Articles on this page are available in 1 other language: Spanish (22) (learn more)

Overview

Distribution

occurs (regularly, as a native taxon) in multiple nations

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

National Distribution

United States

Origin: Native

Regularity: Regularly occurring

Currently: Present

Confidence: Confident

Type of Residency: Year-round

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Global Range: RESIDENT: southern Kansas and vicinity (casually or formerly), and from northern Baja California, southeastern California (formerly, recently reintroduced), southern Arizona, southern New Mexico, and central Texas south to central Chile and central Argentina. Breeding distribution tends to be spotty. In the U.S., most numerous in winter in western and southern Texas (Root 1988).

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Geographic Range

Harris' hawks can be found in semi-open habitats in the southwestern United States and northwestern Mexico, from Baja California to southern Arizona, New Mexico and Texas, extending south through Central and South America to Chile and just into Patagonia.

Biogeographic Regions: nearctic (Native ); neotropical (Native )

  • Johnsgard, P. 1990. Hawks, Eagles, and Falcons of North America. Washington and London: Smithsonian Institution Press.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Physical Description

Morphology

Physical Description

These are large hawks with long tails and broad wings. Harris's hawks range in length from 18 to 23 inches (46 to 76 cm) and have wingspans of 40 to 47 inches (100 to 120 cm). Adult plumage is uniformly chocolate brown with distinct reddish shoulders, upper and underwing coverts, and leg feathers. The tail is dark with white upper and undertail coverts and a white base and terminal band. Juveniles are similar to adults but are less distinctly colored and have a white belly with chocolate brown streaking. The tarsal feathers are pale with reddish barring and there is barring on the tail and wings. Females weigh an average of 1,047 grams, and males are smaller, weighing an average of 735 grams.

Range mass: 735 to 1047 g.

Range length: 46 to 76 cm.

Range wingspan: 100 to 120 cm.

Sexual Dimorphism: female larger

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Size

Length: 53 cm

Weight: 1047 grams

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Ecology

Habitat

Comments: Mainly savanna, open woodland, and semidesert, especially vicinity of marshes, swamps, and large bodies of water (AOU 1983); also near small water sources such as man-made cattle-watering ponds and catchments. River woodland, mesquite forest, saguaro-paloverde desert, brushy flatlands (Harrison 1979). Also suburban areas in southern Arizona. Additional habitats south of Mexico. Water appears to be an important resource in the Sonoran Desert.

Nests in tree, tall shrubby growth, on cactus, power line tower; often low, 1.5-9 m above ground. In Arizona, used saguaro cactus and enclosed tree sites (Mader 1978). Sometimes builds supernumerary nests. Commonly nests in same nest or nest site in successive years.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Habitat and Ecology

Systems
  • Terrestrial
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Harris' hawks are found in various habitats, from upland desert dominated by saguaros to mesquite, palo verde, and ironwood woodlands in the Colorado River valley. There is a population of hawks being reintroduced to the Colorado River that prefer to nest near water in mequite, willows and cottonwoods. In urban areas, they are seen utilizing washes, open lots, and open desert. These hawks may be found at elevations of 400 to 1,000 meters.

Range elevation: 400 to 1,000 m.

Habitat Regions: temperate ; tropical

Terrestrial Biomes: desert or dune ; savanna or grassland ; scrub forest

Other Habitat Features: urban ; suburban ; riparian

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Migration

Non-Migrant: Yes. At least some populations of this species do not make significant seasonal migrations. Juvenile dispersal is not considered a migration.

Locally Migrant: No. No populations of this species make local extended movements (generally less than 200 km) at particular times of the year (e.g., to breeding or wintering grounds, to hibernation sites).

Locally Migrant: No. No populations of this species make annual migrations of over 200 km.

Seasonal migration has not been observed in Arizona or New Mexico (Bednarz et al. 1988).

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Trophic Strategy

Comments: Diet includes mainly small mammals up to rabbit size, various birds, small reptiles, occasionally insects (Terres 1980, Palmer 1988, Bednarz 1988). Cooperative hunting well developed (pairs or groups of commonly 3-7).

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Food Habits

The diet of Harris' hawks is versatile and varies with prey availability. These hawks feed mostly on small mammals such as rats and mice, but also take birds and lizards. They commonly hunt in groups of about five hawks, increasing their success rate and enabling them to take larger prey such as cottontails and jack rabbits. These hunting groups consist of a breeding pair and other helpers, with the female dominating. They are fast flyers and once they have spotted their prey, they land and take turns trying to scare and actually flush the prey animal until it darts from beneath its hiding place. Another member of the hunting group captures the animal and assumes a posture known as mantling, in which the hawk shields the prey with its wings to hide it from other birds. It has been suggested that group hunting is encouraged by the dense brush and thorny nature of their habitat. There is some evidence that these hawks may feed on carrion if food availability is low.

Animal Foods: birds; mammals; reptiles

Primary Diet: carnivore (Eats terrestrial vertebrates)

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Associations

Ecosystem Roles

Harris' hawks are important predators in their ecosystem, controlling populations of many small mammal species.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Predation

Great horned owls (Bubo virginianus) pose the greatest predation threat to this species, but coyotes (Canis latrans) and common ravens (Corvus corax) also threaten young hawks. Female Harris' hawks utilize helpers to protect their nests. The helpers perch in saguaros and scan the surroundings for predators. They tend to become excited and will use an alarm call when predators come within their nesting area. Groups consisting of 2 to 5 hawks will attack and harass any predator threatening the nest. The alpha male is most likely to strike the predator as the female stays behind to protect the nest. This establishment of helpers greatly increases the detection of predators and nest success.

Known Predators:

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Known predators

Parabuteo unicinctus is prey of:
Bubo virginianus
Corvus corax
Canis latrans

This list may not be complete but is based on published studies.
Creative Commons Attribution 3.0 (CC BY 3.0)

© SPIRE project

Source: SPIRE

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

General Ecology

In southern Arizona, 2.5-5 sq km per active nest in saguaro-paloverde (see Palmer 1988, Bednarz et al. 1988). In Pinal County, Arizona, average of one nest per 2.0 sq km; hawks in breeding groups rarely ranged beyond 0.8 km from active nests, except to visit water sources; resident hawks chased trespassing conspecifics out of the nest area during breeding and nonbreeding periods (Dawson and Mannan 1991). Reportedly not territorial in New Mexico, though this may be questionable (see Dawson and Mannan 1991). In Texas, breeding distribution may shift in relation to rainfall pattern and prey abundance (see Palmer 1988). In fall and winter, often in large social aggregations (about 4-11 individuals) that form in zones between nesting areas (Dawson and Mannan 1991).

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Life History and Behavior

Behavior

Communication and Perception

Like all hawks, Harris' hawks have keen vision and hearing. They are known to make hissing noises, give alarm calls, and probably communicate visually as well.

Communication Channels: visual ; acoustic

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Cyclicity

Comments: In Costa Rica, hunts mostly early and late in day (Stiles and Skutch 1989).

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Life Expectancy

Lifespan/Longevity

Records on longevity are collected from the Bird Banding Laboratory (BBL) in Laurel, Maryland. The maximum longevity record for Harris' hawks is 14 years, 11 months.

Range lifespan

Status: wild:
14.9 (high) years.

Average lifespan

Status: wild:
179 months.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Lifespan, longevity, and ageing

Maximum longevity: 25 years (captivity)
Creative Commons Attribution 3.0 (CC BY 3.0)

© Joao Pedro de Magalhaes

Source: AnAge

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Reproduction

Long breeding season (February to early December [egg laying to fledging of young in second broods] in southern Arizona). Clutch size commonly 2-3. Sometimes 2 broods/year. Incubation 33-36 days, by both sexes. Young tended by both parents, fledge at about 6 weeks, may remain with parents for several months after fledging. Some yearlings breed. Cooperative breeder; one or more helpers, which may or may not be related to the breeders, often are active in procuring prey, transporting prey to the nest area, and defending the nest from predation by great horned owls (Dawson and Mannan 1991); sometimes female pairs with two males, with both males incubating the eggs and feeding and brooding the young. See Dawson and Mannan (1991) for detailed information on mating relationships and helper contributions in Arizona. See Bednarz (1988) for information on reproduction in New Mexico. In southern Arizona, nest success was about 68%; 50 nests fledged an average of 1.6 young (Mader 1978).

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Most often, social groups of Harris' hawks contain a single monogamous breeding pair. However, these hawks are known to practice simultaneous polyandry, where more than one male mates with one female and shares in the responsibilities of raising offspring. Polyandry is commonly found in areas where the habitat quality is rich as opposed to arid habitats where the chances of reproductive success are less, even when there are three adults hunting. It is also found to be common in Arizona where the sex ratio is significantly skewed towards males, in comparison with areas such as Texas, where the sex ratio is not as skewed.

Mating System: monogamous ; polyandrous ; cooperative breeder

Harris' hawks build their nests in saguaros, palo verdes and mesquite trees at an average height of 5 meters. In urban areas, nests can be found on cottonwoods, ironwoods, palm trees and electrical towers. Nests are platforms made of sticks, weeds, twigs, and are usually lined with soft mosses, grasses and roots. Between two and four eggs are laid at a time. Females have the ability to breed all year long and can lay two to three clutches within a year. The incubation period lasts about 35 days and the males often share duties with the female during this period. Fledging occurs after another 40 days. The young birds tend to stay around the nest area for two to three months longer.

Breeding interval: Harris' hawks breed two to three times per year.

Breeding season: Harris' hawks breed year round.

Range eggs per season: 3 to 15.

Average eggs per season: 6.

Range time to hatching: 33 to 37 days.

Range fledging age: 35 to 45 days.

Average time to independence: 2-3 months.

Key Reproductive Features: year-round breeding ; gonochoric/gonochoristic/dioecious (sexes separate); fertilization

Average eggs per season: 3.

Both the female and the male contribute to parental care. Harris' hawks practice cooperative breeding, with several birds helping with building nests, incubation, feeding, and defense. This assistance increases nest success. There is often a trio consisting of two males and a female which aid in the nest cycle.

Parental Investment: pre-fertilization (Provisioning, Protecting: Female); pre-hatching/birth (Provisioning: Male, Female, Protecting: Male, Female); pre-weaning/fledging (Provisioning: Male, Female, Protecting: Male, Female); pre-independence (Provisioning: Male, Female, Protecting: Male, Female)

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Barcode data: Parabuteo unicinctus

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There are 3 barcode sequences available from BOLD and GenBank.

Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.

See the BOLD taxonomy browser for more complete information about this specimen and other sequences.

NNCCTATACCTAATCTTCGGCGCCTGAGCTGGTATAGTCGGCACCGCCCTCAGCTTACTCATCCGTGCAGAACTCGGCCAACCCGGCACACTCCTAGGTGACGACCAAATTTATAACGTAATCGTTACCGCACATGCCTTCGTAATAATCTTCTTCATAGTTATACCAATCATGATCGGAGGATTCGGAAACTGACTTGTTCCACTCATAATTGGCGCTCCCGACATAGCCTTTCCACGCATAAACAACATAAGCTTCTGACTACTCCCCCCATCCTTCCTCCTCCTACTAGCTTCCTCAACAGTAGAAGCAGGAGCCGGTACTGGATGAACTGTCTATCCTCCCTTAGCTGGCAACATAGCCCATGCCGGAGCTTCAGTAGACCTAGCCATCTTCTCTCTACACTTAGCCGGAGTTTCATCCATTCTAGGGGCGATCAACTTCATCACAACCGCCATTAATATAAAACCCCCAGCACTCTCCCAGTACCAAACACCCCTGTTTGTATGATCTGTACTCATCACTGCCGTCCTTCTACTACTCTCACTCCCAGTCCTAGCCGCTGGCATCACTATACTACTTACAGACCGAAACCTAAACACAACATTCTTTGACCCTGCCGGCGGAGGCGATCCCATCCTCTACCAACATCTCTTCTGATTCTTCGGACACCCAGAAGTCTACATCTTAATCCTA
-- end --

Download FASTA File

Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Statistics of barcoding coverage: Parabuteo unicinctus

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 3
Specimens with Barcodes: 4
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Conservation

Conservation Status

National NatureServe Conservation Status

United States

Rounded National Status Rank: N5 - Secure

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

NatureServe Conservation Status

Rounded Global Status Rank: G5 - Secure

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

IUCN Red List Assessment


Red List Category
LC
Least Concern

Red List Criteria

Version
3.1

Year Assessed
2012

Assessor/s
BirdLife International

Reviewer/s
Butchart, S. & Symes, A.

Contributor/s

Justification
This species has an extremely large range, and hence does not approach the thresholds for Vulnerable under the range size criterion (Extent of Occurrence <20,000 km2 combined with a declining or fluctuating range size, habitat extent/quality, or population size and a small number of locations or severe fragmentation). Despite the fact that the population trend appears to be decreasing, the decline is not believed to be sufficiently rapid to approach the thresholds for Vulnerable under the population trend criterion (>30% decline over ten years or three generations). The population size is very large, and hence does not approach the thresholds for Vulnerable under the population size criterion (<10,000 mature individuals with a continuing decline estimated to be >10% in ten years or three generations, or with a specified population structure). For these reasons the species is evaluated as Least Concern.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Harris's Hawks are not listed as threatened or endangered. They are included in CITES appendix II and they are protected from harassment and illegal shooting by the Migratory Bird Treaty Act. A population on the Colorado River is thought to have been extirpated due to their dependence on a riparian community which was altered by dam construction and disturbance from dredging as well as nest destruction. Real estate and agriculture threaten the species in Arizona. Recent declines in Texas populations resulted from the clearing of mesquite for agriculture and livestock grazing. Habitat loss is the major cause of decline of this species as well as excessive human disturbance. Shooting can result in nest failure, abandonment and mortality. Electrocution is responsible for the loss of half of the population of breeding hawks. It is possible in areas such as Arizona for birds to live in cities where the native vegetation is protected, houses are spread apart and there is not an overabundant amount of asphalt and concrete.

US Migratory Bird Act: protected

US Federal List: no special status

CITES: appendix ii

IUCN Red List of Threatened Species: least concern

  • Whaley, W. 1986. Population Ecology of the Harris' Hawk in Arizona. Journal of Raptor Research, 20(1): 1-15.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Population

Population Trend
Decreasing
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Threats

Comments: Population declines and range contraction are attributed to habitat loss (e.g., mesquite eradication) and disturbance (USFWS 1987, Palmer 1988, Bednarz et al. 1988). Predators include great-horned owl, coyote, gray fox, and bobcat.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Management

Restoration Potential: See Walton et al. (1988) for information on successful reintroduction along the Lower Colorado River, where the population appears to be limited by nest tree availability, which is constrained by the controlled flows of the Colorado River.

Management Requirements: Bednarz et al. (1988) recommended that special raptor management areas be established on government lands and that human activities not compatible with hawk conservation be restricted in these areas. See Lefranc and Glinski (1988) for information on research needs and management recommendations for the southwestern U.S.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Relevance to Humans and Ecosystems

Benefits

Economic Importance for Humans: Negative

The only negative impact of these hawks is their habit of congregating on electrical transformers, where they are often electrocuted. This has become a great cost to electric companies who are being forced to reinsulate and, in some cases, build arms for perching to reduce the mortality rates of hawks.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Economic Importance for Humans: Positive

Harris' hawks are of great benefit to farmers whose crops are destroyed by rodents. These hawks feed primarily on small rodents such as mice and rats and therefore alleviate a lot of destruction to crops.

Positive Impacts: controls pest population

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Wikipedia

Harris's hawk

Portrait

The Harris's hawk or Harris hawk (Parabuteo unicinctus) formerly known as the bay-winged hawk or dusky hawk, is a medium-large bird of prey that breeds from the southwestern United States south to Chile and central Argentina. Birds are sometimes reported at large in Western Europe, especially Britain, but it is a popular species in falconry and these records almost certainly all refer to escapes from captivity.

The name is derived from the Greek para, meaning beside, near or like, and the Latin buteo, referring to a kind of buzzard; uni meaning once; and cinctus meaning girdled, referring to the white band at the tip of the tail.[2] John James Audubon gave this bird its English name in honor of his ornithological companion, financial supporter, and friend Edward Harris.[3]

The Harris's hawk is notable for its behavior of hunting cooperatively in packs consisting of family groups, while most other raptors hunt alone. It is the unusually social nature of the Harris's hawk and resulting ease of training and high level of cooperativeness that has led to the Harris's hawk becoming a popular bird for use in falconry.[4]

Description[edit]

Adult male

This medium-large hawk is roughly intermediate in size between a peregrine falcon (Falco peregrinus) and a Red-tailed hawk (Buteo jamaicensis). Harris's hawks range in length from 46 to 59 cm (18 to 23 in) and generally have a wingspan of about 103 to 120 cm (41 to 47 in)[5][6] They exhibit sexual dimorphism with the females being larger by about 35%. In the United States, the average weight for adult males is about 701 g (1.545 lb), with a range of 546 to 850 g (1.204 to 1.874 lb), while the adult female average is 1,029 g (2.269 lb), with a range of 766 to 1,633 g (1.689 to 3.600 lb).[7][8] They have dark brown plumage with chestnut shoulders, wing linings, and thighs,[9] white on the base and tip of the tail,[10] long, yellow legs and a yellow cere.[11] The vocalizations of the Harris's hawk are very harsh sounds.[5]

Juvenile[edit]

Juvenile in a falconry demonstration

The juvenile Harris's hawk is mostly streaked with buff, and appears much lighter than the dark adults. When in flight, the undersides of the juveniles' wings are buff-colored with brown streaking. They can look unlike adults at first glance, but the identical chestnut plumage is an aid for identification.[11][verification needed]

Subspecies[edit]

There are three subspecies of Harris's hawk:

  • P. u. superior: found in Baja California, Arizona, Sonora, and Sinaloa. P. u. superior was believed to have longer tails and wings and to be more blackish than P. u. harrisi. However, the sample size of the original study was quite small, with only five males and six females. Later research has concluded that there is not as strong a physical difference as was originally assumed.[12] Other ecological differences, such as latitudinal cline were also brought up as arguments against the validity of the subspecies segmentation.[13]
  • P. u. harrisi: found in Texas, eastern Mexico, and much of Central America.[13]
  • P. u. unicinctus: found exclusively in South America. It is smaller than the North American subspecies.[13]

Distribution and habitat[edit]

Harris's hawks live in sparse woodland and semi-desert, as well as marshes (with some trees) in some parts of their range (Howell and Webb 1995), including mangrove swamps, as in parts of their South American range.[14] Harris's hawks are permanent residents and do not migrate.[13] Important perches and nest supports are provided by scattered larger trees or other features (e.g., power poles, woodland edges, standing dead trees, live trees, and boulders and saguaros.[15]

The wild Harris's hawk population is declining due to habitat loss; however, under some circumstances, they have been known to move into developed areas.[16]

Behavior[edit]

At one week old

This species occurs in relatively stable groups. A dominance hierarchy occurs in Harris's hawks, wherein the mature female is at the dominant bird, followed by the adult male and then the young of previous years. Groups typically include from 2 to 7 birds. Not only do birds cooperate in hunting, they also assist in the nesting process.[17] No other bird of prey is known to hunt in groups as routinely as this species.[18]

Feeding[edit]

The diet of the Harris's hawk consists of small creatures including birds, lizards, mammals, and large insects. Because it often hunts in groups, the Harris's hawk can also take down larger prey.[19] Although not particularly common, the Harris's hawk may take prey weighing over 2 kg (4.4 lb), such as adult jackrabbits, great blue heron (Ardea herodias) and half-grown wild turkeys (Meleagris gallapavo).[20][21][22] The desert cottontail (Syvilagus auduboni), the leading prey species in the north of the Harris's hawk range, usually weighs 800 g (1.8 lb) or less.[23] Undoubtedly because it pursues large prey often, this hawk has larger and stronger feet, with long talons, and a larger, more prominent hooked beak than most other raptor around its size.[8] Locally, other buteonine hawks, including the ferruginous hawk, the red-tailed hawk and the white-tailed hawk also hunt primarily cottontails and jackrabbits, but each are bigger, weighing about 500 g (18 oz), 300 g (11 oz) and 200 g (7.1 oz), respectively, more on average than a Harris's Hawk.[24][25][26][27][28]

In the Southwestern United States, the most common prey species (in descending order of prevalence) are desert cottontail (Syvilagus auduboni), eastern cottontail (Syvilagus floridanus), black-tailed jackrabbit (Lepus californicus), ground squirrels (Ammopsermophilus spp. and Spermophilus spp.), woodrats (Neotoma spp.), kangaroo rats (Dipodomys spp.), pocket gophers (Geomys and Thomomys spp.), Gambel's quail (Callipepla gambelii), scaled quail (C. squamata), northern bobwhite (Colinus virginianus), cactus wren (Campylorhynchus brunneicapillus), northern mockingbird (Mimus polyglottos), desert spiny lizards (Sceloporus magister), and skinks (Eumeces spp.)[29][30] In the tropics, Harris's hawks have adapted to taking prey of several varieties, including those like chickens and European rabbits introduced by man.[31][32] In Chile, the Degu (Octodon degus) makes up 67.5% of the prey.[33]

Hunting[edit]

While most raptors are solitary, only coming together for breeding and migration, Harris's hawks will hunt in cooperative groups of two to six. This is believed to be an adaptation to the desert climate in which they live. In one hunting technique, a small group flies ahead and scouts, then another group member flies ahead and scouts, and this continues until prey is bagged and shared. In another, all the hawks spread around the prey and one bird flushes it out.[34]

Breeding[edit]

They nest in small trees, shrubby growth, or cacti. The nests are often compact, made of sticks, plant roots, and stems, and are often lined with leaves, moss, bark and plant roots. They are built mainly by the female. There are usually two to four white to blueish white eggs sometimes with a speckling of pale brown or gray. The nestlings start out light buff, but in five to six days turn a rich brown.[35]

Very often, there will be three hawks attending one nest: two males and one female.[19] Whether or not this is polyandry is debated, as it may be confused with backstanding (one bird standing on another's back).[36] The female does most of the incubation. The eggs hatch in 31 to 36 days. The young begin to explore outside the nest at 38 days, and fledge, or start to fly, at 45 to 50 days. The female sometimes breeds two or three times in a year.[35] Young may stay with their parents for up to three years, helping to raise later broods. Nests are known to be predated by Coyotes (Canis latrans), golden eagles (Aquila chrysaetos), great horned owls (Bubo virginianus) and flocks of common ravens (Corvus corax), predators possibly too formidable to be fully displaced by the Harris's hawk's cooperative nest defenses.[37] In Chile, black-chested buzzard-eagles (Geranoaetus melanoleucus) are likely predators.[38]

Relationship with humans[edit]

Adult male

Falconry[edit]

Since about 1980, Harris's hawks have been increasingly used in falconry and are now the most popular hawks in the West (outside of Asia) for that purpose, as they are one of the easiest to train and the most social.[39]

Training to catch rabbits

Their desire and ability to work closely with their falconer allows them to take a larger and more varied score of game than any other falcon or hawk species.[4] They are effective on both bird and mammalian prey, and are willing to tackle game larger than themselves. Though not quite as athletic as either falcons or accipiters, the close and cunning ways they learn to work as part of a falconry team more than makes up for their somewhat lesser speed and endurance. However, their cooperativeness as falconry birds may lead to overconfidence in the novice falconer, and the mistaken belief that corners can be cut in training the hawk, leading to some poorly trained birds simply flying away and never coming back. Growing colonies of feral Harris's hawks have been reported in locations outside of the bird's natural range as a result.[citation needed]

Trained Harris's hawks have been used to remove an unwanted pigeon population from London's Trafalgar Square.[40]

In art[edit]

John James Audubon illustrated the Harris's hawk in The Birds of America (published, London 1827–38) as Plate 392 with the title "Louisiana Hawk -Buteo harrisi". The image was engraved and colored by the Robert Havell, London workshops in 1837. The original watercolor by Audubon was purchased by the New York History Society where it remains to this day (January 2009).[citation needed]

References[edit]

  1. ^ BirdLife International (2012). "Parabuteo unicinctus". IUCN Red List of Threatened Species. Version 2013.2. International Union for Conservation of Nature. Retrieved 26 November 2013. 
  2. ^ Jobling, James A. (1991). A Dictionary of Scientific Bird Names. ISBN 0-19-854634-3. 
  3. ^ National Audubon Society. "Audubon". Audubon. Retrieved 2013-04-29. 
  4. ^ a b Beebe, Frank (1984). A Falconry Manual. Hancock House Publishers, ISBN 0-88839-978-2, page 81.
  5. ^ a b Udvardy, Miklos D. F. (2001). National Audubon Society Field Guide to North American Birds 'Western Region'. ISBN 0-679-42851-8. 
  6. ^ Clark, W. S. and B. K. Wheeler. (1987). A Field Guide to Hawks of North America. Houghton Mifflin Co. Boston.
  7. ^ Dunning, John B., Jr. (1993). CRC Handbook of Avian Masses. ISBN 0-8493-4258-9. 
  8. ^ a b Hamerstrom, F. (1978). External sex characters of Harris's hawks in winter. Raptor Res. 12:1–14.
  9. ^ National Geographic Society (1983). Birds of North America. ISBN 0-87044-472-7. 
  10. ^ Sibley, David Allen (2000). National Audubon Society The Sibley Guide to Birds. ISBN 0-679-45122-6. 
  11. ^ a b Rappole, John H. (2000). Birds of the Southwest. ISBN 0-89096-958-2. 
  12. ^ Bednarz, J. C. (1988). "Harris's hawk subspecies: is superior larger or different than harrisi?". in Proceedings of the southwest raptor management symposium and workshop. Washington, D.C. pp. 294–300. 
  13. ^ a b c d Bednarz, James C. (1995). "Harris's Hawk (Parabuteo unicinctus)". 
  14. ^ (Spanish) Olmos Fábio & Robson Silva e Silva (2003). Guará-Ambiente, Flora e Fauna dos Manguezais de Santos-Cubatão Empresa das Artes, ISBN 85-89138-06-2
  15. ^ Bednarz, J. C. and J. D. Ligon. (1988). A study of the ecological bases of cooperative breeding in the Harris's hawk. Ecology 69:1176–1187.
  16. ^ Discoll, James T. "Harris's Hawk". Retrieved 2007-11-19. 
  17. ^ Dawson, J. W. and R. W. Mannan. (1991). The role of territoriality in the social organization of Harris's hawks. Auk 108:661–672.
  18. ^ Griffin, C. R. (1976). A preliminary comparison of Texas and Arizona Harris's Hawks (Parabuteo unicinctus) populations. Raptor Res. 10:50–54.
  19. ^ a b Kaufmann, Kenn (1996). Lives of North American Birds. ISBN 0-395-77017-3. 
  20. ^ Bednarz, J. C. (1988). A comparative study of the breeding ecology of Harris' and Swainson's hawks in southeastern New Mexico. Condor 90:311–323.
  21. ^ Woodward, H.D. (2003). Lone Harris's Hawk Kills Great Blue Heron. The Raptor Research Foundation 1:85–86.
  22. ^ Houcke, H.H. (1971). Predation By a White-Tailed Hawk and a Harris's Hawk on a Wild Turkey Poult Condor 4: 475.
  23. ^ Bednarz, J. C., J. W. Dawson, and W. H. Whaley. (1988). Harris's Hawk. Pages 71–82 in Proceedings of the southwest raptor management symposium and workshop. (Glinski, R. L., B. G. Pendleton, M. B. Moss, M. N. LeFranc, Jr., B. A. Millsap, and S. W. Hoffman, Eds.) Natl. Wildl. Fed. Washington, D.C.
  24. ^ Smith, D. G. and J. R. Murphy. (1978). Biology of the Ferruginous Hawk in central Utah. Sociobiology 3:79–98.
  25. ^ Thurow, T. L., C. M. White, R. P. Howard, and J. F. Sullivan. (1980). Raptor ecology of Raft River valley, Idaho. EG&G Idaho, Inc. Idaho Falls.
  26. ^ Smith, D. G. and J. R. Murphy. (1973). Breeding ecology of raptors in the East Great Basin Desert of Utah. Brigham Young Univ. Sci. Bull., Biol. Ser. Vol. 18:1–76.
  27. ^ Farquhar, C. C. (1986). Ecology and breeding behavior of the White-tailed Hawk on the northern coastal prairies of Texas. PhD. diss. Texas A & M Univ. College Station.
  28. ^ Dunning Jr., John B. (Editor). (1992). CRC Handbook of Avian Body Masses. CRC Press. ISBN 978-0-8493-4258-5.
  29. ^ Mader, W. J. (1975). Biology of the Harris's hawk in southern Arizona. Living Bird 14:59–85.
  30. ^ Brannon, J. D. (1980). The reproductive ecology of a Texas Harris's hawk (Parabuteo unicinctus harrisi) population. Master's Thesis. Univ. of Texas, Austin.
  31. ^ Nutting, C. C. (1883). On a collection of birds from the Hacienda "La Palma," Gulf of Nicoya, Costa Rica, with critical notes by Robert Ridgway. Proc. U.S. Natl. Mus. 1982(5):382–409.
  32. ^ Johnson, A. W. (1965). The birds of Chile and adjacent regions of Argentina, Bolivia, and Peru. Platt Establecimientos Graficos, Buenos Aires.
  33. ^ Jaksic, F. M., J. L. Yanez, and R. P. Schlatter. (1980). Prey of the Harris's hawk in central Chile. Auk 97:196–198.
  34. ^ Cook, William E. (1997). Avian Desert Predators. ISBN 3-540-59262-8. 
  35. ^ a b Baicich, Paul J.; Harrison, Colin J. O. (1997). Nests, Eggs, and Nestlings of North American Birds. ISBN 0-691-12295-4. 
  36. ^ Ligon, J. David (1999). The Evolution of Avian Breeding Systems. Oxford Ornithology Series 10. Oxford University Press. ISBN 019854913X. Retrieved 4 August 2013. 
  37. ^ Dawson, J. W. and R. W. Mannan. (1991). Dominance hierarchies and helper contributions in Harris's Hawks. Auk 108:649–660.
  38. ^ Jiménez, J. E., & Jaksić, F. M. (1989). Behavioral ecology of grey eagle-buzzards, Geranoaetus melanoleucus, in central Chile. Condor 913–921.
  39. ^ "Raptors page". Users.cybercity.dk. Retrieved 2013-04-29. 
  40. ^ Mount, Harry (2009-10-07). "The £60,000 killer loose in Trafalgar Square". Dailymail.co.uk. Retrieved 2013-04-29. 
Creative Commons Attribution Share Alike 3.0 (CC BY-SA 3.0)

Source: Wikipedia

Unreviewed

Article rating from 0 people

Default rating: 2.5 of 5

Names and Taxonomy

Taxonomy

Comments: Subspecies HARRISI and SUPERIOR do not merit recognition as separate taxa (Bednarz 1988).

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!