Articles on this page are available in 2 other languages: Chinese (Simplified) (6), Dutch (1) (learn more)

Overview

Brief Summary

Avocets are decorative birds with an upturned beak. You often see them in inland brackish waters as they forage for food. They catch their food by slightly opening their bill and swinging their head from side to side. The avocet is named after its black cap, as was once worn by European advocates. Actually, this species is called the pied avocet, pied referring to the black and white coloring.
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© Copyright Ecomare

Source: Ecomare

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Comprehensive Description

Longueur 42-45 cm, envergure 77-80 cm, poids 260-290 g.

L’habitat est lié à la haute spécialisation alimentaire de l’espèce, celle-ci se nourrissant presque exclusivement dans des sédiments fluides et peu profonds. L’Avocette est ainsi trouvée essentiellement dans les plaines maritimes (marais salants, lagunes, estuaires, etc.). Elle se confine en des lieux où la végétation est basse et clairsemée, sinon absente, y compris sur des sites artificiels (terrains décapés, remblais…).

L’espèce se nourrit surtout d’insectes, de crustacés et vers. Pour ce faire, elle balance la tête et le bec de droite et de gauche, la partie courbe du bec entrouvert étant plongée dans l’eau ou la vase. Les proies sont localisées au toucher, plus rarement à vue dans l’eau claire ou en surface.

L’Avocette est grégaire tout au long de l’année (parfois plusieurs milliers d’oiseaux ensemble). La formation des couples débute probablement en fin d’hiver, les oiseaux arrivant le plus souvent appariés sur les sites de nid. Les cérémonies de groupe, où plusieurs couples se rassemblent et se font face, sont un trait caractéristique du début de la phase de reproduction. Plus tard, les manifestations complexes destinées à éloigner les prédateurs sont fréquemment exécutées par plusieurs oiseaux.

Le nid, toujours près de l’eau, est une faible dépression complétée de divers éléments végétaux. La ponte unique de 3 ou 4 œufs (extrêmes : 2 à 5) est déposée à partir de la mi-avril. L’incubation dure un peu plus de 3 semaines et les jeunes s’envolent entre leur 7e et leur 8e semaine.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Muséum national d'Histoire naturelle. Service du Patrimoine naturel

Source: Inventaire National du Patrimoine Naturel

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Distribution

Range

N Africa and Eurasia; winters to South Africa and s Asia.

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Physical Description

Diagnostic Description

Description

Length: 43-46 cm. Plumage: white with black crown, wing coverts, scapulars and wing-tips; black may become brownish with wear. Immature brown replaces black of adults, buff tinge to white feathers. Bare parts: iris male red, female brown; bill black; feet and legs blue-grey to grey. Habitat: shallow waters of lagoons, estuaries, seashores and inland water bodies. Resident; breeds in Africa. <389><391><393>
  • Urban, E.K., C.H. Fry & S. Keith (1986). The Birds of Africa, Volume II. Academic Press, London.
Creative Commons Attribution 3.0 (CC BY 3.0)

© WoRMS for SMEBD

Source: World Register of Marine Species

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Ecology

Habitat

Habitat and Ecology

Habitat and Ecology
Behaviour Northern populations migrate south between August and October and return to the breeding grounds between March and May, staging on route in large numbers at certain sites (del Hoyo et al. 1996). The species is present all year round in much of its African range and in parts of Western Europe however (Hayman et al. 1986, del Hoyo et al. 1996). It breeds from April to August in large colonies (del Hoyo et al. 1996) usually of between 10 and 70 pairs (Johnsgard et al. 1981). The species remains gregarious on passage and during the winter, migrating in loose flocks (Hayman et al. 1986), foraging in groups of 5-30 individuals (Urban et al. 1986) and gathering to roost in large flocks of several thousand individuals (Hayman et al. 1986). Habitat Breeding The species breeds in flat open areas (del Hoyo et al. 1996) on shallow saline or brackish wetlands (Johnsgard et al. 1981, Hayman et al. 1986, Urban et al. 1986, del Hoyo et al. 1996, Snow and Perrins 1998) with islands, ridges, spits or margins of bare sand, clay or mud (Snow and Perrins 1998) and sparse short vegetation (Hayman et al. 1986), including inland lakes (Johnsgard et al. 1981, del Hoyo et al. 1996), pools (del Hoyo et al. 1996, Snow and Perrins 1998), coastal lagoons (Johnsgard et al. 1981, del Hoyo et al. 1996, Snow and Perrins 1998), estuaries, saltpans (del Hoyo et al. 1996, Snow and Perrins 1998), saltmarshes, irrigated land and flood-plains in arid areas (Snow and Perrins 1998). The most important characteristics of breeding habitats appear to be water levels which gradually decline over the summer to expose additional feeding areas, and high salt concentrations that prevent the development of excessive emergent and shoreline vegetation (Johnsgard et al. 1981). Non-breeding Outside of the breeding season the species inhabits coastal and inland saline lakes and mudflats (Urban et al. 1986, del Hoyo et al. 1996), lagoons, pools, saltpans (del Hoyo et al. 1996), estuaries (Hayman et al. 1986, del Hoyo et al. 1996), sandy beaches, river deltas and flood-plains (Urban et al. 1986). It rarely occurs on inland freshwater lakes and rivers (Urban et al. 1986, del Hoyo et al. 1996) but may forage on agricultural land (del Hoyo et al. 1996). Diet Its diet consists predominantly of aquatic invertebrates 4-15 cm long including aquatic insects (del Hoyo et al. 1996) (e.g. small beetles, midges and brine flies) (Johnsgard et al. 1981), crustaceans (del Hoyo et al. 1996) (e.g. Corophium spp.) (Johnsgard et al. 1981), oligochaete and polychaete worms, and molluscs, as well and small fish (del Hoyo et al. 1996) (e.g. sole) (Urban et al. 1986) and plant matter (del Hoyo et al. 1996) (e.g. seeds and small roots) (Urban et al. 1986). Breeding site The nest is a scrape (del Hoyo et al. 1996) that may be positioned in a variety of sites including on bare sand (Johnsgard et al. 1981), dried mud, short grass (Urban et al. 1986), dead vegetation and built-up mounds of debris (Johnsgard et al. 1981). The species nests in large colonies, neighbouring nest usually 1 m apart (Hayman et al. 1986) or occasionally as close as 20-30 cm (Urban et al. 1986). Management information Artificially constructed nesting sites in coastal locations such as beaches of bare shingle and islands or rafts covered with sparse vegetation are successful in attracting breeding pairs of this species (Burgess and Hirons 1992). The species responds positively (e.g. breeding numbers increase) to the introduction of cattle grazing on coastal grasslands, possibly as a result of reduced vegetation cover allowing improved predator detection (Olsen and Schmidt 2004).

Systems
  • Terrestrial
  • Freshwater
  • Marine
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Depth range based on 1 specimen in 1 taxon.
Water temperature and chemistry ranges based on 1 sample.

Environmental ranges
  Depth range (m): 0 - 0
  Temperature range (°C): 11.396 - 11.396
  Nitrate (umol/L): 8.636 - 8.636
  Salinity (PPS): 34.665 - 34.665
  Oxygen (ml/l): 6.315 - 6.315
  Phosphate (umol/l): 0.574 - 0.574
  Silicate (umol/l): 3.347 - 3.347
 
Note: this information has not been validated. Check this *note*. Your feedback is most welcome.

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Life History and Behavior

Life Expectancy

Lifespan, longevity, and ageing

Maximum longevity: 27.8 years (wild) Observations: Maximum longevity from banding studies is 27.8 years (http://www.euring.org/data_and_codes/longevity.htm).
Creative Commons Attribution 3.0 (CC BY 3.0)

© Joao Pedro de Magalhaes

Source: AnAge

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Barcode data: Recurvirostra avosetta

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There are 2 barcode sequences available from BOLD and GenBank.  Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.  See the BOLD taxonomy browser for more complete information about this specimen and other sequences.

CTAATCTTCGGTGCATGAGCCGGTATAGTTGGTACTGCCCTCAGCTTACTCATCCGAGCAGAATTAGGCCAACCAGGGACCCTACTAGGAGATGACCAAATCTACAATGTAATCGTCACTGCCCATGCCTTCGTAATAATCTTCTTCATAGTTATACCAATTATGATCGGCGGATTCGGAAACTGACTAGTACCACTCATAATTGGTGCCCCTGACATAGCATTCCCCCGCATAAACAACATAAGCTTTTGACTATTACCACCATCATTCCTACTTCTCCTCGCCTCCTCTACAGTAGAAGCAGGAGCAGGAACAGGCTGAACTGTATACCCCCCCTTAGCTGGTAACTTAGCCCATGCTGGAGCTTCAGTAGACCTAGCCATCTTCTCTCTCCACCTAGCAGGTGTATCCTCTATCCTAGGCGCAATCAACTTCATTACAACTGCCATCAACATAAAACCACCCGCCCTCTCACAATACCAAACCCCCCTATTCGTATGATCCGTCCTCATCACCGCCGTCTTATTACTCCTATCACTCCCAGTTCTAGCTGCCGGCATTACTATACTACTAACAGACCGAAACCTAAACACCACATTCTTTGACCCTGCCGGAGGAGGTGACCCAGTCCTATACCAACACCTCTTC
-- end --

Download FASTA File
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Statistics of barcoding coverage: Recurvirostra avosetta

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 2
Specimens with Barcodes: 4
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Conservation

Conservation Status

IUCN Red List Assessment


Red List Category
LC
Least Concern

Red List Criteria

Version
3.1

Year Assessed
2012

Assessor/s
BirdLife International

Reviewer/s
Butchart, S. & Symes, A.

Contributor/s

Justification
This species has an extremely large range, and hence does not approach the thresholds for Vulnerable under the range size criterion (Extent of Occurrence <20,000 km2 combined with a declining or fluctuating range size, habitat extent/quality, or population size and a small number of locations or severe fragmentation). The population trend is not known, but the population is not believed to be decreasing sufficiently rapidly to approach the thresholds under the population trend criterion (>30% decline over ten years or three generations). The population size is very large, and hence does not approach the thresholds for Vulnerable under the population size criterion (<10,000 mature individuals with a continuing decline estimated to be >10% in ten years or three generations, or with a specified population structure). For these reasons the species is evaluated as Least Concern.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Status in Egypt

Former breeder, regular passage visitor and winter visitor.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Bibliotheca Alexandrina

Source: Bibliotheca Alexandrina - EOL Ar

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Population

Population
The global population is estimated to number c.210,000-460,000 individuals (Wetlands International 2006), while national population sizes have been estimated at < c.10,000 individuals on migration and >c.10,000 wintering individuals c.100-10,000 breeding pairs in China and c.50-1,000 individuals on migration and c.50-1,000 wintering individuals in Taiwan (Brazil 2009).

Population Trend
Unknown
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Threats

Major Threats
The species is threatened in Europe by the pollution of wetlands with polychlorinated biphenyls (PCBs), insecticides, selenium, lead and mercury (del Hoyo et al. 1996). Important wintering sites (e.g. in Portugal or the Yellow Sea) are also threatened by infrastructure development (del Hoyo et al. 1996), land reclamation, pollution, human disturbance and reduced river flows (Kelin and Qiang 2006). The species is susceptible to avian botulism (Blaker 1967, Hubalek et al. 2005) and avian influenza (Melville and Shortridge 2006) so may be threatened by future outbreaks of these diseases.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Wikipedia

Pied Avocet

The pied avocet (Recurvirostra avosetta) is a large black and white wader in the avocet and stilt family, Recurvirostridae. They breed in temperate Europe and western and Central Asia. It is a migratory species and most winter in Africa or southern Asia. Some remain to winter in the mildest parts of their range, for example in southern Spain and southern England.

This species gets its English and scientific names from the Venetian name avosetta. It appeared first in Aldrovandi's Ornithologia (1603).[2] While the name may refer to black and white outfits once worn by European advocates or lawyers, the actual etymology is unknown.[2] Other common names include black-capped avocet, Eurasian avocet or just avocet.[3]

The pied avocet is one of the species to which the Agreement on the Conservation of African-Eurasian Migratory Waterbirds (AEWA) applies.

Description[edit]

The pied avocet is a striking white wader with bold black markings. Adults have white plumage except for a black cap and black patches in the wings and on the back. They have long, upturned bills and long, bluish legs. It is approximately 16.5–17.75 inches (41.9–45.1 cm) in length of which the bill is approximately 2.95–3.35 inches (7.5–8.5 cm) and the legs are approximately 3–4 inches (7.6–10.2 cm). Its wing-span is approximately 30–31.5 inches (76–80 cm).[4] Males and females look alike. The juvenile resembles the adult but with more greyish and sepia tones.

The call of the avocet is a far-carrying, liquid, melodious kluit kluit.[4]

Behaviour[edit]

Pied avocet (juvenile) near Oosterend, Texel island, the Netherlands

These birds forage in shallow brackish water or on mud flats, often scything their bills from side to side in water (a feeding technique that is unique to the avocets[5]). They mainly eat crustaceans and insects.

Their breeding habitat is shallow lakes with brackish water and exposed bare mud. They nest on open ground, often in small groups, sometimes with other waders. 3-5 eggs are laid in a lined scrape or on a mound of vegetation.

In Britain[edit]

The avocet became extinct in Great Britain in 1840.[6] Its successful recolonisation at Minsmere, Suffolk, in 1947[4] led to its adoption as the logo of the Royal Society for the Protection of Birds.

Gallery[edit]

References[edit]

  1. ^ BirdLife International (2012). "Recurvirostra avosetta". IUCN Red List of Threatened Species. Version 2013.2. International Union for Conservation of Nature. Retrieved 26 November 2013. 
  2. ^ a b Lockwood, W B (1993). The Oxford Dictionary of British Bird Names. OUP. ISBN 978-0-19-866196-2. 
  3. ^ Recurvirostra avosetta on Avibase
  4. ^ a b c The Birds of the Western Palearctic [Abridged]. OUP. 1997. ISBN 0-19-854099-X. 
  5. ^ Francisco Moreira(1995) "The winter feeding ecology of Avocets Recurvirostra avosetta on intertidal areas. I. Feeding strategies" Ibis 37:92–98
  6. ^ timesonline
Creative Commons Attribution Share Alike 3.0 (CC BY-SA 3.0)

Source: Wikipedia

Unreviewed

Article rating from 0 people

Default rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!