takes longer in the far north than in the southern part of the range). Young are cared for by parents for 30+ additional days; family unit sometimes may remain together several months. Typically first breeds in 4th or 5th year. Lifelong monogamy may be the rule, though some apparent exceptions have been recorded. A positive correlation between breeding success and jackrabbit number was reported in Idaho, Colorado, and Utah. Distance between active nests almost never is less than 0.8 km. See Palmer (1988) for further details on reproduction.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Golden eagles are monogamous, and pairs may breed together for several years. In sedentary populations, pairs stay together year round. Golden eagle courtship includes the pair flying together, chasing, diving and pretending to attach each other.

Mating System: monogamous

Golden eagles breed between March and August. Some golden eagles are sedentary, remaining in the same territory all year. These eagles may begin building their nests and forming pairs as early as December. Migratory golden eagles don’t begin pair formation and courtship until they return to the breeding grounds in early spring. Many pairs re-use the same nest for many years. Golden eagles usually build their nests on cliffs, but may also use trees, riverbanks and man-made structures, such as windmills, observation towers, nest platforms, and electrical towers. Nests are built 0 to 107 m off the ground. The male and female both build the nest. This takes 4 to 6 weeks. Nests are made of sticks and lined with soft vegetation, such as grasses, dry yucca leaves, inner bark, dead and green leaves, mosses and lichens. Some golden eagle nests are huge. The largest nest was 6.1 m tall and 2.59 m wide.

The female lays 1 to 4 (usually 2) eggs. She lays one egg every 3 to 4 days. The female incubates the eggs for 35 to 45 days (average 42 days). The chicks hatch several days apart, and are helpless (altricial). The older nestlings are usually much larger than the younger nestlings, and the older, stronger eaglets often kill the smaller chicks. The female parent broods the chicks regularly for up the first 45 days or so. Both parents bring food to the nestlings. The nestlings begin to leave the nest when they are 45 to 81 days old. They first leave the nest by walking, hopping or falling out of it. They begin to fly when they are about 10 weeks old, and become independent from their parents 32 to 80 days after fledging. Golden eagles begin to breed when they are 4 to 7 years old.

Breeding interval: Golden eagles breed once yearly.

Breeding season: Golden eagles breed from March through August, depending on their geographic location.

Range eggs per season: 1 to 4.

Average eggs per season: 2.

Range time to hatching: 35 to 45 days.

Average time to hatching: 42 days.

Range fledging age: 45 to 81 days.

Range time to independence: 32 to 80 days.

Range age at sexual or reproductive maturity (female): 4 to 7 years.

Range age at sexual or reproductive maturity (male): 4 to 7 years.

Key Reproductive Features: seasonal breeding ; gonochoric/gonochoristic/dioecious (sexes separate)

Average eggs per season: 2.

The female golden eagle of a pair does most of the incubation. She also broods the chicks much of the time for the first 45 days after hatching. Both parents bring food to the nest, but the male provides more food than the female.

Parental Investment: altricial ; pre-fertilization (Provisioning, Protecting: Female); pre-hatching/birth (Protecting: Male, Female); pre-weaning/fledging (Provisioning: Male, Female, Protecting: Male, Female); pre-independence (Provisioning: Male, Female, Protecting: Male, Female)

  • Kochert, M., K. Steenhof, C. McIntyre, E. Craig. 2002. Golden Eagle (Aquila chrysaetos). Pp. 1-44 in A Poole, F Gill, eds. The Birds of North America, Vol. 684. Philadelphia: The Birds of North America.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: BioKIDS Critter Catalog

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Barcode data: Aquila chrysaetos

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There are 7 barcode sequences available from BOLD and GenBank.

Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.

See the BOLD taxonomy browser for more complete information about this specimen and other sequences.

GTGACACTTATCAATCGATGACTATTCTCAACCAACCACAAAGACATCGGCACTCTATACCTAATCTTCGGCGCATGGGCTGGCATAGTCGGCACCGCCCTTAGCCTTCTTATCCGCGCAGAACTTGGCCAACCTGGCACCCTCTTAGGCGATGACCAAATCTACAATGTAATCGTCACCGCTCATGCTTTCGTAATAATCTTCTTCATAGTCATACCAATCATAATTGGAGGCTTTGGAAACTGACTTGTCCCACTCATAATTGGCGCCCCCGACATAGCCTTCCCACGCATAAACAACATGAGCTTCTGATTACTCCCCCCATCCTTCCTCCTCCTACTAGCCTCTTCAACAGTAGAAGCAGGGGCTGGCACCGGGTGGACTGTCTACCCCCCACTAGCCGGCAACATAGCCCACGCCGGCGCTTCGGTAGACCTAGCTATCTTTTCCCTCCATCTAGCAGGTATCTCATCCATCTTAGGGGCCATTAACTTTATCACAACAGCCATTAACATAAAACCCCCAGCCCTCTCCCAATACCAAACACCCCTATTCGTATGATCCGTTCTTATTACCGCTGTCCTACTATTACTCTCACTCCCCGTCCTAGCTGCTGGCATCACTATATTACTTACAGACCGAAACCTCAACACAACATTCTTCGACCCCGCTGGCGGCGGTGACCCAATTCTGTACCAACACCTCTTCTGATTCTTCGGACACCCCGAAGTCTACATCCTAATTCTC
-- end --

Download FASTA File

Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Statistics of barcoding coverage: Aquila chrysaetos

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 6
Specimens with Barcodes: 9
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Conservation

Conservation Status

The golden eagle is federally protected under the Bald Eagle Protection Act of 1962. In some parts, a decline of golden eagle populations has been recorded. Washington and Montana list it as a species of special concern; and Maine, New Hampshire and New York recognize it as an endangered species. But in other areas they are common and populations are presumably stable. (Tesky, 1994)

Previous to the Protection Act of 1962, some 20,000 golden eagles were killed, mostly from aircraft, because they were thought to prey on yound sheep and goats. But studies in towns where sheep are raised found no evidence to support such claims, as almost 70% of the eagle diet consisted of rabbits. Many golden eagles have been electrocuted in power lines, caught in steel traps set for coyotes and other animals, and poisoned by ranchers. Direct and indirect human-caused mortality, disturbance and elimination of prey by habitat alteration are the main factors limiting golden eagle populations. Recreational activites may also disturb breeding, migration and wintering activities. Golden eagles are likely to abandon nests during incubation if they are disturbed. (Terres, 1980;   http://www.fs.fed.us/database/feis/animals/Bird)

US Migratory Bird Act: protected

US Federal List: no special status

CITES: appendix ii

State of Michigan List: no special status

IUCN Red List of Threatened Species: least concern

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

IUCN Red List Assessment


Red List Category
LC
Least Concern

Red List Criteria

Version
3.1

Year Assessed
2013

Assessor/s
BirdLife International

Reviewer/s
Butchart, S.

Contributor/s

Justification
This species has an extremely large range, and hence does not approach the thresholds for Vulnerable under the range size criterion (Extent of Occurrence <20,000 km2 combined with a declining or fluctuating range size, habitat extent/quality, or population size and a small number of locations or severe fragmentation). The population trend appears to be stable, and hence the species does not approach the thresholds for Vulnerable under the population trend criterion (>30% decline over ten years or three generations). The population size is very large, and hence does not approach the thresholds for Vulnerable under the population size criterion (<10,000 mature individuals with a continuing decline estimated to be >10% in ten years or three generations, or with a specified population structure). For these reasons the species is evaluated as Least Concern.

History
  • 2012
    Least Concern
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

National NatureServe Conservation Status

Canada

Rounded National Status Rank: N4 - Apparently Secure

United States

Rounded National Status Rank: N5B,N5N : N5B: Secure - Breeding, N5N: Secure - Nonbreeding

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

NatureServe Conservation Status

Rounded Global Status Rank: G5 - Secure

Reasons: Widespread distribution throughout the Northern Hemisphere. Still relatively common in some areas. Rank reflects primarily the extensive distribution; local threats/declines do not yet comprise a major conservation problem from a global perspective.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

The golden eagle is federally protected under the Bald Eagle Protection Act of 1962. In some parts, a decline of golden eagle populations has been recorded. Washington and Montana list it as a species of special concern; and Maine, New Hampshire and New York recognize it as an endangered species. But in other areas they are common and populations are presumably stable. (Tesky, 1994)

Previous to the Protection Act of 1962, some 20,000 golden eagles were killed, mostly from aircraft, because they were thought to prey on yound sheep and goats. But studies in towns where sheep are raised found no evidence to support such claims, as almost 70% of the eagle diet consisted of rabbits. Many golden eagles have been electrocuted in power lines, caught in steel traps set for coyotes and other animals, and poisoned by ranchers. Direct and indirect human-caused mortality, disturbance and elimination of prey by habitat alteration are the main factors limiting golden eagle populations. Recreational activites may also disturb breeding, migration and wintering activities. Golden eagles are likely to abandon nests during incubation if they are disturbed. (Terres, 1980;   http://www.fs.fed.us/database/feis/animals/Bird)

IUCN Red List of Threatened Species: least concern

US Migratory Bird Act: protected

US Federal List: no special status

CITES: appendix ii

State of Michigan List: no special status

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: BioKIDS Critter Catalog

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

U.S. Federal Legal Status

The gold eagle is federally protected under the Bald Eagle Protection
Act of 1962 [31].
  • 31. U.S. Department of the Interior, Fish and Wildlife Service. 1978. Bald Eagle Protection Act. 16 U.S.C. 668-668c. FWS/LE ENF 4. Washington, DC. 2 p. [23844]

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Declines in golden eagle populations have been pronounced in coastal
southern California. The golden eagle is listed as a species of special
concern in Washington and Montana. Golden eagles are common and
populations are presumably stable in other western states [13]. Golden
eagles are recognized as an endangered species by Maine, New Hampshire,
and New York. Other states in the Northeast either designate the golden
eagle as a former resident, an occasional transient visitor, or
extirpated [26].
  • 13. Harlow, David L.; Bloom, Peter H. 1989. Buteos and the golden eagle. In: Proceedings of the western raptor management symposium and workshop; 1987 October 26-28; Boise, ID. Scientific and Technical Series No. 12. [Place of publication unknown]
  • 26. Todd, Charles S. 1989. Golden eagle. In: Northeast raptor management symposium and workshop: Proceedings; 1989 May 16-18; Syracuse, NY. National Wildlife Federation Scientific and Technical Series 13. Washington, DC: National Wildlife Federation: 65-70. [22176]

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Status in Egypt

Resident breeder and winter visitor?

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Bibliotheca Alexandrina

Source: Bibliotheca Alexandrina - EOL Ar

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Status

Protected in the UK by the Wildlife and Countryside Act, 1981 and listed as a UK Species of Conservation Importance. Extinct in Ireland. Listed under Annex I of the EC Birds Directive and classified as a Species of European Conservation Concern (SPEC 3- rare) (3).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Population

Population
The global population is estimated to number > c.170,000 individuals (Rich et al. 2004), while national population estimates include: c.100-10,000 breeding pairs in China; < c.100 breeding pairs and < c.50 wintering individuals in Korea; c.100-10,000 breeding pairs in Japan and c.100-10,000 breeding pairs in Russia (Brazil 2009).

Population Trend
Stable
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Threats

Major Threats
The species was heavily persecuted in the 19th Century, and although this threat has diminished significantly with populations now generally stable, the species is still deliberately poisoned, shot and trapped, and it is declining in Spain and North America (Katzner, Smith, et al., 2012). In the past the species was affected by the use of organochlorine pesticides although this is not a significant problem today. There are records of mortality as a result of electrocution when perching on power lines, but no data to suggest any substantial demographic impact. Wind energy developments are a source of direct mortality for the species, particularly in California where wandering sub-adults are mostly affected (Watson, 2010). Future developments in flyways may affect migrating adult eagles, and locally may cause effective habitat loss and lead to collisions (Katzner, Brandes, et al., 2012b). In addition, afforestation, long term changes in food supply, including reduced livestock carrion through changing management practices and climate change, may threaten the species in future (Watson, 2010).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Degree of Threat: B : Moderately threatened throughout its range, communities provide natural resources that when exploited alter the composition and structure of the community over the long-term, but are apparently recoverable

Comments: Decline in the early 1900s was due to eradication campaigns, frequently encouraged by the use of bounties (eagle was believed to be a major predator on livestock).

Golden eagles are extremely susceptible to powerline electrocution because the wings can span phase-to-phase or phase-to-ground wires (Biosystems Analysis 1989); modifications have been made in problem areas.

Other threats include ingestion of poison intended for coyotes; ingestion of toxic water from mining activities; occasional shootings; habitat loss to agriculture, suburban land uses, and energy development; loss of potential food resources as a result of habitat degradation or rodent/rabbit control; mortality in inappropriately designed stock tanks, and collisions with structures and with vehicles on roadways. Human disturbance or activity may cause nest abandonment, render a nest site less productive, or prevent a suitable nest site from being utilized, but direct disturbance of nests appears to be infrequent (see GBBO 2010).

Mortality resulting from inappropriate wind turbine design and placement looms as an increasing threat. Many eagle deaths have been recorded at the Altamont Pass Wind Resource Area in northern California and at the Pine Tree wind turbine facility in Tehachapi in southern California. Several dozen wind energy developments have been proposed for desert areas in southern California, where there are many occupied golden eagle territories (LaPré 2011). Proposed solar energy developments in the Mohave Desert overlap with golden eagle territories (Wildlife Research Institute 2010). Large-scale wind/solar energy development could reduce prey populations and reduce eagle hunting opportunities (GBBO 2010).

The small population in eastern North America may be negatively affected by poor survival to breeding age (Palmer 1988).

See De Smet (1987 COSEWIC report) for further discussion of threats.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Widespread persecution of this eagle throughout the 18th and 19th centuries led to the UK population reaching a low of just 80 breeding pairs by 1870 (3). Poisoning and egg collecting were the main threats, unfortunately despite legal protection, isolated incidences of both still occur to today (6). Commercial tree-planting is also thought to be a threat due to the disruption of habitat, and this appears to have been the factor leading to the loss of a number of breeding pairs in Argyll and Kintyre in the early 1990s (3). Habitat destruction and persecution are factors involved in the continuing decline of this species in some parts of Europe (3).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Management

Preserve Selection and Design Considerations: Size of protected habitat patches should be at least 250 sq km and preferably at least 1,000 sq km (see GBBO 2010).

Management Requirements: Relocation of breeding adult eagles (residents) offers, at best, only a short-term soluation to the problem of eagle predation on livestock (in Wyoming, most relocated birds reestablished their territories) (Phillips et al. 1991).

See Fala et al. (1985) for information on artificial nest sites.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Global Protection: Few to several (1-12) occurrences appropriately protected and managed

Comments: This species is protected in many U.S. and Canadian national parks and wilderness areas. It is protected, by similarity of appearance, under the Bald Eagle Protection Act.

Needs: Adequate protection requires consideration of nesting sites and foraging areas/prey populations.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Management Considerations

More info for the term: natural

Direct and indirect human-caused mortality, disturbance, and the
elimination of prey by habitat alteration are the main factors limiting
golden eagle populations [28]. Shooting, poisoning, trapping,
electrocution and/or collision with powerlines, and pesticide
contamination have all been identified as causes of the decline of
golden eagle populations. In addition, recreational activities may
disturb breeding, wintering, and migration activities, disrupting and
often reducing the population [9].

Habitat management for the golden eagle primarily consists of protecting
areas used for nesting, resting, and foraging, and protecting habitat
used by the prey base [9]. Some researchers suggest placing 0.25- to
2-mile (0.4-3.2 km) buffer zones around nest sites in areas undergoing
energy development or increased recreational use. Nest-site protection
is only advantageous if the prey base remains adequate following
development. Many types of development such as oil, gas, and geothermal
exploration; pipeline and road construction; and development of
campgrounds and interpretive facilities on public lands remove
vegetation from small areas. If important prey concentrations such as
ground squirrel colonies are avoided, golden eagles should be able to
coexist with these developments provided nest sites are undisturbed
[25]. Nesting habitat can be enhanced by providing artifical nest
structures in areas where natural nesting sites have been eliminated.
Population enhancement through captive breeding, foster parenting, and
rehabilitation and reintroduction are feasible techniques where suitable
habitat for golden eagles is unoccupied [9].

Golden eagles are sensitive to human disturbance and are likely to
abandon their nests during the incubation period if disturbed [9,21].
Human disturbance was responsible for 85 percent of golden eagle nesting
failures along the Front Range of the Rockies in Wyoming, Colorado, and
in New Mexico [21]. Placing seasonal restrictions on recreational
activities and limiting human access in nesting areas can minimize the
chance of disturbance [5,9].

Some current laws have reduced human-caused hazards to golden eagles.
As of February 1972, use of poisons on public lands has been banned by
Executive Order. Some animal trapping groups have established policies
against placing leg-hold traps near open bait, and some states have laws
prohibiting open bait trapping [9]. The problem of golden eagles being
electrocuted by powerlines has been greatly reduced during the past
decade through cooperative efforts of government agencies, conservation
organizations, and the electric industry. This cooperation is now being
extended into positive golden eagle Habitat management by power
companies [20].

Golden eagles are very susceptible to organochlorine pesticides and many
other environmental contaminants. Since jackrabbits and other
herbivores eaten by golden eagles accumulate low pesticide levels,
golden eagles accumulate higher levels via food-chain concentration.
Another major threat to golden eagle populations is lead toxicosis,
which has been identified as a cause of golden eagle deaths. A
preliminary study of a population in southern California reported that
26 of 66 golden eagles (39%) had blood lead levels greater than 0.2 ppm,
indicating exposure to environmental lead [13].

Serious golden eagle depredation of livestock is usually infrequent and
localized; however, livestock predation has sometimes become a problem
for ranchers [18]. While a potential problem may occur anywhere golden
eagles and livestock coexist, depredation is most severe on lambs in
open range, most notably in Montana and New Mexico. Because golden
eagles are protected under federal law, options for damage control
efforts are limited and highly restricted [23]. In other areas, such as
California, golden eagle depredation of livestock appears minor [13].
Some researchers suggest that golden eagles are beneficial to livestock
interests because a large percentage of their diet is made up of
rabbits, which compete with livestock for forage. Eight to twelve
jackrabbits consume enough forage to support one sheep. The number of
rabbits and rodents killed by golden eagles translates into a sizeable
quantity of forage [18].
  • 5. Call, Mayo. 1979. Habitat management guides for birds of prey. Techical Note 338. Denver, CO: U.S. Department of the Interior, Bureau of Land Management, Denver Service Center. 70 p. [22451]
  • 9. Dunstan, Thomas C. 1989. The golden eagle. In: Audubon wildlife report: 1989/1990: 499-511. On file with: U.S. Department of Agriculture, Forest Service, Intermountain Research Station, Fire Sciences Laboratory, Missoula, MT. [22392]
  • 13. Harlow, David L.; Bloom, Peter H. 1989. Buteos and the golden eagle. In: Proceedings of the western raptor management symposium and workshop; 1987 October 26-28; Boise, ID. Scientific and Technical Series No. 12. [Place of publication unknown]
  • 18. Matchett, Marc R.; O'Gara, Bart W. 1991. Golden eagles and the livestock industry: an emotionally charged issue. Western Wildlands. 17(1): 18-24. [22519]
  • 20. Nelson, Morlan W. 1982. Human impacts on golden eagles: a positive outlook for the 1980's and 1990's. Raptor Research. 16(4): 97-103. [22517]
  • 21. Palmer, Ralph S., editor. 1988. Handbook of North American birds. Volume 5. New Haven, CT: Yale University Press. 463 p. [22303]
  • 23. Phillips, Robert L.; Fall, Michael W. 1990. Control methods and their future application in predation management. In: Giusti, G. A.; Timm, R. M.; Schmidt, R. H., eds. Predator management in north coastal California: Proceedings of a workshop; 1990 March 10-11; Hopland, CA. Hopland Field Station Publication 101. Berkeley, CA: University of California: 65-70. [22290]
  • 25. Suter, Glenn W., II; Joness, Jan L. 1981. Criteria for golden eagle, ferruginous hawk, and prairie falcon nest site protection. Raptor Research. 15(1): 12-18. [22515]
  • 28. Wassink, Jan. 1991. Birds of the central Rockies. Missoula, MT: Mountain Press Publishing. 179 p. [22307]

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Use of Fire in Population Management

In the southeastern United States, mountain balds are burned to help
maintain prey populations for the golden eagle [15].
  • 15. Landers, J. Larry. 1987. Prescribed burning for managing wildlife in southeastern pine forests. In: Dickson, James G.; Maughan, O. Eugene, eds. Managing southern forests for wildlife and fish: a proceedings; [Date of conference unknown]

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Conservation

Persecution of this species began to decline after 1870. Coupled with the introduction of the Protection of Wild Birds Act 1954, this helped the British population of the golden eagle to start its recovery. This species is now protected under the Wildlife and Countryside Act, 1981. As a result of the listing of this bird under Annex I of the EC Birds Directive, eight sites in Scotland have been designated as Special Protection Areas (SPAs) in order to protect the golden eagle (3). The species also occurs in three reserves owned by the Royal Society for the Protection of Birds (RSPB) and so this magnificent raptor benefits from suitable management and protection at a number of sites (6).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Relevance to Humans and Ecosystems

Benefits

Golden eagles occasionally kill livestock, costing ranchers money.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Some researchers suggest that golden eagles are beneficial to livestock production because they eat a large number of rabbits, which compete with livestock for forage.

Positive Impacts: controls pest population

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Economic Uses

Comments: In many cases, resident eagles may be responsible for chronic loss of young domestic lambs, particularly in parts of Colorado, Wyoming, Montana, and Utah (see Phillips et al. 1991).

Eagle feathers are used for religious and cultural purposes by Native Americans, and the Department of the Interior is responsible for facilitating the distribution of eagle carcasses for these purposes (executive directive, 29 April 1994).

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Economic Importance for Humans: Negative

Golden eagles occasionally kill livestock, costing ranchers money.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: BioKIDS Critter Catalog

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Economic Importance for Humans: Positive

Some researchers suggest that golden eagles are beneficial to livestock production because they eat a large number of rabbits, which compete with livestock for forage.

Positive Impacts: controls pest population

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: BioKIDS Critter Catalog

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Wikipedia

Golden eagle

For other uses, see Golden Eagle (disambiguation).

The golden eagle (Aquila chrysaetos) is one of the best-known birds of prey in the Northern Hemisphere. It is the most widely distributed species of eagle. Like all eagles, it belongs to the family Accipitridae. These birds are dark brown, with lighter golden-brown plumage on their napes. Immature eagles of this species typically have white on the tail and often have white markings on the wings. Golden eagles use their agility and speed combined with powerful feet and massive, sharp talons to snatch up a variety of prey (mainly hares, rabbits, marmots and other ground squirrels).[2]

Golden eagles maintain home ranges or territories that may be as large as 200 km2 (77 sq mi). They build large nests in high places (mainly cliffs) to which they may return for several breeding years. Most breeding activities take place in the spring; they are monogamous and may remain together for several years or possibly for life. Females lay up to four eggs, and then incubate them for six weeks. Typically, one or two young survive to fledge in about three months. These juvenile golden eagles usually attain full independence in the fall, after which they wander widely until establishing a territory for themselves in four to five years.

Once widespread across the Holarctic, it has disappeared from many areas which are now more heavily populated by humans. Despite being extirpated from or uncommon in some its former range, the species is still fairly ubiquitous, being present in sizeable stretches of Eurasia, North America, and parts of North Africa. It is the largest and least populous of the five species of true accipitrid to occur as a breeding species in both the Palearctic and the Nearctic.[3]

For centuries, this species has been one of the most highly regarded birds used in falconry, with the Eurasian subspecies having been used to hunt and kill prey such as gray wolves (Canis lupus) in some native communities. Due to its hunting prowess, the golden eagle is regarded with great mystic reverence in some ancient, tribal cultures. The golden eagle is one of the most extensively studied species of raptor in the world in some parts of its range, such as the Western United States and the Western Palearctic.

Description[edit]

In flight
Subadult, note white in tail and dark neck

The golden eagle is a very large, dark brown raptor with broad wings, ranging from 66 to 102 cm (26 to 40 in) in length and from 1.8 to 2.34 m (5 ft 11 in to 7 ft 8 in) in wingspan.[4][5][6][7] This species' wingspan is the fifth largest amongst extant eagle species.[5] In the largest race (A. c. daphanea) males and females weigh typically 4.05 kg (8.9 lb) and 6.35 kg (14.0 lb). In the smallest subspecies, A. c. japonica, males weigh 2.5 kg (5.5 lb) and females 3.25 kg (7.2 lb).[2] In the species overall, males may average around 3.6 kg (7.9 lb) and females around 5.1 kg (11 lb).[8] The maximum size of this species is a matter of some debate. Large races are the heaviest representatives of the Aquila genus and this species is on average the seventh-heaviest living eagle species. The golden eagle ranks as the second heaviest breeding eagle in North America, Europe and Africa but the fourth heaviest in Asia.[3][5] For some time, the largest known mass authenticated for a wild female was the specimen from the nominate race which weighed around 6.7 kg (15 lb) and spanned 2.55 m (8 ft 4 in) across the wings.[9] American golden eagles are typically somewhat smaller than the large Eurasian races, but a massive female that was banded and released in 2006 around Wyoming’s Bridger-Teton National Forest became the heaviest wild golden eagle on record, at 7.2 kg (16 lb).[10] No comprehensive range of weights are known for the largest subspecies (A. c. daphanea).[9] Captive birds have been measured up to a wingspan of 2.81 m (9 ft 3 in) and a mass of 12.1 kg (27 lb) (the latter figure was for an eagle bred for the purposes of falconry which tend to be unnaturally heavy), respectively.[9] The standard measurements of the species include a wing chord length of 52–72 cm (20–28 in), a tail length of 26.5–38 cm (10.4–15.0 in) and a tarsus length of 9.4–12.2 cm (3.7–4.8 in).[5] The culmen reportedly averages around 4.5 cm (1.8 in), with a range of 3.6 to 5 cm (1.4 to 2.0 in) and the bill length from the gape measures around 6 cm (2.4 in).[11][12] The long, straight and powerful hallux-claw (or hind claw, the equivalent to the big toe) can range from 4.5 to 6.34 cm (1.77 to 2.50 in), being about one centimeter more than the hallux-claw of a bald eagle (Haliaeetus leucocephalus) and a little more than one cm less than a harpy eagle (Harpia harpyja).[13][14][15] The sexes are similar in plumage but are considerably dimorphic in size. Females are rather larger than males with the differences increasing as the body size increases across the races. The large Himalayan golden eagles females are about 37% heavier and nearly 9% longer in wing length than the males of the race compared with the small Japanese golden eagles where females are a relatively modest 26% heavier and around 6% longer in wing length than males.[2][16]

The formidable foot and talons of a golden eagle

Adults are primarily dark brown in color, with a paler, typically golden color (the source of the species’ common name) on the back of the crown and nape, and some grey on the inner-wing and tail.[17] There are subtle differences in coloration among the races, described below. Unlike in other Aquila species, where the tarsal feathers are typically of a similar color to the rest of the plumage, the tarsal feathers of golden eagles tend to be paler, ranging from light golden to white.[2] In addition, some full-grown birds (especially in North America) have white "epaulettes" on the upper part of each scapular feather tract.[3][18] The bill is dark at the tip, fading to a lighter horn color, with a yellow cere.[19] As in many acciptrids, the bare portion of the feet are yellow.[5] This species moults gradually beginning in March or April until September or October each year. Moulting usually decreases in winter. Moult of the contour feathers begins on the head and neck region and process along the feather tracts in a general anterior-posterior direction. Feathers on head, neck, back and scapulars may be replaced annually. With large feathers of the wing and tail, moult beginning with innermost feather and proceeds outwards in a straightforward manner known as "descendant" moult.[18]

The juvenile golden eagle is similar to the adult but tends to be darker, appearing black on the back especially in East Asia. Compared to adults, juveniles have a more unfaded color. Young birds are white for about two-thirds of their tail length ending with a broad, black terminal band.[16] Occasionally, juvenile eagles have white patches on the remiges at the bases of the inner primaries and the outer secondaries, forming a crescent marking on the wings which tend to be divided by darker feathers.[2][20] Rarely, juvenile birds may have only trace amounts of white on the tail. Compared to the relatively consistently white tail, the white patches on the wing are extremely variable and some juveniles have almost no white visible. Juveniles of less than 12 months of age tend to have the most extensive amount of white to the plumage.[18] By their second summer, the white underwing coverts are usually replaced by a characteristic rusty-brown color. By the third summer, the upper-wing coverts are largely replaced by dark brown feathers, however not all feathers moult at once giving many juvenile birds a grizzled pattern. The tail also follows a similar pattern of maturation.[18][20] Due to the amount of variability in different individuals, juvenile eagles cannot be reliably aged on sight alone.[21] Many golden eagles still have white on the tail during their first attempt at nesting.[22] The final adult plumage is not fully attained until the birds are between 5 and a half and 6 and a half years old.[21]

Voice[edit]

While many accipitrids are not known for their strong voices, golden eagles have a particular tendency for silence, even while breeding.[23] Some vocalization, however, has been recorded, and these normally are centering around the nesting period. The voice of the golden eagle is considered weak, high and shrill, even being emphatically described as “quite pathetic” and “puppy-like”, and as somewhat incongruous considering the formidable size and nature of the species.[5] Most known vocalization seem to function as contact calls between eagles, sometimes adults to their offspring, occasionally territorial birds to intruders and rarely between a breeding pair. In Western Montana, nine distinct calls were noted: a chirp, a seeir, a pssa, a skonk, a cluck, a wonk, a honk and a hiss.[24]

Flight physiology[edit]

Golden eagle flying in dihedral with food

Golden eagles are sometimes considered the most superlative fliers among eagles and perhaps among all raptorial birds.[23] They are equipped with broad, long wings with somewhat finger-like indentations on the tips of the wing.[5] Golden eagles are unique among their genus in that they often fly in a slight dihedral, which means the wings are often held in a slight, upturned V.[5] When they must engage in flapping flight, golden eagles appear at their most labored but this flight method is generally less common than soaring or gliding flights.[2] Flapping flight usually consists of 6–8 deep wing-beats, interspersed with 2 to 3 second glides.[2] While soaring the wings and tail are held in one plane with the primary tips often spread.[25] A typical, unhurried soaring speed in golden eagles is around 45–52 kilometers per hour (28–32 mph).[26] When hunting or displaying, the golden eagle is capable of very fast gliding, attaining speeds of up to 190 km/h (120 mph).[2][25] When diving (or stooping) in the direction of prey or during territorial displays, the eagle holds its wings tight and partially closed against its body and the legs up against its tail. In a full stoop, a golden eagle can reach spectacular speeds of up to 240 to 320 kilometers per hour (150 to 200 mph) when diving after prey. Although less agile and maneuverable, the golden eagle is apparently quite the equal and possibly even the superior of the peregrine falcon’s stooping and gliding speeds.[3][27] This places the golden eagle as the one of the two fastest moving living animals on earth.[9] Although most flight in golden eagles has a purpose (i.e. territoriality, hunting, etc.), some flights (such as those by solitary birds or between well-established breeding pairs) seems to function merely as acts of playfulness.[3][23][28]

Confusion species[edit]

Golden eagles are readily distinguished by their brown plumage, paler than most other Aquila, and pale nape patch

Size readily distinguishes this species from most other raptors when it is seen well. Most other raptors are considerably smaller. Buteo hawks, which are perhaps most similar to the golden eagle in structure among the species outside of the “booted eagle” group, are often amongst the larger very common raptors. However, a mid-sized Buteo is dwarfed by a golden eagle, as an adult female eagle has a wingspan of about twice the width and weighs around five times more. Buteos are also usually distinctly paler below, although some species occur in “dark morphs” which can be even darker than a golden eagle.[5][29] Only some Old World vultures and the California condor (Gymnogyps californianus) (among the other raptorial birds this eagle co-exists with) are distinctly larger than the golden eagle, with longer, broader wings, typically held more evenly in a slower, less forceful flight and often have dramatically different color patterns. The turkey vulture (Cathartes aura) is a potential confusion species in North America from a great distance, as it is a large species that (like the golden eagle) often flies with a pronounced dihedral but is easily separated by its less controlled, forceful flying style and its smaller, thinner body, much smaller head and, at closer range, its slaty black-brown color and silvery wing secondaries.[30] Compared to Haliaeetus eagles, the golden eagle has wings that are only somewhat more slender but are more hawk-like and lack the flat, plank-like wing positioning seen in the other genus.[30] Large Northern Haliaeetus usually have a larger bill and larger head which more distinctly protrudes than that of a golden eagle’s in flight. The tail of the golden eagle is longer on average than those of Haliaeetus eagles, appearing to be two or three times the length of the head in soaring flight as opposed to the other eagles where the head is often more than twice the length of the tail.[30] Confusion is most likely between juvenile Haliaeetus and golden eagles since the adult golden has a more solidly golden-brown coloration and all Haliaeetus eagles have obvious distinctive plumages as adults. Haliaeetus eagles are often heavily streaked in their juvenile phase. Juvenile golden eagles can show large patches of white to the wings and tail that are quite different than the random, sometimes large and splotchy-looking distribution of white typical of juvenile Haliaeetus.[5][30]

Distinguishing the golden eagle from other Aquila eagles in Eurasia is potentially a greater identification problem. This identification may rely on the golden's relatively long tail and patterns of white or gray on the wings and tail. Other Aquila eagles do not generally fly in a pronounced dihedral as do golden eagles. At close range, the golden to rufous nape-shawl of the golden eagle is distinctive from other Aquila. Most other Aquila eagles are darker looking in plumage, although the smaller tawny eagle (A. rapax) is often paler than the golden eagle (overlap in range verified only in Bale Mountains, Ethiopia). Among Eurasian Aquila, the adult Eastern Imperial (A. heliaca) and Spanish imperial eagle (A. adalberti) come closest to attaining similar sizes as golden eagles but this species pair are distinguished by their relatively longer neck, flatter wings in flight, white markings on their shoulder forewing-coverts, paler cream-straw colored nape patch and generally darker coloration. Juvenile imperial eagles are much paler overall (caramel-cream in the Spanish; cream and tawny streaks in the Eastern) and are not likely to be confused.[5] Steppe eagles (A. nipalensis) can also be nearly golden eagle-sized but are more compact and smaller headed than a golden eagle with little color variation to their dark earth-brown plumage but for juvenile birds which have distinctive cream-colored bands running through their coverts and secondaries.[3] Verreaux's eagle (A. verreauxii) are most similar in size and body shape to the golden, with the Verreaux's being slightly longer overall but marginally less heavy and long-winged than the golden eagle.[5] The plumage is very distinctly different, however, as Verreaux's eagles are almost entirely jet-black but for some striking, contrasting white on the wing primaries, shoulders and upper-wing.[5] This closely related species is known to co-occur with the golden eagle only in the Bale Mountains of Ethiopia.[2] Other booted eagles in the golden eagle’s range are unlikely to be confused, due to the differences in size and form. Among the Aquila genus, only the long-winged and tailed wedge-tailed eagle (A. audax) of Australasia notably exceeds the golden eagle in average wingspan and length. However, the wedge-tailed eagle is a slightly less heavy bird.[9]

Taxonomy and systematics[edit]

This species was first described by Linnaeus in his 1758 Systema naturae as Falco chrysaetos.[31] Since birds were grouped largely on superficial characteristics at that time, many species were grouped by Linnaeus in the Falco genus. The type locality was given simply as "Europa"; it was later fixed to Sweden. It was moved to the new genus Aquila by French ornithologist Mathurin Jacques Brisson in 1760.[32]

The golden eagle is part of a broad group of raptors called “booted eagles” which are defined by the feature that all species have feathering over their tarsus, unlike many other accipitrids which have bare legs. Included in this group are all species described as “hawk eagles” including the genera Spizaetus and Nisaetus, as well as assorted monotypical genera such as Oroaetus, Lophaetus, Stephanoaetus, Polemaetus, Lophotriorchis and Ictinaetus. The genus Aquila is distributed across every continent but for South America and Antarctica. Up to 20 species have been classified in the genus but the taxonomic placement of some of the traditional species has been questioned as of late. Traditionally, the Aquila eagles have been grouped superficially as largish, mainly brownish or dark-colored booted eagles that vary little in transition from their juvenile to their adult plumages. Genetic research has recently indicated the golden eagle is included in a clade with Verreaux's eagle in Africa as well as the Gurney's eagle (A. gurneyi) and the wedge-tailed eagle (clearly part of an Australasian radiation of the lineage). This identification of this particular clade has long been suspected based on similar morphological characteristics amongst these large-bodied species.[3] More surprisingly, the smaller, much paler-bellied sister species Bonelli's eagle (A. fasciatus) and African hawk-eagle (A. spilogaster), previously included in the Hieraaetus genus, have been revealed to be genetically much closer to the Verreaux's and golden eagle lineage than to other species traditionally included in the Aquila genus.[2][33][34] Other largish Aquila species, the eastern imperial, the Spanish imperial, the tawny and the steppe eagles, are now thought to be separate, close-knit clade, which attained some similar characteristics to the prior clade via convergent evolution.[33][34] Genetically, the “spotted eagles” (A. pomarina, hasata & clanga), have been discovered to be more closely related to the long-crested eagle (Lophaetus occipitalis) and the black eagle (Ictinaetus malayensis), and many generic reassignments have been advocated.[33][35] The Hieraaetus genus, including the booted eagle (H. pennatus), little eagle (H. morphnoides) and Ayres's hawk-eagle (H. ayresii), consists of much smaller species, that are in fact smallest birds called eagles outside of the unrelated Spilornis serpent-eagle genus. This genus has recently been eliminated by many authorities and are now occasionally also included in Aquila, although not all ornithological unions have followed this suit in this re-classification.[2][34][36] The small-bodied Wahlberg's eagle (H. wahlbergi) has been traditionally considered a Aquila species due to its lack of change from juvenile to adult plumage and brownish color but it is actually genetically aligned to the Hieraaetus lineage.[33][37] Cassin's hawk-eagle (H. africanus) is also probably closely related to the Hieraaetus group rather than the Spizaetus/Nisaetus “hawk-eagle” group (in which it was previously classified) which is not known to have radiated to Africa.[38]

Subspecies and distribution[edit]

A member of the largest golden eagle race (A. c. daphanea) mantles over carrion in winter
A captive Aquila chrysaetos canadensis shows the typical rusty coloration of the race

There are six extant subspecies of golden eagle that differ slightly in size and plumage. Individuals of any race are somewhat variable and the differences between subspecies are clinal, especially in terms of body size. Other than these characteristics, there is little variation across the range of the species.[5] Some recent studies have gone so far as to propose that only two subspecies be recognized based on genetic markers: Aquila chrysaetos chrysaetos (including A. c. homeyeri) and A. c. canadensis (including the races A. c. japonica, A. c. daphanea and A. c. kamtschatica).[39]

  • Aquila chrysaetos chrysaetos (Linnaeus, 1758) – sometimes referred to as the European golden eagle.[23] This is the nominate subspecies. This subspecies is found almost throughout Europe including the British Isles (mainly in Scotland), a lion’s share of Scandinavia, southern and northernmost France, Italy and Austria. In Eastern Europe, the race is found from Estonia to Romania, Greece, Serbia and Bulgaria in southeastern Europe. It is also distributed through European Russia, reportedly reaching itself eastern limit around the Yenisei River in Russia, also ranging south at a similar longitude into western Kazakhstan and northern Iran.[2][5] Male wing length is from 56.5 to 67 cm (22.2 to 26.4 in), averaging 62 cm (24 in), and female wing length is from 61.5 to 71.2 cm (24.2 to 28.0 in), averaging 67 cm (26 in). Males weigh from 2.8 to 4.6 kg (6.2 to 10.1 lb), averaging 3.69 kg (8.1 lb), and females weigh from 3.8 to 6.7 kg (8.4 to 14.8 lb), averaging 5.17 kg (11.4 lb).[2][5] The male of this race has a wingspan of 1.89 to 2.15 m (6 ft 2 in to 7 ft 1 in), with an average of 2.02 m (6 ft 8 in), with the female’s typical wingspan range is 2.12 to 2.2 m (6 ft 11 in to 7 ft 3 in), with an average of 2.16 m (7 ft 1 in).[23] This is a medium-sized subspecies and is the palest race. As opposed to golden eagles found further east in Eurasia, the adults of this race are a tawny golden-brown on the upper-side. The nape patch is often gleaming golden in color and the feathers here are exceptionally long.[3][5][40]
  • Aquila chrysaetos homeyeri Severtzov, 1888 –This race occurs in almost the entirety of the Iberian peninsula as well as the island of Crete, though is absent from the rest of continental Europe. It also ranges in North Africa in a narrow sub-coastal strip from Morocco to Tunisia. A completely isolated population of golden eagles is found in Ethiopia’s Bale Mountains, at the southern limit of this species range worldwide. Although this latter population has not been formally assigned to a race, the probability that it belongs with A. c. homeyeri seems high. This subspecies also ranges in much of Asia Minor, mainly Turkey, spottily through the Middle East and the Arabian Peninsula into northern Yemen and Oman to its eastern limits throughout the Caucasus, much of Iran and north to southwestern Kazakhstan.[2][5] Male wing length is from 55 to 64.3 cm (21.7 to 25.3 in), averaging 59 cm (23 in), and female wing length is from 60 to 70.5 cm (23.6 to 27.8 in), averaging 64 cm (25 in). Weight is from 2.9 to 6 kg (6.4 to 13.2 lb) with no known reports of average masses.[2][5] This subspecies is slightly smaller and darker plumaged than the nominate race, but is not as dark as the golden eagles found further to the east. The forehead and crown are dark brownish with the nape patch being short-feathered and a relatively light rusty color.[41]
  • Aquila chrysaetos daphanea Severtzov, 1888 – known variously as the Asian golden eagle, Himalayan golden eagle or berkut.[9] This race is distributed in central Kazakhstan, eastern Iran and the easternmost Caucasus distributed to Manchuria and central China and along the Himalayas from northern Pakistan in the west to Bhutan in the east (rarely ranging over into northernmost India) discontinuing in northeastern Myanmar.[2][5][42] This subspecies is the largest race on average. Male wing length is from 60 to 68 cm (24 to 27 in), averaging 64 cm (25 in), and female wing length is from 66 to 72 cm (26 to 28 in), averaging 70 cm (28 in). No range of body weights are known but males will weigh approximately 4.05 kg (8.9 lb) and females 6.35 kg (14.0 lb).[2][5] Although the wingspan of this race reportedly averages 2.21 m (7 ft 3 in), some individuals apparently are much longer-winged.[9] One aforementioned female “berkut” had an authenticated wingspan of 2.81 m (9 ft 3 in), although she was a captive specimen.[9] It is generally the second darkest race, being blackish on the back. The forehead and crown are dark with a blackish cap near the end of the crown. The feathers of the nape and top-neck are rich brown-red. The nape feathers are slightly shorter than in the nominate race and are similar in length to A. c. homeyeri.[43][44]
  • Aquila chrysaetos japonica Severtzov, 1888 – the common name is the Japanese golden eagle. This race is found in northern Japan (the islands of Honshu, Hokkaido and discontinuously in Kyushu) and undefined parts of Korea.[2][5] Male wing length is from 58 to 59.5 cm (22.8 to 23.4 in), averaging 59 cm (23 in), and female wing length is from 62 to 64.5 cm (24.4 to 25.4 in), averaging 63 cm (25 in). No range of body weights are known but males will weigh approximately 2.5 kg (5.5 lb) and females 3.25 kg (7.2 lb). This is by far the smallest bodied subspecies. It also the darkest with even adults being a slaty-grayish black on the back and crown and juveniles being similar but with darker black plumage contrasting with brownish color and white scaling on the wings, flank and tail. This race has bright rufous nape feathers that are quite loose and long. Adult Japanese golden eagles often maintain extensive white mottling on the inner-webs of the tail that tend to be more typical of juvenile eagles in other races.[2][5]
  • Aquila chrysaetos canadensis (Linnaeus, 1758) – Commonly known as the American golden eagle. Occupies the species’ entire range in North America, which comprises the great majority of Alaska, western Canada and the Western United States. The species is found breeding occasionally in all Canadian provinces but for Nova Scotia. It is currently absent in the Eastern United States as breeding species east of a line from North Dakota down through westernmost Nebraska and Oklahoma to West Texas. The southern limits of its range are in central Mexico, from the Guadalajara area in the west to the Tampico area in the east. It is the subspecies with the largest breeding range and is probably the most numerous subspecies, especially if A. c. kamtschatica is included.[2][5] Male wing length is from 59.1 to 64 cm (23.3 to 25.2 in), averaging 61 cm (24 in), and female wing length is from 60.1 to 67.4 cm (23.7 to 26.5 in), averaging 65 cm (26 in).[2][5][13] The average wingspan in both sexes is about 2.04 m (6 ft 8 in).[3] Males weigh from 2.5 to 4.47 kg (5.5 to 9.9 lb), averaging 3.48 kg (7.7 lb), and females typically weigh from 3.6 to 6.4 kg (7.9 to 14.1 lb), averaging 4.91 kg (10.8 lb).[2][5] The race does not appear to follow Bergmann’s rule (the rule that widely distributed organisms are larger-bodied further away from the Equator), as specimens of both sexes from Idaho had a mean weight of 4.22 kg (9.3 lb) and where slightly heavier than those from Alaska, with a mean weight of 3.76 kg (8.3 lb).[2][3] It is medium-sized, being generally intermediate in size between the nominate and A. c. homeyeri but with much overlap. It is blackish to dark brown on the back. The long feathers of nape and top-neck are rusty-reddish and slightly narrower and darker than in the nominate race.[5][45]
  • Aquila chrysaetos kamtschatica Severtzov, 1888 – sometimes is referred to as the Siberian golden eagle or the Kamchatka golden eagle. This race ranges from Western Siberia (where overlap with A. c. chrysaetos is probable), across most of Russia, including the Altay (spilling over into Northern Mongolia), to the Kamchatka Peninsula and the Anadyrsky District. This subspecies is often included in A. c. canadensis.[2][5] Male wing length is from 61.8 to 70.5 cm (24.3 to 27.8 in), averaging 64 cm (25 in), and female wing length is from 65 to 72 cm (26 to 28 in), averaging 69 cm (27 in).[46] No weights are known in this race.[2] The coloration of these eagles is almost exactly the same as in A. c. canadensis. The main difference is that this race is much larger in size, being is nearly the equal of A. c. daphanea going on wing-length.[5]

The larger Middle Pleistocene golden eagles of France (and possibly elsewhere) are referred to a paleosubspecies Aquila chrysaetos bonifacti, and the huge specimens of the Late Pleistocene of Liko Cave (Crete) have been named Aquila chrysaetos simurgh (Weesie, 1988).[47][48] Similarly, an ancestral golden eagle, with a heavier, broader skull, larger wings and shorter legs when compared to modern birds, has been found in the La Brea Tar Pits of southern California.[49]

Habitat[edit]

Beinn Mhor on the Isle of Mull, Scotland is typical golden eagle habitat: rugged and mountainous.

Golden eagles are fairly adaptable in habitat but often reside in areas with a few shared ecological characteristics. They are best suited to hunting in open or semi-open areas and search them out year-around. Native vegetation seems to be attractive to them and they typically avoid developed areas of any type from urban to agricultural as well as heavily forested regions. In desolate areas (i.e. the southern Yukon), they can occur regularly at roadkills and garbage dumps.[50] The largest numbers of golden eagles are found in mountainous regions today, with many eagles doing a majority of their hunting and nesting on rock formations. However, they are not solely tied to high elevations and can breed in lowlands if the local habitats are suitable. Below are more detailed description of habitats occupied by golden eagles in both continents where they occur.[2]

Eurasia[edit]

In the Arctic fringe of the great continent, golden eagles occur along the edge of the tundra and the taiga from the Kola peninsula to Anadyr in eastern Siberia, nesting in forests and hunting over nearby arctic heathland. Typical vegetation is stunted, fragmented larch woodland merging into low birch-willow scrub and various heathland. In the rocky, wet, windy maritime countries of the British Isles and western Scandinavia, the golden eagle is a mountain-dwelling bird. These areas include upland grasslands, blanket bog and sub-Arctic heaths but also fragmented woodland and woodland edge, including boreal forests. In Western Europe, golden eagle habitat is dominated by open, rough grassland, heath and bogs, in places enlivened by rocky ridges, spurs, crags, scree, slopes and grand plateaux. In Sweden, Finland, the Baltic States, Belarus and almost the entire distribution in Russia all the way to the Pacific Ocean, golden eagles occur sparsely in lowland taiga forest. These areas are dominated by stands of evergreens such as pine, larch and spruce, occasionally supplemented by birch and alder stands in southern Scandinavia and the Baltic States. This is largely marginal country for golden eagles and they occur where tree cover is thin and abuts open habitat. Golden eagle taiga habitat usually consists of extensive peatland formations caused by poorly drained soils. In central Europe, golden eagles today occur almost exclusively in the grand mountain ranges, such as Pyrenees, Alps, Carpathians and the Caucasus. Here, the species nests near the tree line and hunt subalpine and alpine pastures, grassland and heath above. Golden eagles also occur in moderately mountainous habitat along the Mediterranean Sea, from Iberia and the Atlas Mountains in Morocco, to Greece, Turkey and Kurdistan. This area is characterized by low mountains, Mediterranean maquis vegetation and sub-temperate open woodland in various stages of degradation. The local pine-oak vegetation, with a huge variety of Sclerophyllous shrubs are well-adapted to prolonged summer draughts. From Kurdistan and the southern Caspian Sea to the foothills of the Hindu Kush Mountains in Afghanistan, the typical golden eagle habitat is temperate desert-like mountain ranges surrounded by steppe landscapes interspersed with forest. Here the climate is colder and more continental than around the Mediterranean. Golden eagles occupy the alpine ranges from the Altai Mountains and the Pamir Mountains to Tibet, in the great Himalayan massif, and northwestern China, where they occupy the Tien Shan range. In these mountain ranges, the species often lives at very high elevations, living above tree line at more than 2,500 m (8,200 ft), often nesting in rocky scree and hunting in adjacent meadows. In Tibet, golden eagles inhabit high ridges and passes in the Lhasa River watershed, where it regularly joins groups of soaring Himalayan Vultures (Gyps himalayensis).[51] One golden eagle was recorded circling at 6,190 m (20,310 ft) above sea-level in Khumbu in May 1975.[52] In the mountains of Japan and Korea, the golden eagle occupies deciduous scrub woodland and carpet-like stands of Siberian dwarf pine (Pinus pumila) that merge into grasslands and alpine heathland. The golden eagle occurs in mountains from the Adrar Plateau in Mauritania to northern Yemen and Oman where the desert habitat is largely bereft of vegetation but offers many rocky plateaus to support both the eagles and their prey. In Israel, their habitat is mainly rocky slopes and wide wadi areas, chiefly in desert and to a lesser extent in semi-desert and Mediterranean climates, extending to open areas.[53] In Northeastern Africa, the habitat is often of a sparse, desert-like character and is quite similar to the habitat in Middle East and the Arabian peninsula. In Ethiopia's Bale Mountains, where the vegetation is more lush and the climate is clearly less arid than in Northeastern Africa, the golden eagle occupies verdant mountains.[2]

North America[edit]

The ecozones occupied by golden eagles are roughly concurrent with those of Eurasia. In western and northern Alaska and northern Canada to the Ungava Peninsula in Quebec, the eagles occupy the Arctic fringe of North America (the species does not range into the true high Arctic tundra), where open canopy gives way to dwarf-shrub heathland with cottongrass and tussock tundra. In land-locked areas of the sub-Arctic, golden eagles are by far the largest raptor. From the Alaska Range to Washington and Oregon, it is often found in high mountains above the tree line or on bluffs and cliffs along river valleys below the tree line.[54][55] In Washington state, golden eagles can be found in clear-cut sections of otherwise dense coniferous forest zones with relatively little annual precipitation.[56] From east of the Canadian Rocky Mountains to the mountains of Labrador, the golden eagle is found in small numbers in boreal forest peatlands and similar mixed woodland areas. In the foothills of the Rocky Mountains in the United States are plains and prairies where golden eagles are widespread, especially where there's a low human presence. Here, grassland on low rolling hills and flat plains are typical, interrupted only by cottonwood stands around river valleys and wetlands where the eagles may build their nests. Golden eagles also occupy the desert-like Great Basin from southern Idaho to northern Arizona and New Mexico. In this habitat, trees are generally absent other than junipers with vegetation being dominated by sagebrush (Artemisia) and other low shrub species. Although the vegetation varies a bit more, similar habitat is occupied by golden eagles in Mexico.[57][58][59] However, golden eagles are typically absent in North America from true deserts like the Sonora Desert, where annual precipitation is less than 20 cm (7.9 in).[60] Golden eagles occupy the mountains and coastal areas of California and Baja California in Mexico where hot, dry summers and moist winters are typical. The golden eagles here often nest in chaparral and oak woodland, oak savanna and grassland amongst low rolling hill typified by diverse vegetation.[61] In the Eastern United States, the species once bred widely in the Appalachian Plateau near burns, open marshes, meadows, bogs and lakes.[62][63] In Eastern North America, the species still breeds on the Gaspe Peninsula, Quebec. Until 1999, a pair of golden eagles were still known to nest in Maine but they are now believed to be absent as a breeding bird from the Eastern United States.[2] The golden eagles who breed in eastern Canada winter on montane grass and heath fields in the Appalachian Plateau region, especially in Pennsylvania, New York, West Virginia, Maryland and Virginia. Most sightings in the Eastern United States recently are concentrated within or along southwestern border of the Appalachian Plateau (30% of records) and within the Coastal Plain physiographic region (33% of records).[64]

Though they do regularly nest in the marsh-like peatland of the boreal forest, golden eagles are not generally associated with wetlands and, in fact, they can be found near some of the most arid spots on earth. In the wintering population of Eastern United States, however, they are often associated with steep river valleys, reservoirs, and marshes in inland areas as well as estuarine marshlands, barrier islands, managed wetlands, sounds, and mouths of major river systems in coastal areas. These wetlands are attractive due to a dominance of open vegetation, large concentrations of prey, and the general absence of human disturbance.[64] In the midwestern United States, they are not uncommon during winter near reservoirs and wildlife refuges that provide foraging opportunities at waterfowl concentrations.[65]

Dietary biology[edit]

Activity and movements[edit]

In Spain, golden eagles such as this one in the Province of Ávila are sedentary.

Despite the dramatic ways in which they attain food and interact with raptors of their own and other species, the daily life of golden eagles is often rather uneventful. In Idaho, adult male golden eagles were observed to sit awake on a perch for an average of 78% of daylight, whereas adult females sat on nest or perched for an average of 85% of the day.[66] During the peak of summer in Utah, hunting and territorial flights occurred mostly between 9:00 and 11:00 am and 4:00 and 6:00 pm, with the remaining 15 or so hours of daylight spent perching or resting.[23] When conditions are heavily anticyclonic, there is less soaring during the day.[2] During winter in Scotland, golden eagles soar frequently in order to scan the environment for carrion.[2] In the more wooded environments of Norway during autumn and winter, much less aerial activity is reported, since the eagles tend to avoid detection by actively contour-hunting rather than looking for carrion.[67] Golden eagles are believed to sleep through much of the night. Although usually highly solitary outside of the bond between breeding pairs, exceptionally cold weather in winter may cause eagles to put their usual guard down and perch together. The largest known congregation of golden eagles was observed on an extremely cold winter’s night in eastern Idaho when 124 individuals were observed perched closely along a line of 85 power poles.[68]

Migration[edit]

Most populations of golden eagles are sedentary, but the species is actually a partial migrant. Golden eagles are very hardy species, being well adapted to cold climates, however they cannot abide declining available food sources in the northern stretches of their range. Eagles raised at latitudes greater than 60° N are usually migratory, though a short migration may be untaken by those who breed or hatch at about 50° N.[69] During migration, they often use soaring-gliding flight, rather than powered flight.[69] In Finland, most banded juveniles move between 1,000 and 2,000 km (620 and 1,240 mi) due south, whereas adults stay locally through winter. Further east, conditions are too harsh for even wintering territorial adults.[2] Golden eagles that breed from the Kola peninsula to Anadyr in the Russian Far East migrate south to winter on the Russian and Mongolian steppes, and the North China Plains. The flat, relatively open landscapes in these regions hold relatively few resident breeding golden eagles.[70] Similarly the entire population of golden eagles from northern and central Alaska and northern Canada migrates south. At Mount Lorette in Alberta, approximately 4,000 golden eagles may pass during the fall, the largest recorded migration of golden eagles on earth.[71] Here the mountain ranges are relatively moderate and consistent, thus being reliable for thermals and updrafts which made long-distance migrating feasible.[71] Birds hatched in Denali National Park in Alaska traveled from 818 to 4,815 km (508 to 2,992 mi) to their winter ranges in western North America.[69] These western migrants may winter anywhere from southern Alberta and Montana to New Mexico and Arizona and from inland California to Nebraska. Adults who bred in northeastern Hudson Bay area of Canada reached their wintering grounds, which range from central Michigan to southern Pennsylvania to northeastern Alabama, in 26 to 40 days, with arrival dates from November to early December.[72] The departure dates from wintering grounds are variable. In southwestern Canada, they leave their wintering grounds by April 6 to May 8 (the mean being April 21); in southwestern Idaho, wintering birds leave from March 20 to April 13 (mean of March 29); and in the Southwestern United States, wintering birds may depart by early March.[2][69][73] Elsewhere in the species' breeding range, golden eagles (i.e. those who breed in the contiguous Western United States, all of Europe but for Northern Scandinavia, North Africa and all of Asia but for Northern Russia) are non-migratory and tend to remain within striking distance of their breeding territories throughout the year.[5] In Scotland, among all recovered, banded golden eagles (36 out of 1000, the rest mostly died or disappeared) the average distance between ringing and recovery was 44 km (27 mi), averaging 63 km (39 mi) in juveniles and 36 km (22 mi) in older birds.[2] In the dry Southwestern United States, golden eagles tend to move to higher elevations once the breeding season is complete.[28] In North Africa, populations breeding at lower latitudes, like Morocco, are mostly sedentary, although some occasionally disperse after breeding to areas outside of the normal breeding range.[74]

Territoriality[edit]

Two golden eagles in an aerial conflict over their home ranges, the upper bird clearly a juvenile.

Territoriality is believed to be the primary cause of interactions and confrontations between non-paired golden eagles. Golden eagles maintain some of the largest known home ranges (or territories) of any bird species but there is much variation of home range size across the range, possibly dictated by food abundance and habitat preference. Home ranges in most of the range can vary from 20 to 200 km2 (7.7 to 77.2 sq mi).[75] In San Diego County in California, the home ranges varied from 49 to 137 km2 (19 to 53 sq mi), with an average of 93 km2 (36 sq mi).[76] However, some home ranges have been much smaller, such as in southwestern Idaho where, possibly due to an abundance of jackrabbits, home ranges as small as 4.85 km2 (1.87 sq mi) are maintained.[77] The smallest known home ranges on record for golden eagles are in the Bale Mountains of Ethiopia, where they range from 1.5 to 9 km2 (0.58 to 3.47 sq mi).[78] 46% of undulating displays in Montana occurred shortly after the juvenile eagles left their parents range, suggesting that some residents defend and maintain territories year-round.[79] Elsewhere it is stated that home ranges are less strictly maintained during winter but hunting grounds are basically exclusive.[2] In Israel and Scotland, aggressive encounters peaked from winter until just before egg-laying and were less common during the nesting season.[2][80] Threat displays include undulating flight and aggressive direct flapping flight with exaggerated downstrokes.[24] Most displays by mature golden eagles (67% for males and 76% for females) occur, rather than around the nest, at the edge of their home ranges.[66] In Western Norway, most recorded undulating flight displays occur during the pre-laying period in late winter/early spring.[67] Display flights seem to be triggered by the presence of other golden eagles.[2] The use of display flights has a clear benefit in that it lessens the need for physical confrontations, which can be fatal.[66] Usually, non-breeding birds are treated aggressively by the golden eagle maintaining their home range, normally being chased to the apparent limit of the range but with no actual physical contact.[2] The territorial flight of the adult golden eagle is sometimes preceded or followed by intense bouts of undulating displays. The invader often responds by rolling over and presenting talons to the aggressor. Rarely, the two eagles will lock talons and tumble through the air; sometimes fall several revolutions and in some cases even tumble to the ground before releasing their grip.[81][82] In some parts of the Alps, the golden eagle population has reached the saturation point in appropriate habitat and apparently violent confrontations are more common than in other parts of the range.[83] Golden eagles may express their aggression via body language while perched, typically the adult female when confronted by an intruding eagle: the head and body are upright, feathers on head and neck are erect; the wings may be slightly spread and beak open; often accompanied by intense gaze. They then often engage in a similar posture with wings spread wide and oriented toward the threat; sometimes rocking back on tail and even flopping over onto the back with talons extended upward as defense. Such behavior may be accompanied by wing slap against the threatening intruder.[24] When approached by an intruder, the defending eagle turns away, partially spreads tail, lowers head, and remains still; adults on the nest may lower head and “freeze” when approached by a person or a helicopter.[24] Females in Israel displayed more than males and mostly against interspecific intruders; males apparently displayed primarily as part of courtship.[80] Five of 7 aggressive encounters at carcasses during winter in Norway were won by females; in 15 of 21 conflicts, the younger bird dominated an older conspecific.[84] However, obvious juvenile eagles (apparent to the adult eagles due to the amount of white on their wings and tail) are sometimes allowed to penetrate deeply into a pair’s home range and all parties commonly ignore each other.[85][86] In North Dakota, it was verified that parent eagles were not aggressive towards their own young after the nesting period and some juveniles stayed on their parents territory until their 2nd spring and then left by their own accord.[87]

Reproduction[edit]

Eyrie (in hollow at left center) in the Valley of the Siagne de la Pare, Alpes-Maritimes, France

Golden eagles usually mate for life. A breeding pair is formed in a courtship display. This courtship includes undulating displays by both in the pair, with the male bird picking up a piece of rock and dropping it only to enter into a steep dive and catch it in mid-air, repeating the maneuver 3 or more times. The female takes a clump of earth and drops and catches it in the same fashion. Small sticks may also be used in this display.[2] Compared to the bald eagle, golden eagles do not repeat courtship displays annually (which is believed to strengthen pair bonds) and rarely engage in talon-locking downward spirals.[45] Golden eagles typically build several eyries within their territory and use them alternately for several years. Their nesting areas are characterized by the extreme regularity of the nest spacing.[88] In 9 studies of annual nest spacing, the average minimum distance between nests range from 16 km (9.9 mi) apart in Norway to 8 km (5.0 mi) apart in Switzerland.[89][90] Nests in Scotland may found at anywhere from 10 to 65 pairs per 1,000 km2 (390 sq mi), with an average of over 20 pairs found per area.[2] In much of continental Europe, densities of less than 10 pairs per 1,000 km2 (390 sq mi) are typical.[2] In the United States different areas had from 10 to more than 20 pairs on average per 1,000 km2 (390 sq mi). Wyoming had the greatest densities of breeding golden eagles of any complied study, though numbers were comparable to western Scotland as there were an average of just over 20 pairs per 1,000 km2 (390 sq mi), with greatest estimated densities of possibly 125 per area.[91] In Wyoming, the distance between nests ranged from 3.1 to 8.2 km (1.9 to 5.1 mi), averaging 5.3 km (3.3 mi).[91] In the wooded peatlands of Sweden and Belarus, a maximum of 5 pairs appear to occur per 1,000 km2 (390 sq mi).[2] In Quebec, the distance between nests ranged from 8 to 44.7 km (5.0 to 27.8 mi).[92] In the Snake River canyon in Idaho, nests are 5 to 8 km (3.1 to 5.0 mi) apart, while two other nearby studies in Idaho found the average distance were 4.3 km (2.7 mi) and 4.39 km (2.73 mi), respectively.[93][94] The nesting density for a breeding population near Livermore, California and the Altamont Pass Wind Farm is among the highest in the world for golden eagles, with at least 44 pairs in 1997, a density of one pair per 19 km (12 mi).[95][96] Due to the consistency of use by golden eagle pairs, population densities change generally happens only quite gradually.[2]

Nest requirements[edit]

The cliff nest of a golden eagle

Golden eagles seem to prefer to build their nests on cliffs where they are available.[89] Nests are generally located at around half of the maximum elevation of the surrounding land. This height preference may be related to having the ability to transport heavy prey downhill rather than uphill. A massive benefit to cliff nests is that they tend to be largely or entirely inaccessible to mammalian predators on foot (including humans).[2] In Spain, studies revealed the preferred sites of golden eagle nests were on inaccessible cliffs at a great distance from tracks, roads and villages.[97] 95.6% of 410 nests built in Scotland were on cliffs.[98] Similarly, in Bulgaria, Italy, Switzerland, France and Yugoslavia, more than 90% of golden eagles nests were located on cliffs.[99][100][101][102] Greek nests are mostly on cliff ledges, but in the Evros District, nearly 30% of the population nests on trees, mostly pines.[103] Rural, arid areas of Europe such as the Iberian peninsula, Provence in France and the Apennines in Italy, fire combined with pastoral activity has maintained suitable nesting sites at relatively low elevations.[2] In the Spanish Pyrenees, however, nest were found at up to 1,500 m (4,900 ft) in elevation.[104] 80% of nests in Spain are on rocky cliffs, the remaining 20% being in trees.[105] Rocky, low mountainous areas are used for nesting in Israel.[53] All known nests in Iraq have been on cliffs.[106] In Norway, the mean elevation of nests was 500–600 m (1,600–2,000 ft).[90] Throughout the Baltic States and eastern Fennoscandia, golden eagles inhabit relatively flat wooded peatlands and, here, the local golden eagles generally nest in trees. Tree nests are known to be used exclusively in Estonia and Belarus.[107][108] On the island of Gotland in Sweden, the trees holding nests had an average trunk diameter of more than 55 cm (1.80 ft) and an average height of 17.2 m (56 ft) with the nest being located at an average of 11.7 m (38 ft) above the ground.[109] Cliff nests are preferred as nesting sites in most of North America.[110] In Northern California, tree nests were apparently mainly used.[61] In the forested landscape of western Washington, where large clear cut areas having provided suitable hunting habitat, golden eagles almost exclusively nest in Douglas firs (Pseudotsuga menziesii) at forest edge. There, the nest-hosting tree were 38 to 72 m (125 to 236 ft) with the nest being located at a height of 20 to 64 m (66 to 210 ft).[111] In a study of 170 eyries in the state of Wyoming, 111 were on deciduous trees, 36 in ponderosa pines (Pinus ponderosa) and 23 on sides of buttes or bluffs along river. Cottonwood and willow trees dominated the trees selected, averaging 73 cm (2.40 ft) in diameter and 13.4 m (44 ft) in height.[111] In Wyoming, the tree nests are often the tallest tree in a stand and are in a small or isolated woodlot less than 500 m (1,600 ft) away from large clearcuts or fields.[111] Ground nest are rare in Scotland but not uncommon in the United States, especially in arid areas of states such as Nevada, North Dakota and Wyoming. Ground nests typically occur on lofty hills where have little ground vegetation and require adults to have a good protective all-around view.[2][111][112][113] Other exceptional nest sites known in North America have included river banks,[114] abandoned gold dredges[55] and electrical transmission towers.[61]

Both heavy rain and excessive heat can potentially kill nestlings, so golden eagles often place their nests to suit the local climate.[2] In Northern areas, such as Alaska, sun exposure (Southern orientation) may help nesting success, while those nesting in hot, lowland Utah and arid regions of Israel were mainly northerly facing to keep the nest out of the hot glare of the sun.[80][115] Almost all established breeding golden eagles build more than one nest.[2] A typical range of nests per pair is between 2 and 5. In Sweden, pairs on average built 2.4 of them.[109] There is an average of about 4.5 nests per pair in Scotland.[2] In Idaho, there was an average of 6 nests per pair.[93] In more exceptional cases, up to 13 nests have built by a single pair in Scotland and up to 12 by a single pair in Idaho.[2][93] Some pairs utilize alternate nest sites every year, others apparently rarely use alternate nests.[2] Some golden eagle pairs may not use a nest for up to six years after its construction.[2] Golden eagle nests usually consist of heavy tree branches, upholstered with grass when in use. As is typical of a large accipitrid, the nests of golden eagles are very large. However, they are smaller on average than bald eagle nests.[116] In Kazakhstan, golden eagle nests were similar in size to white-tailed eagle nests.[117] In the Isle of Mull in Scotland, however, white-tailed eagle nests were slightly larger as they used thicker, larger sticks lined with grass that make a more massive nest than the isle's golden eagle nests, which used thinner sticks or heather and lined their nest with woodrush.[2] In Arizona, golden eagle nests averaged 175.7 cm (69.2 in) in length (ranging from 121.9 to 264.2 cm (48.0 to 104.0 in)), 119.8 cm (47.2 in) in width (range of 83.8–203.2 cm (33.0–80.0 in)), and 65.0 cm (25.6 in) in height (range of 12.7–200.7 cm (5.0–79.0 in)). The sticks used in the Arizona nests ranged up to a length of 185.4 cm (73.0 in), a diameter of 5.3 cm (2.1 in) and a weight of 980 g (2.16 lb).[116] Nests in Scotland average 133 cm (52 in) in length, 106 cm (42 in) in width and 79 cm (31 in) in depth.[2] In Washington state, tree nests averaged 90 cm (35 in) in depth and 1.2 to 1.5 m (3.9 to 4.9 ft) in diameter.[116] Nests in Sweden averaged 140 cm (55 in) in length, 140 cm (55 in) in width and 110 cm (43 in) in depth.[118] Nests in Kazakhstan averaged 148.3 cm (58.4 in) in length, 115.7 cm (45.6 in) in diameter and 48 cm (19 in) in depth.[117] The nest of the golden eagle may weigh well over 250 kg (550 lb).[119] As the eagles use a nest repeatedly, they repair their nests whenever necessary and enlarge them during each use. If the eyrie is situated on a tree, supporting tree branches may break because of the weight of the nest. The largest known golden eagle nest, located on a steep river butte along Sun River in Montana, was 6.1 m (20 ft) deep and 2.59 m (8.5 ft) in width.[120] Certain other animals—too small to be of interest to the huge raptor—sometimes use the nest as shelter or even as a nest for themselves, for the incidental protection offered. This has mainly been associated with Eurasian wren (Troglodytes troglodytes) in Europe, though has also been recorded remarkably with ring ouzels (Turdus torquatus) and pine martens, both of which have been recorded as prey for golden eagles elsewhere in Europe.[2][121] In a similar situation, little curlews in northeastern Siberia apparently gain some protection from predators by nesting close to golden eagle eyries.[122] In each case, the natural predators of these animals are just the right size for golden eagle prey, and therefore avoid active eyries. Related species such as eastern imperial and Bonelli’s eagles have been observed to nest in abandoned golden eagle nests, as well as distantly related or unrelated raptors including white-tailed eagles, lammergeiers, gyrfalcons and peregrine falcons.[123][117][124][125]

Mating and egg-laying[edit]

Mating and egg-laying timing for golden eagle is variable depending on the locality. Copulation normally lasts 10–20 seconds. Mating seems to occur around 40–46 days before the initial egg-laying.[2] Unusual mating systems of three birds have been recorded in Scotland and Sweden, usually the third being an immature of either sex. These may simply reflect a relatively unstable period of population adjustment.[2] Occasionally, pairs have been recorded copulating outside of the context of fertilization, possibly for pair maintenance and displacement activity. In Japan, a pair was seen mating 46 days before egg laying and in the United States 55 days after egg-laying.[126][127] The date of egg laying has been directly correlated by the latitude where the pair lives.[2] In the U.S., egg laying can be from anywhere between January and September, though is usually in March or later. In Scotland, egg-laying occurs in March to mid-April.[2] The earliest median laying date in 25 international studies was December 3 in Oman; the latest median date of egg-laying was May 7 in sub-Arctic Alaska.[2][128] Egg laying starts in the dry season as early as late November around Mali and Niger while the median egg laying date in southwestern Morocco is January 15.[78][129] In Ethiopia, the estimated range of egg-laying dates ranged from October 24 to January 5.[78] The median egg laying day in Arctic Russia was May 1.[70] In the Kilbuck and Ahklun Mountains area, three pairs had eggs hatched from May 14 to 23, and young fledged from July 8 to August 10 with a median date of July 23 for 11 nests.[55] Two nests on the Kisaralik River still contained young on July 24, and four nests contained young from 16 to 21 July.[130] Clutches have been recorded range in size from 1 to 4 eggs, though two is the norm around the range. Records of single egg clutches are fairly common in Europe, with 3 being rare there but seemingly more common in North America, where up to 12% of clutches include 3 eggs. A 4 egg clutch is considered exceptional.[2][5] The lowest mean clutch size known from surveys is 1.82 eggs in the Altai Mountains of Russia.[131] A mean of 48 clutches from Algeria and Tunisia showed an average of 1.89 eggs per nests, with a range of 1 to 3.[129] The female laid an average number of eggs of 1.99 in 332 clutches from 8 studies in 5 of the Western United States. The largest mean clutch size across the range was 2.1 in Montana.[132] In the wild, eggs are typically laid at 3 to 5 day intervals, with records in captivity of intervals of up to 7 or 10 days.[133][134][135] The eggs vary from all white to white with cinnamon or brown spots and blotches. Scottish eggs averaged 75 by 59 mm (3.0 by 2.3 in) in size and weigh about 145 g (5.1 oz).[2] In Armenia, the average egg measured 76.5 by 59.1 mm (3.01 by 2.33 in) and weighed 123 g (4.3 oz). In North America, eggs average 74.5 by 58 mm (2.93 by 2.28 in), with a range of lengths from 67.5 to 85.7 mm (2.66 to 3.37 in) and a range of width of 49.4 to 63.2 mm (1.94 to 2.49 in).[136][137] Eggs of golden eagles in California weighed from 113.9 to 176.6 g (4.02 to 6.23 oz), averaging 141.4 g (4.99 oz).[138] The incubation period lasts from 41 to 45 days, averaging about 42.4 days, with previously reported claims of as low as 33 days from North America now known to be erroneous.[2][5] Females do a majority of, but not all, of the incubating and largely attain their own food up to the stage of egg-laying, after which they are typically fed by the male. The female may continue to grab most of their own food in areas where carrion is easily accessible.[133] If made to forage excessively during the incubation stage by a non-attentive mate, the female may abandon the nesting attempt.[139] In Idaho, the female did 84% of the incubation during the day, with the male doing about 16%.[139] At night, the female generally appears to do all of the incubating.[140] In Japan, the female did 90% of the observed incubating.[126]

Early life[edit]

A few day-old golden eagle nestling with its unhatched sibling's egg

The golden eagle chick may be heard from within the egg 15 hours before it begins hatching. After the first chip is broken off of the egg, there is no activity for around 27 hours. After this period, the hatching activity accelerates and the shell is broken apart in 35 hours. The chick is completely free in 37 hours.[24] Upon hatching, the chicks are covered in fluffy white down. One day after hatching, chicks will weigh 105 to 115 g (3.7 to 4.1 oz), with an average of 110.6 g (3.90 oz).[141][142] In the first 10 days, chicks mainly lie down on the nest substrate.[24] The eagles are capable of preening on their second day but are continually thermoregulated via brooding by their parents until around 20 days.[2] Within 10 days, the hatchlings grow considerably, weighing around 500 g (1.1 lb).[139] Around this age, they also start sitting up more.[24] Around 20 days of age, the chicks generally start standing, which becomes the main position over the course of the next 40 days.[24] The whitish down continues until around 25 days of age, at which point it is gradually replaced by dark contour feathers that eclipse the down and the birds attain a general piebald appearance.[2] After hatching, 80% of food items and 90% of food biomass is captured and brought to the nest by the adult male. The adult male golden eagle perch away from the nest for about 74% of the nestling period, whereas females mainly stay on the nest for about 45 days after the first chick hatches.[139] The voice of nestlings advances from a soft chirp to a disyllabic seeir at around 15 days of age and then to a louder, clearer and conspicuously harsher psaa call given from about 20 days of age to as late as several weeks after fledging.[24] From 10 days to 45 days of age, the nestlings eat much more food and grow considerably. Meal size increases throughout the nesting season, the estimated morsel of flesh fed to the young ranged from 6 mm (0.24 in) at hatching to 15 mm (0.59 in) at fledging.[139] The nestling golden eagles start “mantling” over food at around 10–20 days old: when given a food object, they stand over it, wings partially open, tail fanned and head bowed, covering the food item completely. This is believed to be a competitive behavior as it seen only in nests with more than one chick.[2] Within a matter of days, the chicks try to defecate over the edge of the nest but are not competent at it until they are around 20 days old.[2] The average daily food consumption for female nestlings tends to be greater than those in male nestlings. The average food consumption of the nestling sexes averages 691 g (24.4 oz) and 381 g (13.4 oz) per day, respectively, with male nestlings weighing about 500 to 600 g (1.1 to 1.3 lb) less than the equivalent-aged females.[2] Despite this, males typically tend to develop sooner and fledge more quickly than the females.[143] The average amount of food brought to the nest daily was notably higher in Idaho and Montana, where an average of 1,417 g (3.124 lb) and 1,470 g (3.24 lb) of prey were brought to the nest, respectively, than in Texas, where an average of 885 g (1.951 lb) was brought.[139][144][145] For the first 30 days or so, the nestlings are fully dependent on their parents to feed them but after that period, they start standing around the edge of the nest and practice food tearing.[2] When the first chick is an average of 29 days old, the female first start perching off the nest and at 40 days of age, she stops perching on the nest platform.[139] From 50 days onward, dark brown plumage sprouts from the same sockets as the down and plumage changes become more subtle. The feet go from flesh-colored at hatching to grey to black, thence finally to yellow.[2] When they are around 20 days or so old, as the structure of their wing develops, the nestlings start wing flapping and the frequency and intensity of this behavior increases considerably by 40 days old.[24] Fledging occurs at 66 to 75 days of age in Idaho and 70 to 81 days in Scotland.[2][139]

Cainism[edit]

Cainism”, as it is sometimes called, or siblicide is inarguably the most controversial and confusing aspect of the golden eagles’ reproductive biology.[146] This is the habitual behavior in the nest of the oldest hatchling to attack and usually kill their young siblings. In fact, this behavior is quite common, not only in large accipitirids but also in unrelated raptorial birds such as skuas and owls.[143] Cainism is frequent, even typical in species of the Aquila genus. The traditionally classified genus can be broken down into two groups: facultative cainists (wherein fewer than 90% of known nests do the oldest nestling attack and kill their younger siblings) and obligate cainists (wherein more than 90% of nests do the older kill the younger siblings). The golden eagle is part of the facultative cainists group, along with the wedge-tailed, eastern imperial, steppe and greater spotted eagles. The obligate cainists are two tropical species, the Verreaux's and the tawny eagle, and one temperate-climate-dwelling species, the lesser spotted-eagle.[2][143] Other Aquila eagles seem to roughly fall into the tropical species being obligate cainists vs temperate species being facultative cainists categories.[3][5][147] Sometimes called “biologically wasteful”,[23] this strategy is most commonly explained as useful for the species because it makes the parents' workload manageable even when food is scarce, while providing a reserve chick in case the first-born dies soon after hatching. Golden eagles invest much time and effort in bringing up their young; once able to hunt on their own, most golden eagles survive many years, but mortality even among first-born nestlings is much higher, in particular in the first weeks after hatching.[2][146] This theory is borne out by the fact that the tropical species which are obligate cainists invariably have a longer average nesting period than species which nest in temperate zones.[2][3][146] In southwestern Idaho, sibling aggression occurred in all nests with 2-chick broods observed from blinds, and resulted in 1 death in 3 (43%) of 7 broods.[139] In another study, siblicide accounted for 7% of 41 nestling mortalities in southwestern Idaho.[93] 6 (40%) of 15 nestling losses in nests in Central Europe were from cainism.[148] In Scotland, there may be a weak link between food supply and cainism. On Skye, where carrion and rabbits are quite abundant, the younger sibling survives to fledge in about 20% of nests, whereas in the West-Central Highlands, where food is more scarce, the second sibling fledged in only about 4% of nests.[2] However, many nest where food availability was seemingly much higher than what all nestlings would need for food still experience siblicide.[23] The nestlings hatch in approximate 3 to 5 day intervals. If it is a three egg clutch, the mean estimated weight of the three hatchlings at the time the final egg hatches is 367 g (12.9 oz), 252 g (8.9 oz) and 98 g (3.5 oz), making the largest chick easily dominant and giving the youngest practically no chance of survival.[23] The oldest golden eagle hatchling may start acting aggressively to its younger sibling(s) as soon as it or they hatch. Within the first two days, this often escalates into “bill-stabbing” wherein the younger sibling is jabbed around their neck or the middle of their body until a gapping, fatal wound is created. If it is not directly killed, the younger sibling may starve to death, which may be an even more common occurrence. It is apparently common for the younger, weaker siblings to stop begging for food after sibling aggression starts and the parent eagles do not feed the nestlings unless they beg.[23] In some cases, the young nestlings are physically forced from the nest entirely by their older sibling.[149] It is possible that cainism is more common when the older hatchling happens to be a female but, in many cases of males hatching first, they are still larger than the younger siblings and often do dominate and kill them whether male or female.[150] In one nest in Idaho and one in Montana, the oldest sibling was reported to eat their younger siblings, the only verified instances of cannibalism in golden eagles.[45][151] Although the brooding mothers, otherwise famous for the high level of their parental care, is fully aware of the sibling aggression, in no raptorial bird species are they known to intervene when cainism occurs.[5] After the young are about 20 days old, the amount of aggression between siblings (if both survive) decreases and both chicks can usually fledge, though aggression may again increase shortly before fledging.[2]

Fledging and ensuing years[edit]

The first attempted flight departure can be abrupt, with the young jumping off and using a series of short, stiff wing-beats to glide downward or being blown out of nest while wing-flapping. The initial flight often includes a short flight on unsteady wings followed by an uncontrolled landing.[152] Young eagles stay within 100 m (330 ft) of the nest in the first few weeks after fledging. They typical have a favored perch where food is brought by the parents and the fledglings only rarely need to take to the wing.[2] 18 to 20 days after first fledging, the young eagles will take their first circling flight but they cannot gain height as efficiently as their parents until approximately 60 days after fledging.[153] Around the time they are 4 months old, the juveniles start to shun the parents attention, even if offered shelter from rain.[24] In Cumbria, young golden eagles were first seen hunting large prey 59 days after fledging and 75 to 85 days after fledging the young were largely independent of parents.[2] In Israel, at 60–70 days old after fledging, the juveniles were still close to nest and quite dependent on parents for food. At the next stage, at around 120 days old, the Israeli juvenile eagles hunting attempts increased and at 160–180 days old they moved further and further away from the nests. The juveniles in Israel first settled over 12 km (7.5 mi) away from the nests.[154] From their first winter until their fourth or fifth winter is the least well-known of the golden eagle’s life. Juveniles disperse widely during their first year, with males remaining closer to the natal area than the more highly exploratory females.[155] In North Dakota, radio-tagged juvenile golden eagles stayed within 5 km (3.1 mi) of the nest for the first 100 days after fledging but then dispersed over 15 km (9.3 mi) in the following 40 days. The study in North Dakota focused on juveniles from six different nests which successfully produced two fledglings and the behavior of the sibling-pairs was surprisingly gregarious as they flew together, perched together and mutually preened for months after independence.[87] In the juvenile stage, most Idaho non-breeders stayed within 100 km (62 mi) of their place of hatching, although some birds distributed more than 1,000 km (620 mi) away from their natal range.[156] The movements of first-year eagles from Denali National Park averaged more than 5,500 km (3,400 mi), with surviving individuals migrating south to western Canada and the Western U.S. in autumn then moving back north to western Yukon and Alaska in spring.[69] In Switzerland, juvenile birds traveled an accumulated range of 2,000 to 15,000 km2 (770 to 5,790 sq mi) whereas the adults never left their home ranges of 75 to 191 km2 (29 to 74 sq mi).[89] A radio-tagged juvenile in Spain travelled a range of more than 16,000 km2 (6,200 sq mi) in its first three years of independence, then ultimately settled in a vacant territory 26 km (16 mi) from its hatching place.[157] There is a handful of records of pairs of sub-adult golden eagles (based on their plumage) nesting, sometimes even successfully producing fledglings.[158][159][160] The first attempt of nesting by six banded golden eagles in southwestern Idaho occurred when they were from four to seven years of age, with five years appearing to be the average internationally.[3][156] Once they attempt to nest for the first time, golden eagles will often return to the vicinity of the natal zone, regularly within 7 to 65 km (4.3 to 40.4 mi) of their original nest site, sometimes attacking and even killing older golden eagles pairs if they occupy the area.[161]

Reproductive success[edit]

Golden eagle - nest scene reconstitution

Generally breeding success seems to be greatest where prey is available in abundance.[2] In Central Utah, 57% of eggs successfully hatched out of 87 eggs from 44 clutches.[162] In Idaho, 65% of 282 eggs from 145 clutches successfully hatched, and in Montana, 86% of 28 eggs from 14 clutches hatched.[45][163] In Scotland, the highest breeding success of golden eagles was in the Eastern Highlands where heather moorland still abundant, bearing plentiful red grouse and mountain hare.[2] The jackrabbit follows a 10-year cycle where it peaks and crashes. In Idaho, 100% of observed nests produced at least one fledgling when the jackrabbits peaked in the late 1970s through the early 1980s and then at the low point in the mid to late 1980s, the nests produced on average only 0.2 fledglings.[164] Similarly, in central Utah jackrabbit numbers were correlated with average number of young reared by 16 golden eagle pairs. Here the average number of young ranged from 0.56 in 1967 to 1.06 in 1969 to 0.31 in 1973.[165] In Sweden, nesting success rose noticeably in years where the hunting bag (estimated quantity of prey) rose.[166] After viral hemorrhagic pneumonia (VHP) killed off many rabbits in Spain, the average breeding success of golden eagles in Northern Spain dropped from 0.77 in 1982-1989 to 0.38 by 1990-1992.[167] In Belarus, the average brood size is reportedly 1.8 whereas the average number of fledglings is 1.1.[108] As previously mentioned, adverse weather can affect breeding success. In the exceptionally stormy and cold spring of 1984 in Montana, 71% (10 out of 14) studied nests failed.[168] A long period of exceptionally rainy, cold springs in Scotland reportedly resulted in a 25% reduction of fledging pairs being produced. Rather than directly killing the nestlings, stormy, wet weather probably causes the most harm to productivity due to the hampering of the parents ability to hunt.[169] In arid areas, heavier rainfall has the opposite effect and actually improves nesting success. Rainy years in the deserts of Israel, which provide more brown hares and chukars to hunt, were more successful years for breeding.[170] While siblicide is estimated to claim about 80% of second hatchlings among golden eagles, in some parts of the range, the survival rate in successful nests is higher. In ideal habitats in North America (Northwestern United States and Alaska), 38 to 56% of nests produce a second fledging.[69] Populations at northern end of range have smaller broods (brood size being about 12% smaller) and produce fewer fledglings (population productivity being about 25% smaller) than those in temperate areas, as has been revealed by contrasting studies of Alaska to Idaho.[66][69]

Longevity[edit]

Golden eagles are fairly long-living birds in natural conditions. The survival rate of raptorial birds tends to increase with larger body size, with a 30-50% annual loss of population rate in small falcons/accipiters, a 15-25% loss of population rate in medium-sized hawks (i.e. Buteos or kites) and a 5% or less rate of loss in eagles and vultures. The oldest known wild golden eagle was a bird banded in Sweden which was recovered 32 years later.[2] The longest-lived known wild golden eagle in North America was 23 years and 10 months.[171] The long-lived known captive golden eagle, a specimen in Europe, survived to 46 years of age.[133] The estimated adult annual survival rate on the Isle of Skye in Scotland is around 97.5%.[172] When this extrapolated into an estimated lifespan this results in 39 and half years as the average for adult golden eagles in this area, which is probably far too high an estimate.[2] Survival rates are usually much lower in juvenile eagles than in adult eagles. In the western Rocky Mountains, 50% of golden eagles banded in the nest died by the time they were 2 and a half years and an estimated 75% died by the time they were 5 years old.[173] Near a wind turbine facility in west-central California, estimated survival rates, based on conventional telemetry of 257 individuals, were 84% for first-year eagles, 79% for 1- to 3-year-olds and adult floaters and 91% for breeders; with no difference in survival rates between sexes.[61] Survival rates may be lower for migrating populations of golden eagles.[174] A 19-34% survival rate was estimated for juvenile eagles from Denali National Park in their first 11 months.[174] The average life expectancy of golden eagles in Germany is 13 years, extrapolated from a reported mere 92.5% survival rate.[175]

Natural mortality[edit]

Natural sources of mortality are largely reported in anecdotes. On rare occasions, golden eagles have been killed by competing predators or by hunting mammalian carnivores, including the aforementioned wolverine, snow leopard, cougar, brown bear and white-tailed eagle attacks. Most competitive attacks resulting in death probably occur at the talons of other golden eagles. Nestlings and fledglings are more likely to be killed by another predator than free-flying juveniles and adults. It has been suspected that golden eagle nests may be predated more frequently by other predators (especially birds, which are often the only other large animals that can access a golden eagle nest without the assistance of man-made climbing equipment) in areas where golden eagles are regularly disturbed at the nest by humans. Jeff Watson believed that common raven occasionally eats golden eagle eggs but only in situations where the parent eagles have abandoned their nesting attempt.[2] However, there are no confirmed accounts of predation by other bird species on golden eagle nests.[2] Occasionally, golden eagles may be killed by their prey in self-defense. There is an account of a golden eagle dying from the quills of a North American porcupine (Erethizon dorsatum) it had attempted to hunt.[176] On the Isle of Rùm in Scotland, there are few cases of red deer trampling golden eagles to death, probably the result of a hind having intercepted a bird that was trying to kill a fawn.[177] Although usually well out-matched by the predator, occasionally other large birds can put up a formidable fight against a golden eagle. An attempted capture of a great blue heron by a golden eagle resulted in the death of both birds from wounds sustained in the ensuing fight.[178] There is at least one case in Scotland of a golden eagle dying after being “oiled” by a northern fulmar, a bird whose primary defense against predators is to disgorge an oily secretion which may inhibit the predator's ability to fly.[179] Of natural sources of death, starvation is probably under-reported. 11 of 16 dead juvenile eagles which had hatched in Denali National Park had died of starvation.[174] Of 36 deaths of golden eagles in Idaho, 55% were possibly attributable to natural causes, specifically 8 (26%) from unknown trauma, 3 (10%) from disease and 6 (19%) from unknown causes.[180] Of 266 golden eagle deaths in Spain, only 6% were from unknown causes that could not directly attributed to human activities.[181] Avian cholera caused by bacteria (Pasteurella multocida) infects eagles that eat waterfowl that have died from the disease. The protozoan Trichomonas sp. caused the deaths of 4 fledglings in a study of wild golden eagles in Idaho.[93] Several further diseases that contribute to golden eagle deaths have been examined in Japan.[182] A captive eagle died from two malignant tumors - one in the liver and one in the kidney.[183]

In human culture[edit]

1870s illustration of burkut falconers in Kazakhstan

As early as recorded history, mankind was fascinated by the eagle. Most early recorded cultures regarded the golden eagle with reverence. It was only after the Industrial Revolution, when sport-hunting became widespread and commercial stock farming became internationally common, that humans started to widely regard golden eagles as a threat to their livelihoods. This period also brought about the firearm and industrialized poisons, which made it easy for humans to kill the evasive and powerful birds. The following are various reportages of the significance of eagles, many likely pertaining to the golden eagles, in early cultures and older religions as well as national and military insignias.

Falconry[edit]

Russian depiction of Mongolian falconers fox-hunting with a golden eagle.

Golden eagles can be trained to be highly effective falconry birds, though their size, strength, and aggressiveness require careful handling to control the risk of injury to the falconer.[184] They have been used in this practice at least since the Middle Ages. In Asia, they were reportedly used in teams to hunt such animals as deer, antelope and wolves. Concurrently in Europe, their use for falconry was typically reserved for Emperors and Kings, which is why there are several common names for the golden eagle in various languages that roughly translate as the “royal eagle”.[185] In the United States falconers seldom use golden eagles, as the similarly aggressive Ferruginous hawk is more available and provides a similar hunting experience with most of the same game species with lower risk of injury to the falconer.[186] The most common interaction of American falconers with golden eagles is in trying to avoid them in order to reduce golden eagle attacks on their trained birds.[187] The very athletic golden eagle is approximately as swift as the large falcons, is quite willing to attack smaller raptors when the opportunity is available, and is often capable of flying down a falcon or hawk. Experienced falconers will consequently not fly their birds if golden eagles are spotted, and usually prefer to fly later in the day when the golden eagles have typically already fed.

The culture in which falconry with golden eagles is prominent today is amongst the Kyrgyz people of the Tien Shan Mountains of southeastern Kazakhstan and Kyrgyzstan.[188] This practice is also culturally prominent in western Mongolia and Xinjiang.[189][190] There are around 250 active eagle hunters in Bayan-Ölgii Province of Mongolia, and 50 in Kazakhstan.[191][192] In these cultures, the golden eagle is considered a highly-valued working animal which will be used for 15 years or more. Falconers carry their bird on a gloved right hand, usually with a wooden brace to support its considerable weight. In the Tien Shan Mountains, falconry mostly occurs in late fall and early winter. It is possible for up to 30 to 50 foxes to be caught by a single eagle during this season.[2]

Full-grown wolves are not believed to be viable prey for wild golden eagles; they are too dangerous due to their large size and large, powerful bite.[23] Despite this, falconers occasionally use golden eagles to hunt wolves. The steppe wolf (Canis lupus campestris), a relatively small-bodied race of wolf at around 35 kg (77 lb), is the main wolf reportedly hunted by golden eagles in falconry.[2] There is little solid evidence that even a well-trained golden eagle in the possession of falconers can normally overtake a healthy adult wolf without assistance, either from other eagles or from their human “owners”.[193] Some wolves prove particularly challenging quarry: there is the tale of one that was injured by 11 successive eagles but foiled their attempts – killing each one – until it was finally dispatched thanks to the efforts of a twelfth eagle.[194]

Heraldry and myth[edit]

Main article: Eagle (heraldry)

The golden eagle is the most common national animal in the world, with five nations—Albania, Germany, Austria, Mexico and Kazakhstan—making it the national animal. It is also a common motif in the national symbols of countries that have not officially made it the national animal or national bird. The reasons for this are various, but among the nations that use the golden eagle as or in a state symbol, there are two clear traditions that help explain the modern usage. Among European countries, the golden eagle was the model for the aquila, the most prominent symbol of the Roman legions and more generally the Roman civilization that had such a powerful impact on Western culture; furthermore, some Roman traditions were carried on by the Byzantine Empire in the Southern and Eastern of Europe and the Holy Roman Empire in Central and Western Europe, transmitting the use of the golden eagle to several modern states. This association of the golden eagle with Rome has also led to the adoption of similar symbols in other countries; for instance, the adoption of the related and physically similar bald eagle as the national bird of the United States was inspired by the conception of the United States as a modern reincarnation of the Roman Republic, a theme that recurs in other elements as well (including the prevalence of neoclassical architecture in American public buildings and the use of Roman terminology—such as naming the upper house of Congress the Senate—to hark back to the Roman model). In perhaps one of the golden eagle's more unfortunate representations in human culture, Adolf Hitler used a golden eagle regularly as a symbol for the Nazi Party, including large monuments or statues on buildings and bridges as well as the pins worn on lapels of Nazi officers. In this case, the eagle was used as to stir up nationalism, since it was a longtime symbol (Hoheitszeichen) for the German Empire dating back centuries in use for the Coat of arms of Prussia.[2][195]

Another large tradition of using the golden eagle can be found in the Arab world, where the eagle is historically a symbol of power in Arabic poetry, and was according to legend the personal emblem of Saladin. The specific depiction of golden eagle legendarily considered to be Saladin's was adopted by the Arab nationalist movement, and currently appears on the arms of Egypt, Iraq, and Palestine; it had previously appeared on the arms of the People's Democratic Republic of Yemen (1967–1990) and on the arms of the Libyan Arab Republic (1970–1972). The current emblem of Yemen displays a golden eagle, but it is not that of Saladin. In Japanese culture, the main representation of eagles in mythology is Tengu, a monster human-bird possibly modeled on an eagle and given its mountain dwelling habits, perhaps partially inspired by golden eagles. Tengu is described as a bipedal creature with a long nose-beak, wings and a fan with 12 wooden ribs, resembling tail feathers, though is sometimes is illustrated as far more human-like than bird-like. Mischievous and powerful, Tengu is mainly the protector of the mountains, is able to foretell the future, creates winds and even attack people who try to harm the mountainous landscape.[2]

Religion[edit]

Eagles are often prominent in The Bible, though are sometimes mixed with carrion birds and are not specifically identifiable to species. As the most widespread eagle in the Middle East and Eurasia, certainly many said references must pertain to the golden eagle. The use of eagles seems generally heavier in the Torah or the Old Testament than in the New Testament. In biblical times, eagles and other meat-eating birds were banned from being eaten since their diet was considered unsavory.[196] However, eagles are mentioned in the Bible as being admired for their swiftness,[197] great physical power[198] and their seemingly endless endurance.[199] Eagles are one of four dimensions of creation,[200] as a messenger of God,[201] and a skilled predator.[202] Eagles are also widespread in the Bible for symbolism.[2] For example, due to the perceived high level of parental care, eagles were associated with protection and even paralleled to God carrying the Israelites out of Egypt.[203]

Earlier Eurasian cultures and faiths also feature eagles quite prominently. In Hellenistic religion, the golden eagle is the signature bird of the god Zeus, a connection most notable in the myth of Ganymede, where the god adopted the form of a golden eagle to kidnap the boy, as well as the eagle-like daimon Aetos Dios Theoi: EAGLE OF ZEUS . At least a few sources also associate it with Helios. In Norse mythology, the golden eagle sits atop Yggdrasil, the great ash tree that runs through the universe. A squirrel, Ratsatosk, carries messages and insults between the eagle at the crown and a serpent gnawing at the tree roots.[204] In many cultures, eagles were viewed as a link between terrestrial mankind and celestial deities.[205] Eagles were particularly prominent in Roman culture. Many banners, coins and insignias from Rome feature eagles. In Roman religion, the eagle was both the symbol and the messenger of the Roman sky-god, Jupiter. When an emperor died, his body was burned in a funeral pyre and an eagle was released above his ashes to carry his soul to the heavens. Somewhat surprisingly, eagles play a small role in Celtic mythology.[206] In Celtic stories, eagles are often characters who have transformed from human to bird form. One of the most prominent eagle-related Celtic myths is that of Llew Llaw Gyffes who escaped death at the hands of a hunter who spears him by taking an eagle’s form and killing the hunter.[207] When the Roman Empire blended with Celtic tradition, many symbols feature both eagles and the Celtic sun gods.[2]

In North America[edit]

A ceremonial head-dress made by the Nez Perce people from the tail feathers of juvenile golden eagles in what is now Idaho

Because of the nature-based culture, religions and lifestyles of the people living there, eagles were often even more prominent in ancient North America than in Eurasia. The eagle is a sacred bird in some of the cultures there and the feathers of the eagle are central to many religious and spiritual customs, especially among some Native Americans in the United States and First Nations in Canada, as well as among many of the peoples of Mesoamerica. Some Native American peoples revere eagles as sacred and the feathers and other parts of bald and golden eagles were prominent possessions amongst tribes. Feathers are often worn on Native American headdresses and have been compared to the Bible and crucifix of Christianity. Eagle feathers were also used to construct prayer sticks, doctors’ rattles and medicine pipes. Per Thomas E. Mails: "in the mind of the Plains warrior in the 18th and 19th century, the male golden eagle flew above all the creatures of the world and saw everything. Nothing matched his courage and swiftness, and his talons had the strength of a giant's hand. The eagle was very holy."[208] The tail feathers of juvenile golden eagle feathers have often been used in various Native ceremonies and are used to honor noteworthy achievements, great strength and healing abilities and qualities such as exceptional leadership and bravery.[208] The golden eagle is thought to be the origin of the Thunderbird legends of the southwestern United States,[185] In the Cheyenne, golden eagles are referred to, in addition to "Thunderbird", as "bird father", "war eagle", "striped eagle" and "prairie eagle".[2] The “eagle dance” is an important part of Sioux tradition, wherein the participants would dance around, mimicking the motions of a flying eagle while chanting the equivalent of “The eagles are flying, the eagles are flying. The eagles are here, the eagles are here…”[208] No Native warrior would be allowed to kill an eagle for his feathers until he had proven his bravery in battle with other tribes. Per Mails, “It has been claimed that the Indian warrior would rather part with his horse, his tipi or even his wife, than lose his eagle feathers in battle, since to have this happen would be to make dishonor and loss of status in the eyes of his entire tribe”.[208] The warriors were not allowed to use weapons when capturing eagles for their feathers. The most common method to capture golden eagles was to lay a trap, consisting of an earth-colored tarp, with a dead jackrabbit on it, over a pit containing a crouching warrior. When the eagle came to land on the tarp, the warrior would grab the eagle by the top of its feet to pull it in and kill it. Apparently, if the warrior failed to grab the eagle properly it sometimes resulted in serious injury to the human.[208] In the Hopi tribe, one of two eagle nestlings (it was strictly forbidden to capture one unless there was two nestlings in the nest) would be captured and raised with great care, until it reached an age where it could be killed and harvested for its feathers.[209]

Current United States eagle feather law (50 CFR 22) stipulates that only individuals of certifiable Native American ancestry enrolled in a federally recognized tribe are legally authorized to obtain eagle feathers for religious or spiritual use. Thus, the supply of eagle material for traditional ceremonial use can be guaranteed and ceremonial eagle items can be passed on as heirlooms by their traditional owners without the restrictions that would usually apply. Commercial trade in golden eagles or their feathers or body parts is not legalized by these exceptions.[210]

Postage stamps[edit]

Golden eagle logo on the tail fin of a Cessna 421B Golden Eagle twin-engine light aircraft

The golden eagle is the eighth-most common bird depicted on postage stamps with 155 stamps issued by 71 stamp-issuing entities.[211][212]

Other[edit]

J.R.R. Tolkien used an image of an immature golden eagle from T. A. Coward's 1919 work The Birds of the British Isles and Their Eggs for an illustration depicting Bilbo Baggins awaking next to Gwaihir, a giant eagle of Middle-earth.[213]

American aircraft manufacturer Cessna manufactured its Model 421 series of aircraft between the late 1960s and mid-1980s, calling the type the Golden Eagle.

Status and conservation[edit]

In flight in Czech Republic

At one time, the golden eagle lived in a great majority of temperate Europe, North Asia, North America, North Africa, and Japan. Although widespread and quite secure in some areas, in many parts of the range golden eagles have experienced sharp population declines and have even been extirpated from some areas. The total number of individual golden eagles from around the range is estimated to range somewhere between 170,000 and 250,000 while the estimated total number of breeding pairs ranges from 60,000 to 100,000.[2][214] Few other eagle species are as numerous, though some species like tawny eagle, wedge-tailed eagle and bald eagle have total estimated populations of a similar size to the golden eagle’s despite having distributions which are more restricted.[3][5] The world’s most populous eagle may be the African fish eagle (Haliaeetus vocifer), which has a stable total population estimated at 300,000 individuals and is found solely in Africa.[3][215] On a global scale, the golden eagle is not considered threatened by the IUCN.[1]

Eurasia[edit]

In Europe, there are an estimated 6,000 to 10,000 breeding pairs. There was a great decline in Central Europe where they are now essentially restricted to the Apennine, Alps, and Carpathian Mountains. The strongholds in the continent are Spain, which holds an estimated 1,300 breeding pairs, Norway, which holds an estimated 860 to 1,040 breeding pairs and European Russia, which holds an estimated 500 to 1,000 breeding pairs.[216] Other European countries with stable and sizable populations include Italy, with an estimated 476-541 pairs, Switzerland, with 300-310 pairs and Romania, with an estimated 85-130 pairs.[216] The following nations are thought to have golden eagle populations that are increasing: Bulgaria with 150-170 pairs, Denmark with 1 known breeding pair, Finland with an estimated 300-350 pairs, France with approximately 390-460 pairs, Hungary with 3-5 known pairs, Ireland with 2 current pairs and Poland with approximately 35-40 pairs.[216][217] The following nations are thought to have decreasing golden eagle populations: Albania with about 50-200 pair, Croatia with approximately 90-110 pairs, England with no known current pairs, Greece with an estimated 100-200 breeding pairs and Latvia with somewhere around 5-10 pairs.[103][216][218] Several other European countries have a small number of golden eagles with less than 50 breeding pairs but with populations that are generally considered stable.[216] Despite their large population there, the golden eagle was considered near threatened in Spain in a 2003 report.[219] One of the authors of the previous study asserted that the population had increased in 2008 by perhaps 20% in Spain since the last survey in the late 1990s.[220] In Belarus, the population has reportedly declined considerably due to trapping, poisoning and the draining and development of upland bogs.[108] The golden eagle is considered Critically Endangered in the Czech Republic, where it was once quite common in the Beskydy and Krkonoše Mountains until logging hit the area hard around the time of World War II. All recent breeding attempts by the species in the Czech Republic are believed to have been unsuccessful.[221]

In Britain, the last comprehensive survey of golden eagles took place in 2003, and found 442 occupied territories.[222] A less thorough survey in 2007 showed that in addition to large numbers of territories in the Scottish Highlands and the Inner and Outer Hebrides, there were a handful of birds in southern Scotland and northern England.[223] The population is higher today in Scotland than it was in the 19th century, due to the heavy persecution at that time by sheep farmers, gamekeepers, and collectors.[2] There may have been as few as 190 pairs in the 1950s, though this survey may have not been complete.[224] Between 1969 and 2003 they nested in the Lake District, Cumbria.[222] In Ireland, where it had been extinct due to hunting since 1912, efforts are being made to re-introduce the species. In April 2007, a pair of golden eagles produced the first chick to be hatched in the Republic of Ireland in nearly a century. Forty-six birds were released into the wild in Glenveagh National Park, County Donegal, from 2001 to 2006, with at least three known female fatalities since then. It is intended to release a total of sixty birds, to ensure a viable population. The reintroduced golden eagles at the park produced a pair of fledglings for the first time in 2011.[225] The golden eagle is classified as bird of “High Conservation Concern” in Ireland.[226]

Fewer estimates are known from Asia and North Africa. A stronghold population is in mountainous Turkey, where the large population included an estimated 2,000-3,000 breeding pairs persist. In Japan, there is an estimated 175-260 breeding pairs, with a total population of approximately 500 individuals. One study stated that food shortages and decreases in suitable foraging habitat are assumed to be responsible for an observed decline in population size and reproductive success in Japan.[227] In the Koreas, the golden eagle is known to be rarely observed and, in 2010, only 10 were seen in South Korea during winter birding censuses.[228] Little is known in terms of population numbers elsewhere in Eurasia, with the IUCN estimating between 100 and 10,000 individuals each in China and in Russia, numbers that suggest the species occurs very sparsely in these massive countries.[229] In North Africa, the main occurrence is in Morocco, which is estimated to hold 200 to 500 breeding pairs. There appear to much fewer in other North African countries, with small, scattered populations in Algeria, Tunisia and Egypt, areas where no immature-plumaged eagles were observed in 2005.[230]

North America[edit]

In North America the situation is not as dramatic. It appears the greatest density of golden eagles anywhere in the world occurs in the Western United States and Western Canada. In total, the contiguous Western United States may hold up to 30,000 individual golden eagles, with a total of 70,000 to 100,000 individuals estimated across all of North America.[25][231][232] One estimate of the number of breeding pairs in the contiguous Western United States that excluded California, South Dakota, Montana and Oregon was 9,387.[233] The state with the largest known winter count of golden eagles is Montana with 13,138, followed by Wyoming with 10,072, Colorado with 7,081 and Utah with 5,993. Wyoming had the highest estimated set of breeding pairs 3,381-4,174, followed by 1,800 in Utah, 1,200 in Nevada and California and Idaho both with around 500 pairs (notably, Montana was not included in these particular studies, although the breeding population must include well over a thousand pair there).[234][235] In 6 out of 8 Canadian provinces where golden eagles breed, over 10,000 birds were observed in breeding bird surveys.[236] In 1981, it was estimated that there were 63,242 wintering individual golden eagles in the 16 Western United States (excluding Alaska).[237] However, there has still been a noticeable decline in some areas.

Threats[edit]

In modern times, almost all threats to golden eagles are attributable, directly or indirectly, to human activities.[238] In fact, all Aquila eagles in Eurasia face the same human-sourced threats as the golden eagle: habitat change, persecution, poisoning (often directed at other species) and collisions with man-made objects.[2] Certainly the most widespread unintentional threat to golden eagles by humans is urbanization and human-population growth which have made areas historically used by eagles unsuitable both in terms of habitat and prey availability. Habitat destruction in North American had, by the late 19th century, already driven golden eagles from some regions they used to inhabit.[239] In Southern California and the Colorado Front Range, this has been proved via long-term population and habitat surveys.[240][241] In Western China, the main threats to golden eagles are land development, the use of pesticides and apparent regular captures for falconry.[242] Fires since 1980 have caused large-scale losses of shrubs and jackrabbit habitat in areas used by eagles throughout the Intermountain West of North America. Wildfires that burned more 40,000 hectares of scrublands between 1981 and 1987 in the Morley Nelson Snake River Birds of Prey National Conservation Area affected nesting populations adversely. Nesting success at burned territories in Snake River Canyon declined after major fires. Abandoned burned territories have been subsumed by neighboring pairs, resulting in a decreased number of nesting pairs.[243] In a few cases, mankind has accidentally benefited golden eagles by logging previously heavily wooded areas. This has been recorded in the 1800s and 1900s in the Appalachian Mountains of the Eastern United States, where reforestation has now made the habitat unsuitable for nesting eagles, and in Washington state, which still holds breeding eagles in desolate areas that have been logged.[56][62] Afforestation, the commercial planting of non-native woodland, is a serious issue in Scotland, with the largest amount of it occurring in southwestern Scotland, especially in Argyll. During afforestation, the land is ploughed and in excess of 2,500 seedlings are planted per hectare, mainly with exotic conifers including Sitka spruce (Picea sitchensis) and lodgepole pine (Pinus contorta). The woodland canopy closes and ground vegetation dies, making these dark and gloomy places until harvesting in 40 to 50 years. More than 50% of land in Scotland at an elevation of 200–600 m (660–1,970 ft) has been planted as such. Afforestation requires removal of sheep and the fencing out or shooting deer, both important sources of carrion for golden eagles. Foraging areas of golden eagles have been confirmed to not include afforested areas.[2][244]

Death by collisions with man-made structures and objects can be serious local issue. Electrocution or collision with power lines has become an increasingly significant cause of mortality since the early 20th century. Apparently, juveniles birds are more susceptible than adults, being generally less cautious and physically adept.[245] Due to attempts to perch on or by flying into power lines, a total of 134 and 115 golden eagles were killed by power lines in the western United States in 1972 and ’73, with a peak of 66 in Utah in 1972.[246] Today, golden eagles still regularly meet their demise due to power lines in the United States and the species was considered the bird-of-prey in North America most likely to killed by them.[247] 266 examined golden eagle deaths from 1980 to 1990 in Spain showed that 14 of the deaths (5%) were from electrocution and 57 (21%) were from wire collision.[181] Compared to the United States and Spain, in some other parts of the range such as Scotland and Scandinavia, electrocutions and wire-collisions are rare due to fewer high power-poles in the desolate areas that the golden eagles occupy.[2] Controversially, the US Fish and Wildlife Service has permitted that a "wind-farmer" in central Oregon could legally cause the incidental killing of golden eagles by large wind turbines. Such turbines have set up as an alternative source of energy but are often fatal for high-flying birds such as raptors.[248] Wind turbine blades appear to move slowly from a distance but at close range move so quickly as to appear a nearly invisible blur. It is estimated that up to 70 golden eagles may be killed locally by turbines each year in west-central California, almost all of them being juveniles as opposed to adults which tend to remain on their home ranges that largely occur outside of the wind farm area.[61][249] There are mounting concerns of the effect of wind turbines in Europe as well, since construction of new ones are increasing in Scotland and Spain.[250][251] Collisions with automobiles rarely claim golden eagle lives, though instances of this can increase in desolate areas during winter, when road-side prey or carrion may attract the eagles. In the Diablo Range, California, 5% of 61 radio-tagged birds died from vehicle collisions.[61] Where disturbance is regular, breeding failure for golden eagles is significantly more frequent. This was certainly inferred in the 1982 Scottish breeding bird survey when disturbances were heavy in the Highlands.[2] Sheep farmers and egg-collectors are the leading cause of disturbances at the nests. Recreation, forest management and development projects such as road construction, mining or power generation are other potential sources of disturbances. When disturbed by humans at the nest, the parents frequently leave their nest for a period of up to two hours, reduced provisioning rates, endangered eggs or young to predation, as well as overheating, chilling or desiccation.[252] Human intrusion within 750–1,500 m (2,460–4,920 ft) of nests can cause disturbance.[253] Nesting success was found to be reduced in Norway during years where the Easter holidays fell early, apparently due to the volume of vacationers in the countryside in these years during the pivotal early stages of nesting.[254] During a study in Wrangell – St. Elias National Park and Preserve of Alaska, experimenters camped within 400 m (1,300 ft) of active nests, which led to reduced food delivery and nest attendance by the parents, then at 800 m (2,600 ft), at which distance the disturbance of nesting behavior seemed to decrease considerably.[255] The topography of the landscape and location of the nest can affect how closely the nest can be approached without disturbance.[256] Mining and various types of energy development occur in eagle nesting and wintering habitat. The practice of surface coal mining threatens the limited nesting sites in Wyoming.[257] In the Italian Apennines, high levels of nesting failures have been contributed directly to disturbance, thanks to increased tourism in remote mountain areas, construction of new roads and mining.[258] Aggressive behavior by golden eagles due to a human presence near the nest is considered exceptional and usually only result in minor injuries if any, as a particularly bold eagle may rarely attempt to dissuade a human trespasser.[133][259] Golden eagles are somewhat sensitive to human disturbance even while not nesting. Experimental studies showed that pedestrians, which caused flushing at 105–390 m (344–1,280 ft), were more likely to cause wintering golden eagles in Colorado to flush than vehicles, at 14–190 m (46–623 ft). This study showed that golden eagles were more sensitive to human disturbance during winter than several other raptor species, including Bald Eagles.[260]

The intentional killing of golden eagles has been a huge conservation hurdle for the species. While illegal in most countries today, hunting, trapping and poisoning may still occur clandestinely across almost the entire range. During 1948, in Carter County, Montana, 286 golden eagles were shot and killed in the month of March alone. At the time $5 was offered by the Montana Fish and Game Commission for each eagle killed, a bounty initiated by pressure from sportsmen and ranchers who believed that eagles were killing large numbers of sheep and “antelopes”.[261] Approximately 20,000 golden eagles were killed from light aircraft in the Southwestern United States in the 1940s, with the rate of such shooting in Texas having continued at over a thousand a year (5,000 from 1942 to 1947).[262] In the United States, the golden eagle was given federally protected status in 1963. Allegedly, in 1972, over 800 golden eagles were shot from aircraft in Wyoming and Colorado.[28][263] In Switzerland more than 100 golden eagles were reportedly shot each decade until the species was legally protected in 1953.[89] In Scotland, many estate managers would pay gamekeepers to hunt down any and kill all eagle species in the 1800s and early 1900s. On one estate in Caithness, Scotland, allegedly 295 eagles (including both golden and white-tailed eagles) were shot and trapped from the years of 1820 to 1826.[264] Occasionally, golden eagles may be caught in trap lines laid out to capture mammalian predators.[180] Today, some authorities believe many game managers still try to deliberately destroy the contents of nests in spring or intentionally disturb the eagles during their nesting process.[2] In a study conducted in Scotland, areas were broken down between low disturbance areas (with a low human presence and limited history of persecution), moderate areas (where minor disturbances occur, mainly unintentionally from hill-walkers or rarely intentionally by egg-collectors) or severe disturbance areas (where persecution, heavy disturbance and considerable egg-collecting is believed to still occur). In low disturbance areas, about 45% of nests failed, in moderate disturbance areas about 74% failed and in severe disturbance areas 93% of nesting attempts failed.[265] 73 out of 147 inaccessible nesting sites in this study (50%) produced fledglings, whereas more accessible nests produced fledglings in only 21 out of 68 nests (31%).[265] The golden eagle became legally protected in 1980 in Spain but the species is still regularly killed there today. In 266 golden eagle deaths from 1980 to 1990, 59% (157 specimens) had died from shooting or trapping and 8% (21 specimens) died from poisoning.[181]

Poisoning, both intentional and unintentional, is perhaps the most insidious man-made threat to golden eagles. The usual targets of carrion-poisoning are species such as coyotes, red fox and gray wolves, which are considered pest that threaten livestock (a charge usually vastly exaggerated by the human imagination). However, golden eagles are occasionally targeted as well for the same reasons. The main cause of mortality for golden eagles in Britain has been poisoning, with a number of 51 eagles verified to be killed by poisoning from 1980 to 2008 probably being far lower than the actual amount killed as such.[2][266] A disproportionate amount of golden eagle poisonings in Scotland from 1981 to 2000 were linked to grouse moors (where grouse are kept for the pleasure of shooting) and were probably cases of gamekeepers deliberately poisoning eagles and foxes to keep their stock of grouse high.[267] It is estimated that the adult survival rate is reduced by 3 to 5% in Scotland by intentional poisonings.[266] In the 1980s, California Ground Squirrels, due to the perception among cattle rangers that they are agricultural pests, were poisoned by the anticoagulant rodenticide, Chlorophacinone. In turn, the poisonings caused golden eagles, as one of the major natural predator of California ground squirrels, to die in turn.[268] At least 10 individuals died in 1971 from eating Thallium(I) sulfate–laced pronghorn set out by sheep ranchers in Wyoming; despite public outcries, poisoning by sheep ranchers continued into the 1980s.[263] In the 20th century, organochloride and heavy metal poisonings were also commonplace, but these have declined thanks to tighter regulations on pollution. In southern Idaho, 10 out of 17 golden eagles examined were found to have had exposure to lead.[269] As a whole, the golden eagle is less susceptible than most raptors to organochlorine pesticides because of mammal-feeding habits, as opposed to predominantly bird-eating species like peregrine falcons and fish-eating species like bald eagles, both of which had huge population declines in the 20th century due to the use of pesticides like DDT . Eggs from golden eagle nests that were collected after 1946 in North America had shell thicknesses similar to (of less than a 10% difference) those collected in earlier years.[270] However, in Scotland egg shell thickness did decrease by around 10% from 1951 to 1965.[271] A dead golden eagle collected on the island of Lewis had the highest concentration of organochlorine known from a modern bird in Scotland.[272] The higher effects of organochlorines in Scotland may be due to the fact that birds there consume a relatively high quantity of seabirds, as opposed to North America, where this practice is rare.[2]

The reason why golden eagles are intentionally killed is usually due to the fear of loss of livestock and game species. As previously described, most feeding on ungulates is probably only as a carrion. The findings of virtually every study of losses of stock to golden eagles has revealed that the actual amount of livestock killed by the eagles is negligible and financial restitution from conservation organizations should not be necessary, including those studies funded by the farming organizations or governmental programs seeking to justify the “control” of golden eagles.[2] In Scotland, studies have revealed that an estimated 0.5-8% of lamb mortality is attributable to golden eagle predation. This equates to the raptors killing about 0.15-2.4% of a given flock of sheep. Starvation and accidents are actually the primary cause of lamb deaths in Scotland, with occasional fox, crow and dog predation also occurring.[273][274][275] On the Western Isles of Scotland, a closely studied relationship between the nesting golden eagles and the local sheep flocks showed that 1 to 3% of lamb deaths were attributable to this species.[276] In North America, sheep predation is generally even rarer than in Eurasia but some flocks of sheep in Montana have experienced a relatively heavy rate of loss, more than 10% in some cases, determined to be caused by golden eagle predation in harsh-weather years that lower the numbers of jackrabbits and cottontails.[277] Some organizations have attempted to relocate golden eagles from areas where lamb predation was semi-regular. In Montana, over 400 eagles (most seemingly migratory specimens) were relocated at a cost of over $100,000. Similarly, 16 breeding eagles were relocated in Wyoming after relatively heavy levels of lamb depredation. In each case, relocation has failed as the eagles find their way back to their own home ranges or wintering grounds in a matter of a few weeks, showing that the eagles have a strong homing ability.[277][278] In northern Norway, among 36 deaths out of 263 first-year, radio-collared lambs in a free ranging sheep flock died, 17 from wolverine predation, 8 were from disease, 5 from golden eagle predation, 3 from Eurasian lynx predation and 2 from Red fox predation.[279] In Sweden, the hunting of semi-domestic reindeer by golden eagles has been analyzed. Of an estimated 120,000 reindeer born every year in that nation, golden eagles are reported to kill less than 500 of them, amounting to less than 0.4% loss.[280] Jeff Watson advocated that, instead of trying to kill the golden eagle, that sheep-farmers should encourage population growth in prey like rabbits, hares and ground squirrels, as golden eagles will generally ignore livestock if wild prey is abundant.[2]

Conservation[edit]

The golden eagle is not threatened at the species level but efforts need to be taken to prevent extinctions from many northern countries. The primary efforts undertaken to conserve the species have been, in order of prevalence from highest to lowest: conservation education and awareness, policy protection, directed land management, legislation and law enforcement and the provision of indentures.[2] In Scotland, only 3 out of 16 regions in Scotland occupied by golden eagles since 1982 have been deemed favorable for conservation status, based upon the extent of local persecution, prey abundance and habitat change.[250] The United Kingdom has put in place deterrent legislation to prevent behavior around the nest with the potential to cause harm and acts of willful harm to white-tailed eagles and some have advocated using the same policies for golden eagles.[250] Education in this region mainly is undertaken by the Royal Society for Protection of Birds (RSPB). To curb the destructive practice of afforestation, some locals have switched to planting native Caledonian pine forests instead, likely resulting in much less harm to the native fauna possibly including golden eagles.[281] While conservation efforts in Scotland have previously included the setting aside Sites of Special Scientific Interest (SSSIs), these are usually too small to benefit golden eagles. More recently, the United Kingdom government has instead taken from governmental policies enacted in Continental Europe the idea of Special Protection Areas (SPAs), which offers strong legal protection of single species. Potentially more than 7,000 km2 (2,700 sq mi) may be set aside in Scotland as SPA for golden eagles.[282] Some education of mountain-climbers in country holding breeding golden eagles has been undertaken by the Mountaineering Council of Scotland.[283] Within the United States, the golden eagle is legally protected by the Bald and Golden Eagle Protection Act.[5] In the United States, many studies of the effects of industrialization and development have been undertaken by the very companies attempting to develop near areas holding golden eagles, in order to understand and hopefully minimize harmful effects. For example, Swan Falls electric power-plant in southern Idaho has funded research into the effects of reconstruction activities on breeding raptors (including the golden eagles), the Arch Mineral Corporation has funded studies attempting to test and successfully relocate golden eagle nests and KENETECH Windpower and the National Renewable Energy Laboratory have funded research into the effects of turbine-based wind energy on golden eagles.[61][284][285] In the 1970s in the United States, bounds were made to reduce the number of golden eagles to die from electrocution and wire-collisions. The primary change has been to raise the central insulator more than 1 m (3.3 ft) above the cross-arm and to position the ground-wire at a lower height on the pole, both likely to reduce the probability of golden eagles striking the wires with their wings. Also, the power company may place an insulating tube from 1 to 2 m (3.3 to 6.6 ft) on either side of the pole attachment or, especially if the previous modifications are not feasible, install raised perches at the top of the power pole.[286] In Spain, the issue of electrocutions is more intractable because all pylons were made out of metal, which makes them much more dangerous to wildlife flying into them.[287]

The golden eagle’s effect on conservation-dependent species[edit]

On the conservation front, the golden eagle is itself unintentionally contributing to the conservation crisis of another animal, the island fox, a small insular relative of the gray fox found only in the Channel Islands of California. Golden eagles did not start nesting in these islands until the 1960s. The predominant theory on why they did not previously occupy them was that territorial bald eagles deterred them until DDT use decimated the local bald eagle population.[288] This critically endangered canid had evolved without major natural predators but the large breeding population of golden eagles in California has spilled in numbers over to the islands and is there feeding partially on the foxes, whose already declining population cannot support sustained predation.[289] Also in North America, attempts to reintroduce endangered whooping cranes by mixing them with flocks of sandhill cranes have been largely unsuccessful in part due to natural predators picking off the unnaturally unwary birds. Although the chief predator has been Bobcats, golden eagles are one of the other predators that are habitually killing the birds.[290] The golden eagle may be a competitor and, rarely, a predator of the recently reintroduced California condors in central Arizona and southern California, but the pressure exerted by the eagles on condors are seemingly minor, especially in contrast to manmade conservation issues for the species such as lead poisoning from bullets left in hunter-killed ungulate carcasses.[291][292] In Scotland, the common hen harrier has been the subject of much unfavorable attention due to the fact that it is a habitual predator of the chicks of red grouse, a subspecies considered to be near threatened in the nation. One of the methods to control harrier numbers has been proposed is to encourage a population increase of golden eagles, which may also hunt grouse but are unlikely to cull young grouse and tend to outcompete and sometimes hunt the harriers themselves.[293]

References[edit]

  1. ^ a b BirdLife International (2013). "Aquila chrysaetos". IUCN Red List of Threatened Species. Version 2013.2. International Union for Conservation of Nature. Retrieved 26 November 2013. 
  2. ^ a b c d e f g h i j k l m n o p q r s t u v w x y z aa ab ac ad ae af ag ah ai aj ak al am an ao ap aq ar as at au av aw ax ay az ba bb bc bd be bf bg bh bi bj bk bl bm bn bo bp bq br bs bt bu bv bw bx by bz ca cb cc cd ce cf cg ch ci cj ck cl cm cn co cp cq cr cs ct cu cv cw cx Watson, Jeff (2010). The Golden Eagle. A&C Black. ISBN 978-1-4081-1420-9. 
  3. ^ a b c d e f g h i j k l m n o Eagles, Hawks and Falcons of the World by Leslie Brown & Dean Amadon. The Wellfleet Press (1986), ISBN 978-1555214722.
  4. ^ "Golden Eagle, Life History". All About Birds. Cornell Lab of Ornithology. 2009. Retrieved 26 December 2010. 
  5. ^ a b c d e f g h i j k l m n o p q r s t u v w x y z aa ab ac ad ae af ag ah ai aj Ferguson-Lees, James and Christie, David A. (2001) Raptors of the World, Houghton Mifflin Harcourt Publishing Company, ISBN 0-618-12762-3
  6. ^ Peterson, Roger Tory (1998). A Field Guide to Western Birds: A Completely New Guide to Field Marks of All Species Found in North America West of the 100th Meridian and North of Mexico. Houghton Mifflin Harcourt. pp. 180–. ISBN 978-0-395-91174-7. 
  7. ^ National Geographic Field Guide To The Birds Of North America, 4th Edition. 2002. ISBN 978-0-79226-877-2. 
  8. ^ del Hoyo, J; Elliot, A; Sargatal, J (1996). Handbook of the Birds of the World 3. Barcelona: Lynx Edicions. ISBN 84-87334-20-2. 
  9. ^ a b c d e f g h Wood, Gerald (1983). The Guinness Book of Animal Facts and Feats. ISBN 978-0-85112-235-9. 
  10. ^ Bedrosian, B. & Craighead, D. 2008. Record mass for North American Golden Eagle (Aquila chrysaetos canadensis). Journal of Raptor Research, 42: 156-157.
  11. ^ Sagip Eagle. Gbgm-umc.org. Retrieved on 2012–08–22.
  12. ^ "Birds of North America Online—Birds of North America Online". Bna.birds.cornell.edu. Retrieved 2012-11-08. 
  13. ^ a b Bortolotti, G.R. 1984. Age and sex size variation in Golden Eagles. Journal of Field Ornithology, 55: 54-66.
  14. ^ Fowler, J.M. & Cope, J.B. "Notes on the Harpy Eagle in British Guiana". The Auk. Retrieved 2013-04-22. 
  15. ^ Peter Nye. "Journey North Bald Eagles". Journey North. Retrieved 2013-04-22. 
  16. ^ a b Terres, John K. (1980). "Golden Eagle". The Audubon Society Encyclopedia of North American Birds. New York: Alfred A. Knopf. p. 478. ISBN 0-517-03288-0. 
  17. ^ Clark, William S.; Wheeler, Brian K. (2001). A field guide to hawks of North America. New York: Houghton Mifflin Company. p. 241. ISBN 0-395-67067-5. 
  18. ^ a b c d Jollie, Malcolm (1947). "Plumage Changes in the Golden Eagle". Auk (American Ornithologists' Union) 64 (4): 549–576. doi:10.2307/4080715. Retrieved 27 December 2010. 
  19. ^ Clark, William S (1983). "The field identification of North American eagles". North American Birds 37 (5): 822–826. Retrieved 27 December 2010. 
  20. ^ a b Liguori, Jerry (2004). "How to Age Golden Eagles". Birding: 278–283. Retrieved 27 December 2010. 
  21. ^ a b Tjernberg, M. 1988. Age determination of Golden Eagles, Aquila chrysaetos. Bar Fagelvard, 47: 321-334.
  22. ^ Ellis, D.H. & Lish, J.W. 2006. Thinking about feathers: adaptations of golden eagle retrices. Journal of Raptor Research, 40: 1-28.
  23. ^ a b c d e f g h i j k Brown, L. 1976. Eagles of the World. David and Charles, ISBN 0360003184.
  24. ^ a b c d e f g h i j k Ellis, D. H. 1979. Development of behavior in the Golden Eagle. Wildlife Monographs, 70: 1-94.
  25. ^ a b c "Golden Eagle Fact Sheet". San Diego Zoo. Retrieved 2013-05-01. 
  26. ^ ADW: Aquila chrysaetos: INFORMATION. Animaldiversity.ummz.umich.edu. Retrieved on 2012–08–22.
  27. ^ Darling, F. F. 1934. Speed of a Golden Eagle's flight. Nature 140:325-326.
  28. ^ a b c Palmer, R.S. 1988. Golden eagle: Aquila chrysaetos. In: Palmer RS (Ed.). 'Handbook of North American birds. Volume 5'. New Haven, CT: Yale University Press. pp. 180-231.
  29. ^ Cornell University. Bna.birds.cornell.edu. Retrieved on 2012–08–22.
  30. ^ a b c d Sutton, C.; Dunne, P.; Sibley, D. (1989). Hawks in Flight: The Flight Identification of North American Migrant Raptors. Boston: Houghton Mifflin Harcourt. ISBN 0-3955-1022-8. 
  31. ^ "[Falco] cera lutea, pedibus lanatis, corpore fusco ferrugineo vario, cauda nigra basi cinereo-undulata." – "A [diurnal raptor] with yellow cere, [feathered tarsometatarsus], body dusky brown variegated with rusty, tail black with ashy-waved base." (Linnaeus 1758)
  32. ^ Brisson, Mathurin-Jacques and Martinet, François Nicolas (1760). Ornithologie; ou, Méthode contenant la division des oiseaux en ordres, sections, genres, espéces & leurs variétés. &c. Paris: C.J.B. Bauche. pp. 28, 419. 
  33. ^ a b c d Helbig, A.J., Kocum, A., Seibold, I. & Braun, M.J. "A multi-gene phylogeny of aquiline eagles (Aves: Accipitriformes) reveals extensive paraphyly at the genus level" (PDF). Elseveir. Retrieved 2013-04-23. [dead link]
  34. ^ a b c Lerner, H.R. & Mindell, D.P. "Phylogeny of eagles, Old World vultures, and other Accipitridae based on nuclear and mitochondrial DNA" (PDF). Elseveir. Retrieved 2013-04-22. 
  35. ^ "Lophaetus pomarinus". The Peregrine Fund. Retrieved 2013-04-22. 
  36. ^ "Aquila morphnoides". The Peregrine Fund. Retrieved 2013-04-22. 
  37. ^ "Aquila wahlbergi". The Peregrine Fund. Retrieved 2013-04-23. 
  38. ^ "Aquila africana". The Peregrine Fund. Retrieved 2013-04-23. 
  39. ^ Wink, M., & Sauer-Gürth, H. 2004. Phylogenetic relationships in diurnal raptors based on nucleotide sequences of mitochondrial and nuclear marker genes. Pages 483-495 in Raptors worldwide (R. D. Chancellor, and B.-U. Meyburg, Eds.). World Working Group on Birds of Prey/MME-BirdLife Hungary, Berlin and Budapest.
  40. ^ "Birds of Kazakhstan. Golden Eagle (Aquila chrysaetos chrysaetos).". birds.kz. Retrieved 2013-04-23. 
  41. ^ "Birds of Kazakhstan. Golden Eagle (Aquila chrysaetos homeyeri).". birds.kz. Retrieved 2013-04-23. 
  42. ^ Rasmussen, PC and Anderton, JC (2005). Birds of South Asia. The Ripley Guide. Volume 2. Smithsonian Institution & Lynx Edicions. p. 107. 
  43. ^ "Birds of Kazakhstan. Himalayan Golden Eagle (Aquila chrysaetos daphanea).". birds.kz. Retrieved 2013-04-23. 
  44. ^ "Himalayan Golden Eagle". Foundation for Ecological Security- Indian Biodiversity. Retrieved 2013-04-23. 
  45. ^ a b c d Cornell University. Bna.birds.cornell.edu. Retrieved on 2012–08–22.
  46. ^ "Birds of Kazakhstan. Golden Eagle (Aquila chrysaetos kamtschatica).". birds.kz. Retrieved 2013-04-23. 
  47. ^ Weesie, P. D. M. 1988. The Quaternary avifauna of. Crete, Greece. Palaeovertebrata, 18: 1-94
  48. ^ Sánchez Marco, A. (2004). "Avian zoogeographical patterns during the Quaternary in the Mediterranean region and paleoclimatic interpretation". Ardeola 51 (1): 91–132. 
  49. ^ Howard, H. 1947. An ancestral Golden Eagles a question in taxonomy. Auk, 64: 287-291.
  50. ^ Burles, D. W. & Frey, R. 1981. Raptor monitoring program, 1980 report. Kluane National Park, YT.
  51. ^ Lang, A., Bishop, M.A. & Le Seuer, A. Forktail 23 (2007).
  52. ^ Inskipp, C., & Inskipp, T. 1991. A guide to the birds of Nepal, 2nd edition. Smithsonian Institution Press, Washington, D.C.
  53. ^ a b Shirihai, H. 1996. The Birds of Israel. Academic Press, London.
  54. ^ Ritchie, R. J. and J. A. Curatolo. 1982. Notes on Golden Eagle productivity and nest site characteristics, Porcupine River, Alaska, 1979-1982. Raptor Research, 16: 123-127.
  55. ^ a b c Petersen, M. R., D. N. Weir, and M. H. Dick. 1991. Birds of the Kilbuck and Ahklun Mountain Region, Alaska. U.S. Department of the Interior, Fish & Wildlife Service, North American Fauna 76, Washington, D.C.
  56. ^ a b Marr, N.V. & Knight, R.L. Food Habits of Golden Eagles in Eastern Washington. Murrelet, 64: 73-77.
  57. ^ Craig, T. H. & Craig, E.H. 1984. Results of a helicopter survey of cliff nesting raptors in a deep canyon in southern Idaho. Raptor Research, 18 :20-25.
  58. ^ Marzluff, J. M., Knick, S.T., Vekasy, M. S., Schueck, L. S. & Zarriello, T.J. 1997. Spatial use and habitat selection of Golden Eagles in southwestern Idaho. Auk 114: 673-687.
  59. ^ Millsap, B. A. 1981. Distributional status of Falconiformes in west central Arizona-with notes on ecology, reproductive success and management. U.S. Department of the Interior, Bureau of Land Management, Phoenix District Office, Phoenix, AZ.
  60. ^ Root, T. L. 1988. Atlas of wintering North American birds; an analysis of Christmas Bird Count data. University of Chicago Press, Chicago, IL.
  61. ^ a b c d e f g Hunt, W. G., Jackman, R.E. Brown, T. L., Gilardi, J. G., Driscoll, D. E. & Culp, L. 1995. A pilot Golden Eagle population study in the Altamont Pass Wind Resource Area, California. Predatory Bird Research Group, University of California, Santa Cruz.
  62. ^ a b Spofford, W. R. 1971. The breeding status of the Golden Eagle in the Appalachians. American Birds, 25: 3-7.
  63. ^ Singer, F. J. 1974. ‘’Status of the Osprey, Bald Eagle, and Golden Eagle in the Adirondacks’’. New York Fish & Game Commission Journal, 21: 18-31.
  64. ^ a b Millsap, B. A. and S. L. Vana. 1984. Distribution of wintering Golden Eagles in the eastern United States. Wilson Bulletin, 96: 692-701.
  65. ^ Wingfield, G. A. 1991. Central plains buteos and Golden Eagle. Pages 60-68 in Proceedings of the Midwest raptor management symposium and workshop. (Pendleton, B. G., Ed.) National Wildlife Federation, Washington, D.C.
  66. ^ a b c d Collopy, M. W. and T. C. Edwards, Jr. 1989. Territory size, activity budget, and role of undulating flight in nesting Golden Eagles. Journal of Field Ornithology, 60: 43-51.
  67. ^ a b Bergo, G. 1987. Territorial behavior of Golden Eagles in Western Norway. British Birds, 80: 361-376.
  68. ^ Craig, T. H. & Craig, E.H. 1984. Large concentration of roosting Golden Eagles in southwestern Idaho. Auk 101:610-613.
  69. ^ a b c d e f g McIntyre, C.L., Douglas, D.C. & Collopy, M.W. 2008. Movements of golden eagles (Aquila chrysaetos) from interior Alaska during their first year of independence. Auk, 125(1): 214-224.
  70. ^ a b Dementiev, G.P. & Gladkov, N.A. 1966. Birds of the Soviet Union, Vol. 1. Israel Programme of Scientific Translations, Jerusalem.
  71. ^ a b Sherrington, P. 1993. Golden Eagle migration the Front Ranges of the Alberta Rocky Mountains. Birders Journal, 2: 195-204.
  72. ^ Brodeur, S., Décarie, R., Bird, D.M. & Fuller, M. 1996. Complete migration cycle of Golden Eagles breeding in northern Quebec. Condor 98: 293-299.
  73. ^ Boeker, E. L. & Ray, T.D. 1971. Golden Eagle population studies in the Southwest. Condor, 73: 463-467.
  74. ^ Thévenot, M., Bergier, P. & Beaubrun, P. 1985. Present distribution and status of raptors in Morocco. Pages 83-101 in 'Conservation studies on raptors' (I. Newton, and R. D. Chancellor, Eds.). International Council for Bird Preservation, Cambridge, UK.
  75. ^ McGrady, M.J. 1997. Golden Eagle. BWP Update, 1: 99-114.
  76. ^ Dixon, J.B. 1937. The Golden Eagle in San Diego County, California. Condor, 39: 49-58.
  77. ^ Marzluff, J.M, et al. 1997. Spatial use and habitat selection of golden eagles in southwestern Idaho. Auk, 114: 673-687.
  78. ^ a b c Clouet, M., Barrau, C. & Goar, J.L. 1999. The Golden Eagle (Aquila chrysaetos) in the Bale Mountains, Ethiopia. The Raptor Research Foundation, 33 (2): 102-109.
  79. ^ Harmata, A. R. 1982. What is the function of undulating flight display in Golden Eagles? The Raptor Research Foundation, 16: 103-109.
  80. ^ a b c Bahat, O. 1989. Aspects in the ecology and biodynamics of the Golden Eagle (Aquila chrysaetos homeyeri) in the arid regions of Israel. Master's Thesis. Tel Aviv Univ. Tel Aviv, Israel.
  81. ^ Haller, H. 1982. Spatial organization and dynamics of a population of Golden Eagles (Aquila chrysaetos) in the central Alps. Ornithol. Beob. 79:163-211.
  82. ^ Bergo, G. 1987. Territorial behaviour of Golden Eagles in western Norway. British Birds, 80: 361-376.
  83. ^ Haller, H. 1996. The Golden Eagle in the Grisons: Long-term studies on the population ecology of Aquila chrysaetos in the centre of the Alps. Ornithol. Beob. Beiheft 9:1-167.
  84. ^ Halley, D.J. & Gjershaug, J.O. 1998. Inter- and intra-specific dominance relationships and feeding behaviour of golden eagles Aquila chrysaetos and Sea Eagles Haliaeetus albicilla at carcass. Ibis, 140: 295-301.
  85. ^ Kochert, M.N. 1972. Population status and chemical contamination in Golden Eagles in southwestern Idaho. Masters in Science thesis. University of Idaho, Moscow.
  86. ^ Brown, L. H. and A. Watson. 1964. The Golden Eagle in relation to its food supply. Ibis 106:78-100.
  87. ^ a b O'Toole, L. T., Kennedy, P. L., Knight, R.L. & McEwen, L. C. 1999. Postfledging behavior of Golden Eagles. Wilson Bulletin, 111: 472-477.
  88. ^ Watson, A. & Rothery, P. 1986. Regularity in spacing of Golden Eagle Aquila chrysaetos nests used within years in northeast Scotland. Ibis, 131: 336-348.
  89. ^ a b c d Haller, H. 1982. Raumorganisation und Dynamik einer Population des Steinadlers Aquila chrysaetos 'm den Zentralalpen. Der Orinthologische Beobachter, 79: 163-211.
  90. ^ a b Bergo, G. 1984. Population size, spacing and age structure of Golden Eagles Aquila chrysaetos (L.) in Handaland, West Norway. Fauna Norvegica, Series C, Cindus: 7: 106-108.
  91. ^ a b Phillips, R.L., McEneaney, T.P. & Besko, A.E. 1984. Population densities of breeding Golden Eagles in Wyoming. Wildlife Society Bulletin, 12: 269-273.
  92. ^ Morneau, F., S. Brodeur, R. Décarie, S. Carrière, and D. M. Bird. 1994. Abundance and distribution of nesting Golden Eagles in Hudson Bay, Quebec. Journal of Raptor Research. 28: 220-225.
  93. ^ a b c d e Beecham I.J. & Kochert M.N. 1975. Breeding biology of the golden eagle in southwestern Idaho. Wilson Bulletin 87: 506-13.
  94. ^ Craig, T. H. & Craig, E.H. 1984. Results of a helicopter survey of cliff nesting raptors in a deep canyon in southern Idaho. Journal of Raptor Research, 18: 20-25.
  95. ^ Hunt, Grainger; Hunt, Teresa (June 2006). "The trend of Golden Eagle territory occupancy in the vicinity of the Altamont Pass Wind Resource Area: 2005 survey". Scientific Review Committee of the Altamont Pass Wind Resource Area. "The area surrounding the Altamont Pass Wind Resource Area (WRA) near Livermore, California contains a higher reported density of nesting golden eagles than anywhere else in the world." 
  96. ^ Hunt, W. Grainger; Jackman, Ron E.; Hunt, Teresa L.; Driscoll, Daniel E.; Culp, Lois (June 1999). "A Population Study of Golden Eagles in the Altamont Pass Wind Resource Area: Population Trend Analysis 1994–1997". National Renewable Energy Laboratory. "Annual nest surveys have revealed a substantial breeding population, the density of which is among the highest reported for the species. An 820–km2 area near the town of Livermore held at least 44 pairs in 1997, a density of one pair per 19 km2" 
  97. ^ Donazar, J.A., Cellabos, O. & Fernandez, C. 1989. Factors influencing the distribution and abundance of seven cliff nesting raptors: a multivariate study. In: 'Raptors in the Modern World' (Eds. Meyerburg & Chancellor), pp. 542-552. WWGBP, London, Berlin & Paris.
  98. ^ Watson, J. & Dennis, R.H. 1992. Nest site selection by Golden Eagles Aquila chrysaetos in Scotland. British Birds, 85: 469-481.
  99. ^ Mathieu, R. & Choisy, J.P. 1982. L'Aigle Royal Aquila chrysaetos dans les Alpes Meridonales Francaises de 1964 a 1980. Essai sur la distribution, les effectifs, le regime alimentaire et la reproduction. Bievre, 4: 1-32.
  100. ^ Grubac, R. 1987. L'Aigle Royal en Macedone. In: 'L'Aigle Royal in Europe', pp. 37-39.
  101. ^ Mickev, T., Petrov, T., Profirov, L., Yankov, P. & Gavrailov, S. 1989. Distribution and nature-defensive status of the Golden Eagle Aquila chrysaetos chrysaetos (L., 1758) in Bulgaria. Bulletin of South Bulgaria, 25: 75-87.
  102. ^ Fasce, P. & Fasce, L. 1984. L’Aquila Reale in Talia: Ecologia e Conservazione. Lega Italian Porotezione Uccelli, Serie Scientifica, Parma.
  103. ^ a b Handrinos, G., & Akriotis, T. 1997. The birds of Greece. Christopher Helm Ltd., A & C Black, London.
  104. ^ Fernandez, C. 1987. Seasonal variation in the feeding habits of a pair of Golden Eagles in Navarra. In: 'L'Aigle Royal en Europe' (ed. S Michel), 107-117.
  105. ^ del Moral, J. C. 2009. The Golden Eagle: breeding population in 2008 and census method. Seguimiento de Aves, 32: 1-185.
  106. ^ Ararat, K., Fadhil, O., Porter, R. F. & Salim, M. 2011. Breeding birds in Iraq: important new discoveries. Sandgrouse, 33: 12-33.
  107. ^ Randia, T. & Tammur, E. 1996. Population trends and breeding success of the Golden Eagle Aquila chrysaetos I Estonia 1935-1991. In: Eagle Studies (Eds. B.U. Meyerburg & R.D. Chancellor), pp. 483-487, WWWBGP, Berlin, London & Paris.
  108. ^ a b c Ivanovski, V.V. 1990. Breeding ecology of the Golden Eagle (Aquila chrysaetos) in northern Belarus. Soobshcheniya Pribaltiiskoi Komissii po Izucheniyu Migratsii Ptits Akademiya Nauk Estonskoi SSR 22:130-154.
  109. ^ a b Tjernberg, M. 1983. Habitat and nest site features of Golden Eagles Aquila chrysaetos in Sweden. Swedish Wildlife Research, 12: 131-163.
  110. ^ Baglien, J. W. 1975. Biology and habitat requirements of the nesting Golden Eagle in southwestern Montana. Master's Thesis. Montana State University, Bozeman.
  111. ^ a b c d Menkens, Jr., G. E. and S. H. Anderson. 1987. Nest site characteristics of a predominantly tree-nesting population of Golden Eagles. Journal of Field Ornithology, 58: 22-25.
  112. ^ Seibert, D. J., R. J. Oakleaf, J. M. Laughlin, and J. L. Page. 1976. Nesting ecology of Golden Eagles in Elko County, Nevada. Technical Note 281. U.S. Department of the Interior, Bureau of Land Management, Denver, CO.
  113. ^ Ward, J. P., L. R. Hanebury, and R. L. Phillips. 1983. Raptor inventory of coal areas in western North Dakota. Report prepared for U.S. Fish & Wildlife Service, Bismarck Field Office, Bismarck, ND.
  114. ^ Phillips, R. L., A. H. Wheeler, J. M. Lockhart, T. P. McEneaney, and N. C. Forrester. 1990. Nesting ecology of Golden Eagles and other raptors in southeastern Montana and northern Wyoming. Technical Report 26. U.S. Department of the Interior, Fish & Wildlife Service, Washington, D.C.
  115. ^ Mosher, J.A. & White, C.M. 1976. Directional exposure of Golden Eagle nests. Canadian Field-Naturalist, 90: 356-359.
  116. ^ a b c Grubb, T. G. and W. L. Eakle. 1987. Comparative morphology of Bald and Golden eagle nests in Arizona. Journal of Wildlife Management, 51: 744-748.
  117. ^ a b c Katzner, T.E., Bragin, E.A., Knick, S.T. & Smith, A.T. (2003). Coexistence in a multispecies assemblage of eagles in central Asia. Condor, 105: 538-551.
  118. ^ Tjernberg. 1983. Habitat and nest site features of Golden Eagles Aquila chrysaetos (L.) in Sweden. Swedish Wildlife Research, 12: 131-163.
  119. ^ Kulves, H. Havornens Haliaeetus albicilla albicilla L ekogi pa Aland. Skrifer utgiuna av Alands Kultus tense Lnr 9.
  120. ^ Ellis, D. H. 1986. Extremely tall eagle nests. National Geographic. 2:517-519.
  121. ^ Pedrini, P. & Sergio, F. 2001. Regional conservation priorities for a large predator: golden eagles (Aquila chrysaetos) in the Alpine range. Elsevier Science Ltd. Biological Conservation 103 (2002): 163–172.
  122. ^ Labutin, Y. V., Leonovitch, V. V., & Veprintsev, B. N. 1982. The Little Curlew Numenius minutus in Siberia. Ibis, 124(3), 302-319.
  123. ^ Poole, K. G. and R. G. Bromley. 1988. Interrelationships within a raptor guild in the central Canadian arctic. Canadian Journal of Zoology, 66: 2275-2282.
  124. ^ Ratcliffe, D.A. 1990. Bird life of mountains and upland. University Press, Cambridge.
  125. ^ Margalida, A., & García, D. 1999. Nest use, interspecific relationships and competition for nests in the Bearded Vulture Gypaetus barbatus in the Pyrenees: influence on breeding success. Bird Study, 46(2): 224-229.
  126. ^ a b Aoyama, I., Sekiyama, F. Obara, N., Tamura, G. & Sakaguchi, G. 1988. Breeding biology of a pair of Golden Eagles in the Kitakami Mountains. Aquila chrysaetos, 6: 14-23.
  127. ^ Ellis, D.H. & Powers, L. 1982. Mating behaviour in the Golden Eagle in non-fertilization context. Journal of Raptor Research, 16: 134-136.
  128. ^ Gallagher, M.D. & Brown, M.R. 1982. Golden Eagle Aquila chrysaetos breeding in Oman, eastern Arabia. Bulletin of the British Ornithologists’ Club, 102: 41-42.
  129. ^ a b Heim de Balzac, H. & Maynaud, N. 1962. Les Oiseaux du Nord-Ouest de l’Afrique. Lechevalier, Paris.
  130. ^ B.J. McCaffery fide Petersen et al. op cit.
  131. ^ Irisov, E.A. & Irisov, N.L. 1998. On distribution and biology of Golden Eagle in Altai. Modern Ornithology. Moscow, pp. 139-156.
  132. ^ McGahan, J. 1968. Ecology of the Golden Eagle. Auk 85:1-12.
  133. ^ a b c d Gordon, S. 1955. The Golden Eagle; king of birds. 1st Am. ed. Citadel Press, New York.
  134. ^ Kish, F. 1970. Egg laying and incubation by American Golden Eagles, Aquila chrysaetos canadensis, at Topeka Zoo. International Zoo Yearbook, 10 :26-29.
  135. ^ Kish, F. 1972. First breeding by American Golden Eagles Aquila chrysaetos canadensis at Topeka Zoo. International Zoo Yearbook, 12: 136-138.
  136. ^ Bent, A.C. 1937. Life histories of North American Birds of Prey. Part 1. U.S. National Museum Bulletin, 167: 1-109.
  137. ^ Steinbeck, W. 1884. The Golden Eagle (Aquila chrysaetus [sic]) . Ornithol. Oolog. 9:58.
  138. ^ Hanna, W. C. 1930. Notes on the Golden Eagle in southern California. Condor 32:121-123.
  139. ^ a b c d e f g h i Collopy, M.W., 1984. Parental care and feeding ecology of Golden Eagle nestlings. Auk, 101 (4): 753-760.
  140. ^ Everett, M.J. 1981. Role of male Golden Eagle during incubation. British Birds, 74: 309-310.
  141. ^ Sumner, Jr., E. L. 1929. Comparative studies in the growth of young raptors. Condor 31:85-111.
  142. ^ Sumner, Jr., E. L. 1929. Notes on the growth and behavior of young Golden Eagles. Auk 46:161-169.
  143. ^ a b c Newton, I. 1979. Population Ecology of Raptors. Poyser,Berkhamsted.
  144. ^ Mcgahan, J. 1967. Quantified estimates of predation by a Golden Eagle population. Journal of Wildlife Management, 31: 496-501.
  145. ^ Lockhart, J.M. 1976. The food habits, status and ecology of nesting Golden Eagles in the Trans-Pecos region of Texas. Masters of Science thesis. Ross State University, Alpine, Texas.
  146. ^ a b c Simmons, R. 1988. Offspring quality and the evolution of cainism. Ibis, 130: 339-357.
  147. ^ "Search Species Database by Species". The Peregrine Fund. Retrieved 2013-05-02. 
  148. ^ Kropil, R. and M. Majda. 1996. Causes of low productivity in the Golden Eagle Aquila chrysaetos in the central West Carpathians. Pages 489-494 in Eagle studies. (Meyburg, B. U. and R. D. Chancellor, Eds.) World Working Group on Birds of Prey and Owls, Berlin, Germany.
  149. ^ Sakaguchi, H. & Chiba, K. 1988. Observations of sibling competition and the post-fledging return of a Golden Eaglet to the eyrie. Aquila chrysaetos 6:28-29.
  150. ^ Bortolotti, G. 1989. Sex ratios of fledgling Golden Eagles. Auk, 106 :520-521.
  151. ^ Collopy, M.W. 1983. A comparison of direct observations and collections of prey remains in determining the diet of Golden Eagles. Journal of Wildlife Management, 47: 360-368.
  152. ^ Camenzind, F. J. 1969. Nesting ecology and behavior of the Golden Eagle Aquila chrysaetos. Brigham Young University Science Bulletin., Biological Series 10:4-15.
  153. ^ Walker, D.G. 1987. Observation on the post-fledging period of the Golden Eagle Aquila chrysaetos in England. Ibis, 129: 92-96.
  154. ^ Bahat, O. 1992. Post-fledging movements of Golden Eagles Aquila chrysaetos in the Judean and Negev Deserts, Israel. In: 'Eagle Studies', pp. 517-522. WWGBP, Berlin, London and Paris.
  155. ^ Soutillo et al. 2006
  156. ^ a b Steenhof, K., Kochert, M.N. & Moritsch, M.Q. 1984. Dispersal and migration of southwestern Idaho raptors. Journal of Field Orinthology, 55; 357-368.
  157. ^ Urios, V., Soutullo, A. Lopez-Lopez, P., Cadahia, L, Liminana, R. & Ferrer, M. 2007. The first case of successful breeding of a Golden Eagle Aquila chrysaetos tracked from birth by satellite telemetry. Acta Ornithologica, 42: 205-209.
  158. ^ Teresa, S. 1980. Golden Eagles successfully breeding in subadult plumage. The Raptor Research Foundation, 14: 86-87.
  159. ^ Bates, G.G. 1976. Breeding of sub-adult Golden Eagles. Birds Study, 23: 284.
  160. ^ Steenhof, K., Kochert, M.N. & Doremus, J.H. 1983. Nesting of subadult Golden Eagles in southwestern Idaho. Auk 100:743-747.
  161. ^ Grant, J. R. & McGrady, M.J. 1999. Dispersal of Golden Eagles Aquila chrysaetos in Scotland. Ringing & Migration, 19: 169-174.
  162. ^ Smith, D. G. & Murphy, J.R. 1979. Breeding responses of raptors to jackrabbit density in the eastern Great Basin Desert of Utah. The Raptor Research Foundation, 13: 1-14.
  163. ^ Reynolds III, H. V. 1969. Population status of the Golden Eagle in south-central Montana. Master's Thesis. University of Montana, Missoula.
  164. ^ Steenhof, K. & Kochert, M.N. 1988. Dietary response of three raptor species to changing prey densities in a natural environment. Journal of Animal Ecology, 57: 37-48.
  165. ^ Murphy, J.R. 1975. Status of the Golden Eagle in central Utah 1967-1973. Raptor Research Report, 3: 91-96.
  166. ^ Tjernberg. 1983. Habitat and nest site features of Golden Eagles Aquila chrysaetos (L.) in Sweden. Swedish Wildlife Research, 12: 131-163.
  167. ^ Fernández, C. 1993. Effect of the viral haemorrhagic pneumonia of the wild rabbit on the diet and breeding success of the Golden Eagle Aquila chrysaetos (L.) . Revue d'écologie, 48(3): 323-329.
  168. ^ Phillips, R.L., Wheeler, A.H., Forrester, N.C., Lockhart, J.M. & McEneaney, T.P. 1990. Nesting ecology of Golden Eagles and other raptors in southeastern Montana and northern Wyoming. Fish and Wildlife Technical Report No. 2. WSDI, Washington.
  169. ^ Haworth, P.R., Fielding, A.K., Whitfield, D.P. & Reid, R. 2009. Diet and breeding success in Golden Eagles: implications for land management. Report by Haworth Conservation to Scottish Natural Heritage.
  170. ^ Bahat, O. & Mendelssohn, H. 1996. The long-term effect of precipitation on the breeding success of Golden Eagles in the Judean and Negev Deserts, Israel. In: 'Eagle Studies', pp. 517-522. WWGBP, Berlin, London and Paris.
  171. ^ Klimkiewicz, M. K. 1997. Longevity records of North American birds, Version 97.1. Patuxent Wildlife Rescue Center, Bird Banding Laboratory. Laurel, MD.
  172. ^ Perrins, C.M. & Birkhead, T.R. 1983. Avian ecology. New York: Chapman & Hall
  173. ^ Harmata, A.R. 2002. Encounters of Golden Eagles banded in the Rocky Mountain West. Journal of Field Ornithology, 73: 27-32.
  174. ^ a b c McIntyre, C.L., Collopy, M.W. & Lindberg, M.S. 2006. Survival probability and mortality of migratory juvenile Golden Eagles from Interior Alaska. Journal of Wildlife Management, 70: 717-722.
  175. ^ Bezzel, E. & Funfstuck, H.-J. 1994. Brut biologie und Populations dynamic des Steinadlers Aquila chrysaetos im Werdenfelser Land/Oberbayern. Acta Ornithologica, 3: 5-32.
  176. ^ Lano, A. 1922. Golden Eagle Aquila chrysaetos and porcupine. Auk, 39: 258-259.
  177. ^ Love, J.A. 1989. Eagles. Whittet Books, London.
  178. ^ Santy, D. 1964. A recollection of an encounter between a Golden Eagle and a Great Blue Heron. Blue Jay, 22: 55.
  179. ^ Gordon, S. 1971. Oil and the eagle: an unsolved riddle. Country Life, December: 1639.
  180. ^ a b Bortolotti, G.R. 1984. Trap and poison mortality of Golden and Bald Eagles. Journal of Wildlife Management, 48: 1173-1179.
  181. ^ a b c Arroyo, B., Ferreiro, E. & Garza, V. 1990. El Aquila Real Aquila chrysaetos en Spana: distribution, reproduccion y conservacion. ICONA, Madrid.
  182. ^ Ikedia, Y. & Yamazaki, T. 1988. Diseases of Golden Eagles: a review. Aquila Chrysaetos, 6: 36-40.
  183. ^ Mikaelian, I.R. 1998. Metastatic cholangiocellular carcinoma and renal adenocarcinoma in a golden eagle (Aquila chrysaetos). Avian Pathology 27(3):321-325.
  184. ^ Hollinshead, Martin (1995). Hawking with golden eagles. Surrey, British Columbia: Hancock House. ISBN 0-88839-343-1. 
  185. ^ a b Warhol, Tom; Reiter, Chris (2003). Eagles. Marshall Cavendish. pp. 18–19. ISBN 0-7614-1578-5. 
  186. ^ Beebe, Frank, 1984. A Falconry Manual. Hancock House Publishers, ISBN 978-0-88839-978-6.
  187. ^ Dickinson, Rachel, 2009. Falconer on the Edge. Houghton Mifflin-Harcourt, ISBN 978-0-618-80623-2.
  188. ^ Miller Mundy, A. 1996. Riding in the Eagle’s Wake. The Field, February 1996.
  189. ^ Dementiev, Le vol a l'aigle au Turkestan. L'Oiseau el R.F.O. 1936.
  190. ^ Ludlow, F. & Kinnear, N.B. 1936. A contribution to the ornithology of Chinese Turkestan, Part III. Ibis Series 3, 3 : 658-694.
  191. ^ http://mb.com.ph/node/355358/mongolia-hunting-with-golden-eagle#.UMa7cJFX3qg
  192. ^ "Kazakhstan's eagle hunters soar as other raptors fall prey to black market - CNN.com". CNN. 2012-07-25. 
  193. ^ Mykola Rud'. "Golden Eagle". Naturalist Magazine. Retrieved 2013-05-06. 
  194. ^ Darrin Naish. "Using an eagle to catch and kill a wolf". Tetrapod Zoology. Retrieved 2013-05-07. 
  195. ^ Geoff Walden. "Nazi Eagles". Third Reich in Ruins. Retrieved 2013-06-12. 
  196. ^ Leviticus 11:13, Deuteronomy 14:12.
  197. ^ 2 Book of Samuel 1:23; Jeremiah 4:13.
  198. ^ Revelations 8:13.
  199. ^ Isaiah, 40:31.
  200. ^ Revelations 4:7
  201. ^ Revelations 8:13
  202. ^ Deuteronomy 28:49; Job 39: 27-28
  203. ^ Deuteronomy 32: 11-12; Job 39: 27-28
  204. ^ Doty, W.G. (Ed.). 2002. The Times World Mythology. Times Books, London.
  205. ^ Armstrong, E.A. 1958. The Folklore of Birds. Collins, London.
  206. ^ MacKillop, J. 1998. Oxford Dictionary of Celtic Myth and Legend. Oxford University Press, Oxford and New York.
  207. ^ Green, M. 1992. Animals in Celtic Life and Myth. Routledge, London and New York.
  208. ^ a b c d e Mails, T.E. 1991. The Mystic Warriors of the Plains. Mallard Press, Lombard, IL.
  209. ^ Fewkes, W.J. 1900. Property rights among the Hopi. American Anthropologist, 2: 600-707.
  210. ^ USDCDN (1986), USFWS-SR (2001), USFWS-OLE (2004a,b), e-CFR (2008)
  211. ^ Scharning, Kjell. "Bird Stamp Statistics". Theme Birds on Stamps. birdtheme.org. Retrieved 17 January 2011. 
  212. ^ Scharning, Kjell. "Stamps showing Golden Eagle Aquila chrysaetos". Theme Birds on Stamps. Retrieved 17 January 2011. 
  213. ^ Hammond, Wayne G.; Scull, Christina (1995). J. R. R. Tolkien Artist and Illustrator. Hammersmith, London: HarperCollins. pp. 120–21. ISBN 0-261-10322-9. 
  214. ^ Rich, T.D.; Beardmore, C.J.; Berlanga, H.; Blancher, P.J.; Bradstreet, M.S.W.; Butcher, G.S.; Demarest, D.W.; Dunn, E.H.; Hunter, W.C.; Inigo-Elias, E.E.; Martell, A.M.; Panjabi, A.O.; Pashley, D.N.; Rosenberg, K.V.; Rustay, C.M.; Wendt, J.S.; Will, T.C. 2004. Partners in flight: North American landbird conservation plan. Cornell Lab of Ornithology, Ithaca, NY.
  215. ^ "Haliaeetus vocifer". The Peregrine Fund. Retrieved 2013-05-24. 
  216. ^ a b c d e BirdLife International. 2004. Birds in Europe: Population estimates, trends and conservational status. Birdlife International (Bird Conservation Series 12), Cambridge.
  217. ^ Nankinov, D., A. Dutsov, B. Nikolov, B. Borisov, G. Stoyanov, G. Gradev, D. Georgiev, D. Popov, D. Domuschiev, D. Kirov, E. Tilova, I. Nikolov, I. Ivanov, K. Dilchev, K. Popov, N. Karaivanov, N. Todoov, P. Shurulinkov, R. Stanchev, R. Aleksov, R. Tsonev, S. Dalakchieva, S. Ivanov, S. Marin, S. Stajkov, S. Nikolov, and H. Nikolov. 2004. Breeding totals of the ornithofauna Bulgaria. Green Balkans, Plovdiv, Bulgaria.
  218. ^ Radovic, D., J. Kralj, V. Tutis, and D. Cikovic. 2003. Red Data Book of birds of Croatia. Ministarstvo zastite okolisa i prostornog uredenja, Zagreb, Croatia.
  219. ^ Arroyo, B. & Del Moral, J.C. 2003. Águila Real, Aquila chrysaetos. In Martí R, Del Moral JC eds, 'Atlas de las Aves Reproductoras de España. Dirección General de Conservación de la Naturaleza-Sociedad Española de Ornitología', Madrid: 188-189.
  220. ^ Del Moral, J. C. 2009. The Golden Eagle: breeding population in 2008 and census method. Seguimiento de Aves 32:1-185.
  221. ^ Kren, J. Birds of the Czech Republic. London, 2000. 336 pp.
  222. ^ a b Mark Holling and the Rare Breeding Birds Panel Report for 2003-4 accessed 4 March 2010.
  223. ^ Mark Holling and the Rare Breeding Birds Panel (2010). "Rare breeding birds in the United Kingdom in 2007". British Birds 103: 45–6. 
  224. ^ Nicholson 1957
  225. ^ "Latest News". National Parks & Wildlife Service. Retrieved 2013-05-21. 
  226. ^ BirdWatch Ireland 2008
  227. ^ Ozawa, T. 2008. The population of Golden Eagles (Aquila chrysaetos) in Toyama Prefecture and their critical condition. Aquila Chrysaetos 22:1-9.
  228. ^ National Institute of Biological Resources, South Korea, 2011.
  229. ^ Brazil, M. 2009. Birds of East Asia: eastern China, Taiwan, Korea, Japan, eastern Russia. Christopher Helm, London.
  230. ^ Thiollay, J.-M. 2006. The decline of raptors in West Africa: long-term assessment and the role of protected areas. Ibis 148:240-254.
  231. ^ "Golden Eagle Management". Arizona Game and Fish Department. Retrieved 2013-05-03. 
  232. ^ Olendorff, R. R., A. D. Miller, and R. N. Lehman. 1981. Suggested practices for raptor protection on power lines-the state of the art in 1981. Raptor Research Report, 4: 1-111.
  233. ^ Good, R.E., Nielsen, R.M., Sawyer, H.H. & Macdonald, L.L. "Population Level Survey of Golden Eagles (Aquila chrysaetos) in the Western United States" (PDF). U.S. Fish & Wildlife Service. Retrieved 2013-05-03. [dead link]
  234. ^ Harlow, D.L. & Bloom, P.H. 1989. Buteos and the Golden Eagles. In: 'Proceedings of the Western Raptor Management Symposium and Workship' (Ed. B.G. Pendleton), pp. 102-110, Scientific and Technical Series No. 12. National Wildlife Federation, Washington.
  235. ^ Good, R.E. & Nielson, R.M., Sawyer, H.H., & McDonald, L.L. 2004. Population level survey of Golden Eagles (Aquila chrysaetos) in the Western United States. Reported prepared for United States Fish & Wildlife Services by Western Ecosystems Technology, Inc. Wyoming.
  236. ^ chrysaetos "Aquila chrysaetos- Additional details on Conservation". The Peregrine Fund. Retrieved 2013-05-03. 
  237. ^ Olendorff, R. R., A. D. Miller, and R. N. Lehman. 1981. Suggested practices for raptor protection on power lines-the state of the art in 1981. Raptor Research Report, 4: 1-111.
  238. ^ Franson, J. C., L. Sileo, and N. J. Thomas. 1995. Causes of eagle deaths. Pages 68 in 'Our living resources'. (LaRoe, E. T., G. S. Farris, C. E. Puckett, P. D. Doran, and M. J. Mac, Eds.) U.S. Department of the Interior, National Biological Services, Washington, D.C.
  239. ^ Henninger, W.F. (1906). "A preliminary list of the birds of Seneca County, Ohio". Wilson Bulletin 18 (2): 47–60. 
  240. ^ Scott, T. A. 1985. Human impacts on the Golden Eagle population of San Diego County. Master's Thesis. San Diego State Univ. San Diego, CA.
  241. ^ Boeker, E. L. 1974. Status of Golden Eagle surveys in the western states. Wildlife Society Bulletin, 2: 46-49.
  242. ^ Ma, M. 2013. Government-sponsored Falconry Practices, Rodenticides, and Land Development Jeopardize Golden Eagles (Aquila chrysaetos) in Western China. Journal of Raptor Research, 47(1): 76-79.
  243. ^ Kochert, M. N., K. Steenhof, L. B. Carpenter, and J. M. Marzluff. 1999. Effects of fire on Golden Eagle territory occupancy and reproductive success. Journal of Wildlife Management, 63: 773-780.
  244. ^ Marquiss, M., Ratcliffe, D.A. & Roxburgh, R. 1985. The numbers, breeding, success and diet of Golden Eagles in southern Scotland in relation to changes in land use. Biological Conservation, 33: 1-17.
  245. ^ Benson, P.C. 1981. Large raptor electrocution and power pole utilization: a study in six western states. Ph.D. thesis. Brigham Young University, Prova, Utah.
  246. ^ Boeker, E.L. & Nickerson, P.R. 1975. Raptor electrocutions. Wildlife Society Bulletin, 3: 79-81.
  247. ^ Lehmann, R.N. 2001. Raptor electrocution on powerlines: current issues and outlook. Wildlife Society Bulletin, 29: 804-817.
  248. ^ Thelander, C. G., & Rugge, L. 2000. Avian risk behavior and fatalities at the Altamont Wind Resource Area. National Renewable Energy Laboratory NREL, Golden, Colorado.
  249. ^ Feds propose allowing wind-farm developer to kill golden eagles – U.S. News. Usnews.msnbc.msn.com (2012–01–04). Retrieved on 2012–08–22.
  250. ^ a b c Whitfield, D.P., Fielding, A.H., McLeod, D.R.A. & Haworth, P.F. 2008. A conservation framework for the golden eagle: implications for conservation and management in Scotland. Scottish Natural Heritage Commissioned Report No. 193. Scottish Natural Heritage, Battleby.
  251. ^ Tapia, L., Domínguez, J., & Rodríguez, L. 2009. Using probability of occurrence to assess potential interaction between wind farms and a residual population of golden eagle Aquila chrysaetos in NW Spain. Biodiversity and Conservation, 18(8): 2033-2041.
  252. ^ Sutler, G.W. & Joness, J.L. 1981. Criteria for Golden Eagle, Ferruginous Hawk and Prairie Falcon nest site protection. Journal of Raptor Research, 15: 12-18.
  253. ^ Ruddock, M. & Whitfield, D.P. 2007. A review of disturbance distances in selected bird species. Report from Natural Research (Projects), Ltd. To Scottish Natural Research, Banchary, UK.
  254. ^ Fremming, O.R. 1980. Kongeorn I Norge. Viltmpport, 12: 1-63.
  255. ^ Steidl, R.J., Kozie, K.D., Dodge, G.J. Pehovski, T. & Hogan, E.R. 1993. Effects of human activity on breeding behavior of Golden Eagles in Wrangell-St. Elias National Park and Preserve; a preliminary assessment. WRST Reserve Resource Management Report No.. 93-3. National Park Service, Wrangell-St. Elias National Park and Preserve, Cooper Canyon, Alaska.
  256. ^ Camp, R.J., Sinton, D.T. & Knight, R.L. 1997. Viewsheds: a complementary management approach to buffer zones. Wildlife Society Bulletin, 25: 612-615.
  257. ^ Phillips, R. L. & Beske, R.E. 1984. Resolving conflicts between energy development and nesting Golden Eagles. Pages 214-219 in Issues and technology in the management of impacted western wildlife; proceedings of symposium, Steamboat Springs, Colorado, November 15–17, 1982. (Comer, R. D., Merino, J. M., Monarch, J. W., Pustmueller, C., Stalmaster, M., Stoecker, R., Todd, J. & Wright, W. Eds.) Thorne Ecological Institute, Boulder, CO.
  258. ^ Allavena, J. 1985. Preliminary results on the Golden Eagle Aquila chrysaetos in the central-southern regions of the Apennines in Italy. WWBGP Bulletin, 2: 79-81.
  259. ^ Camenzind, F. J. 1969. Nesting ecology and behavior of the Golden Eagle Aquila chrysaetos L. Brigham Young University Science Bulletin, Biological Series, 10: 4-15.
  260. ^ Holmes, T.L., Knight, R.L., Stegall, L. & Craig, G.R. 1993. Responses of wintering grassland raptors to human disturbance. Wildlife Society Bulletin, 21: 461-468.
  261. ^ Woodgerd, W. 1952. Food Habits of the Golden Eagle. Journal of Wildlife Management, 16: 457-459.
  262. ^ Phillips, R. L. 1986. Current issues concerning the management of Golden Eagles in western U.S.A. Pages 149-156 in 'Birds of prey Bulletin no. 3'. (Chancellor, R. D. and B. U. Meyburg, Eds.) World Working Group on Birds of Prey and Owls, Berlin, Germany.
  263. ^ a b Beans, B. E. 1996. Eagle's plume. Scribner, New York.
  264. ^ Love, J.A. 1983. The Return of the Sea Eagle. University Press, Cambridge.
  265. ^ a b Watson, J. & Dennis, R.H. 1992. Nesting site selection by Golden Eagles Aquila chrysaetos in Scotland. British Birds, 85: 469-481.
  266. ^ a b Whitfield, D.P., Fielding, A.H., McLeod, D.R.A. & Haworth, P.F. 2004. The effects of persecution on the population dynamics of Golden Eagles in Scotland. Biological Conservation, 118: 249-259.
  267. ^ Whitfield, D.P., McLeod, D.R.A., Watson, J., Fielding, A.H. & Haworth, P.F. 2003. The association of grouse moor in Scotland the illegal use of poisons to control predators. Biological Conservation, 114: 157-163.
  268. ^ Peeters, H.J. 1994. Suspected poisioning of Golden Eagles Aquila chrysaetos by chlorophacinone. In: Raptor conservation today (Eds. Meyburg & Chancellor) pp. 775-776, WWGBP, London.
  269. ^ Craig, T.H., Connelly, J.W., Craig, E.H. & Parker, T.L. 1990. Lead concentrations in Golden and Bald Eagles. Wilson Bulletin, 102: 130-133.
  270. ^ Anderson, D. W. and J. J. Hickey. 1972. Eggshell changes in certain North American birds. Proceedings of the International Ornithological Congress, 15: 514-540.
  271. ^ Ratcliffe, D.A. 1970. Changes attributable to pesticides in egg-breakage frequency and eggshell thickness in some British birds. Journal of Applied Ecology, 7: 67-107.
  272. ^ Newton, I. & Galbraith, E.A. 1991. Organochlorines and mercury in the eggs of Golden Eagles Aquila chrysaetos from Scotland. Ibis, 133: 115-121.
  273. ^ Hewson, R. 1984. Scavenging and predation upon sheep and lambs in West Scotland. Journal of Applied Ecology, 21: 843-868.
  274. ^ Lockie, J.D. The breeding density of the Golden Eagle and Fox in relation to food supply in Wester Ross, Scotland. Scottish Naturalist, 7: 67-77.
  275. ^ Leitch, A.F. 1986. Report on eagle predation on lambs in the Glenelg Area in 1986. Report to Natural Conservancy Council, Inveress.
  276. ^ Campbell, S. & Hartley, G. 2004. Investigation into Golden Eagle predation of lambs on Benbecula in 2003. Scottish Agricultural Science Agency, Edinburgh.
  277. ^ a b Matchett, M.R. & O;Gara, B.W. 1987. Methods of controlling Golden Eagle depredation on domestic sheep in southwestern Montana. Journal of Raptor Research, 21: 85-94.
  278. ^ Phillips, R.L., Cummings, J.L. & Berry, J.D. 1991. Response of breeding Golden Eagles to relocation. Wildlife Society Bulletin, 19: 430-434.
  279. ^ Warren, J.T., Mystrud, I. & Lynnebakken, T. 2001. Mortaliy of lambs in free-ranging domestic sheep (Ovis aries) in northern Norway. Journal of Zoology, London, 254: 195-202.
  280. ^ Tjernberg, M. 1990. The Golden Eagle, Aquila chrysaetos, in Sweden: distribution, population and threats. Vår Fågelvärld 49:337-348.
  281. ^ McGrady, M.J., Petty, S.J., & McLeod, D.R.A. 2004. Potential impact of new native forests on golden eagles in Scotland. Scottish Natural Heritage Commissioned Report No. 18. Scottish Natural Heritage, Edinburgh.
  282. ^ Stroud, D.A., Chambers, A., Cook, S., Buxton, N., Fraser, B., Clement, P., Lewis, P., McLean, L., Baker, H. & Whitehead, S. 2001. The UK SPA network: its scope and content. Joint Nature Conservation Committee, Peterborough.
  283. ^ Mountaineering Council of Scotland.2009. A brief guide to ‘birds at crags’ from climbers. With particular reference to Peregrine Falcons and eagles.
  284. ^ Holthuijzen, A.M.A. 1989. Behavior and productivity of nesting Prairie Falcons in relation to construction activities at Swan Falls Dam. Final Report, Idaho Power Company, Boise, Idaho.
  285. ^ Fala, R.A., Anderson, A. & Ward, J.P. 1985. Highwall to pole Golden Eagle nest site relocations. Journal of Raptor Research, 19: 1-7.
  286. ^ Nelson, M. W. & Nelson, P. 1977. Power lines and birds of prey. Pages 228-242 in World Conference on Birds of Prey: report of proceedings, Vienna 1975 (R. D. Chancellor, Ed.). International Council for Bird Preservation, London.
  287. ^ Ferrer, M. 1993. El Aquila Imperial. Quercus, Madrid.
  288. ^ Gibson, L. 2006. The role of lethal control in managing the effects of apparent competition on endangered prey species. Wildlife Society Bulletin, 34(4): 1220-1224.
  289. ^ Urocyon littoralis (California Channel Island Fox, Channel Islands Fox, Island Fox, Island Gray Fox, Island Grey Fox). Iucnredlist.org. Retrieved on 2012–08–22.
  290. ^ Ellis, D. H., K. R. Clegg, J. C. Lewis, and E. Spaulding. 1999. Golden Eagle predation on experimental Sandhill and Whooping cranes. Condor 101:664-666.
  291. ^ Snyder, N.F.R., Ramey, R.R. & Sibley, F.C. 1986. Nest-site biology of the California Condor. Condor 88: 228-241).
  292. ^ Meretsky, V.J., Snyder, N.F.R., Beissinger, S.R., Clendenen, D.A. & Wiley, J.W.. 2000. Demography of the California Condor: implications for reestablishment. Conservation Biology NatureServe. 2010. NatureServe Explorer: An Online Encyclopedia of Life [web application].
  293. ^ Thompson, P.S., Amar, A., Hoccom, D.G., Knott, J. & Wilson, J.D. 2009. Resolving the conflict between driven-grouse shooting and conservation of Hen Harriers. Journal of Applied Ecology, 46: 950-954.

Further reading[edit]

  • Cramp, Stanley, ed. (1979). Handbook of the Birds of Europe the Middle East and North Africa, the Birds of the Western Palearctic, Volume 2: Hawks to bustards. Oxford: Oxford University Press. ISBN 978-0-19-857505-4. 
Creative Commons Attribution Share Alike 3.0 (CC BY-SA 3.0)

Source: Wikipedia

Unreviewed

Article rating from 0 people

Default rating: 2.5 of 5

Names and Taxonomy

Taxonomy

The currently accepted scientific name for the golden eagle is Aquila
chrysaetos (Linnaeus) [1]. The following five races are recognized
[9,21]:

Aquila chrysaetos chrysaetos (Linnaeus)
Aquila chrysaetos hameryi (Severtza)
Aquila chrysaetos daphanea (Menzbir)
Aquila chrysaetos canadensis (Linnaeus)
Aquila chrysaetos japonica (Severtza)

Aquila chrysaetos canadensis is the only race that occurs in North
America [9,21].
  • 1. American Ornithologists' Union. 2004. The A.O.U. check-list of North American birds, 7th edition, [Online]
  • 9. Dunstan, Thomas C. 1989. The golden eagle. In: Audubon wildlife report: 1989/1990: 499-511. On file with: U.S. Department of Agriculture, Forest Service, Intermountain Research Station, Fire Sciences Laboratory, Missoula, MT. [22392]
  • 21. Palmer, Ralph S., editor. 1988. Handbook of North American birds. Volume 5. New Haven, CT: Yale University Press. 463 p. [22303]

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Common Names

golden eagle

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!