Articles on this page are available in 1 other language: Spanish (17) (learn more)

Overview

Brief Summary

Rupornis magnirostris, an old world term for the Roadside Hawk is the most common bird seen in Central and South America. Molecular evidence recently reclaimed the hawk in the monophyletic group of Buteo, the distinguished name for buzzards (Amaral, 2009). Magnirostris refers to its large beak needed for it general omnivorous diet. Single or paired individuals are common along roadsides, as their name implies, perched on light post or tall trees. Roadside hawks can also be found in second growth forests, open shrub lands, pastures, or forest outskirts. Still-hunting from an aerial perch is displayed to capture mostly amphibians and lizards, but also small mammals such as bats, birds, squirrels, and mice (Panasci and Whitacre, 2000).  Ground-hunting is performed to capture insects including Orthoptera, Arachnoidae, and Hymenoptera (Haverschmidt, 1962).

Typically, the roadside hawk is stationary and solitary. However, it is extremely territorial. Piercing vocalizations are a common form of communication. When nests are being guarded, distinct calls and flying patterns are observed as well as during mating times. The bird is small in size reaching 33-41 cm in length and 250 to 300 grams in weight (Haverschmidt, 1962).The body is mostly grey colored with a yellow banded tail and clustered bands throughout its chest. Males and females display the same coloration but differ in size with the male being smaller (Rodriguez-Flores and Arizmendi, 2010). Nests are built from twigs and leaves in tall trees. Average nests dimensions are about 34.7 cm in length and 26.3 cm in width inhabiting one to two eggs on average for about four to six weeks (Rodriguez-Flores and Arizmendi, 2010). 

  • AMARALA F.ET AL. 2009. Patterns and processes of diversification in a widespread and ecologically diverse avian group, the buteonine hawks (Aves, Accipitridae). Molecular Phylogenetics and Evolution 53.3:703-715.
  • BIRDLIFE INTERNATIONAL. 2012. Buteo magnirostris. Red List of Threatened Species. Version Website: www.iucnredlist.org. [Accessed 4 March 2014].
  • GLOBAL RAPTOR INFORMATION NETWORK. 2014. Species account: Roadside Hawk Rupornis magnirostris. Website: http://www.globalraptors.org. [Accessed 4 March 2014].
  • HAVERSCHMIDT F. 1962. Notes on the Feeding Habits and Food of Some Hawks of Surinam. The Condor 64.2: 154-158.
  • PANASCI T. AND WHITACRE D. 2000. Diet and foraging behavior of nesting Roadside Hawks in Petén, Guatemala. The Wilson Bulletin 112.4: 555-558.
  • RODRIGUEZ-FLORES C. and ARIZMENDI M.C. 2010. Roadside Hawk (Buteo magnirostris), Neotropical Birds Online. Cornell Lab of Ornithology. Website: http://neotropical.birds.cornell.edu/portal/species/overview?p_p_spp=126516 [Accessed 4 March 2014].
Creative Commons Attribution 3.0 (CC BY 3.0)

© Shannon Insley

Supplier: Shannon Insley

Unreviewed

Article rating from 0 people

Default rating: 2.5 of 5

Ecology

Habitat

Habitat and Ecology

Systems
  • Terrestrial
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Barcode data: Buteo magnirostris

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There are 9 barcode sequences available from BOLD and GenBank.

Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.

See the BOLD taxonomy browser for more complete information about this specimen and other sequences.

GTGACATTTATCAACCGATGACTATTCTCAACCAACCACAAAGACATTGGTACACTATACCTAATCTTCGGCGCCTGAGCTGGTATAGTCGGCACCGCCCTCAGCCTACTCATTCGCGCAGAACTCGGCCAACCAGGCACACTCCTAGGCGACGACCAAATCTACAACGTAATCGTTACTGCACATGCCTTTGTAATAATCTTCTTCATAGTTATACCAATCATGATTGGAGGATTCGGAAACTGACTTGTCCCACTCATAATTGGAGCCCCCGACATAGCCTTTCCACGCATAAACAACATAAGCTTCTGGCTACTCCCTCCATCCTTCCTCCTCCTACTGGCCTCCTCAACAGTAGAAGCAGGAGCCGGCACTGGATGAACTGTCTACCCCCCATTAGCTGGCAACATAGCCCATGCCGGAGCTTCAGTAGACTTGGCCATCTTCTCCTTACACTTAGCTGGAGTCTCATCCATTCTAGGAGCAATCAACTTTATCACAACCGCCATCAACATAAAACCCCCAGCCCTCTCCCAGTACCAAACACCCCTATTCGTATGATCTGTCCTCATTACCGCCGTCCTTCTATTACTTTCACTCCCAGTCCTAGCCGCTGGCATCACTATACTACTCACAGACCGAAACCTAAACACAACATTCTTTGACCCTGCCGGCGGAGGCGATCCTATCCTATACCAACACCTCTTCTGATTCTTTGGACACCCAGAAGTCTA
-- end --

Download FASTA File

Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Statistics of barcoding coverage: Buteo magnirostris

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 9
Specimens with Barcodes: 15
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Conservation

Conservation Status

IUCN Red List Assessment


Red List Category
LC
Least Concern

Red List Criteria

Version
3.1

Year Assessed
2012

Assessor/s
BirdLife International

Reviewer/s
Butchart, S. & Symes, A.

Contributor/s

Justification
This species has an extremely large range, and hence does not approach the thresholds for Vulnerable under the range size criterion (Extent of Occurrence <20,000 km2 combined with a declining or fluctuating range size, habitat extent/quality, or population size and a small number of locations or severe fragmentation). The population trend appears to be increasing, and hence the species does not approach the thresholds for Vulnerable under the population trend criterion (>30% decline over ten years or three generations). The population size is very large, and hence does not approach the thresholds for Vulnerable under the population size criterion (<10,000 mature individuals with a continuing decline estimated to be >10% in ten years or three generations, or with a specified population structure). For these reasons the species is evaluated as Least Concern.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Population

Population
Partners in Flight estimate the total population to number 500,000-4,999,999 individuals (A. Panjabi in litt. 2008).

Population Trend
Increasing
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Wikipedia

Roadside hawk

The roadside hawk (Rupornis magnirostris) is a relatively small bird of prey found in the Americas. This vocal species is often the most common raptor in its range. It has many subspecies and is now usually placed in the monotypic genus Rupornis instead of Buteo.[2]

Description[edit]

The roadside hawk is 31–41 cm (12–16 in) long and weighs 250–300 g (8.8–10.6 oz).[3] Males are about 20% smaller than females, but otherwise the sexes are similar.[4] In most subspecies, the lower breast and underparts are barred brown and white, and the tail has four or five grey bars. Twelve subspecies are usually recognised and there is significant plumage variation between these. Depending on the subspecies involved, the roadside hawk is mainly brown or grey. It is fairly common to observe a touch of rufous (i.e., a light reddish-brown) on the bird's wings, especially when seen in flight.[5] Its call is a very high-pitched piercing squeak. The eyes of adult roadside hawks are whitish or yellow. As suggested by its specific name (magni = large; rostri = beak), its beak is relatively large.[4]

The roadside hawk may be marginally the smallest hawk in the widespread genus Buteo, although Ridgway's hawk and the white-rumped hawk are scarcely larger.[4] In flight, the relatively long tail and disproportionately short wings of the roadside hawk are distinctive. It frequently soars, but does not hover.[4]

Subspecies[edit]

The subspecies and their distributions are:[6]

Range and habitat[edit]

Recorded in Brazil

Problems playing this file? See media help.

The roadside hawk is common throughout its range: from Mexico through Central America to most of South America east of the Andes cordillera. It is found from the northern Caribbean coast of South America south to the northeastern parts of Argentina. With the possible exception of dense rainforests, the roadside hawk is well adapted to most ecosystems in its range. It is also an urban bird, and is possibly the most common species of hawk seen in various cities throughout its range—or perhaps just the most conspicuous one, as it becomes aggressive when nesting and has been recorded attacking humans passing near the nest.[7][8]

Food and feeding[edit]

The roadside hawk's diet consists mainly of insects, squamates, and small mammals, such as young common marmosets and similar small monkeys which are hunted quite often.[9] It will also take small birds, but far less often than generalists such as the related but larger white-tailed hawk, or bird specialists like the more distantly related aplomado falcon. Mixed-species feeding flocks it encounters when hunting in open cerrado habitat are not particularly wary of it: they watch it lest the hawk come too close, but consider them hardly more of a threat than the diminutive American kestrel.[10]

References[edit]

  1. ^ BirdLife International (2012). "Buteo magnirostris". IUCN Red List of Threatened Species. Version 2012.1. International Union for Conservation of Nature. Retrieved 16 July 2012. 
  2. ^ South American Classification Committee (2011) Revise generic boundaries in the Buteo group. Accessed 16 June 2011
  3. ^ "Roadside Hawk". oiseaux-birds.com. 
  4. ^ a b c d Ferguson-Lees, James; Christie, David A. (2001). Raptors of the World. London: Christopher Helm. ISBN 0-7136-8026-1. 
  5. ^ As illustrated in: Frisch, J.D.; Frisch, C.D. (2005). Aves Brasileiras e Plantas que as Atraem [Brazilian birds and plants attractive to them] (in Portuguese). São Paulo: Dalgas Ecotec. p. 191. ISBN 85-85015-07-1. 
  6. ^ Clement, J.F. (2007). The Clements Checklist of the Birds of the World (6th ed.). ISBN 978-0-7136-8695-1. 
  7. ^ BirdLife species factsheet for Buteo magnirostris
  8. ^ Pereira, José Felipe Monteiro (2008). Aves e Pássaros Comuns do Rio de Janeiro [Common birds of Rio de Janeiro] (in Portuguese). Rio de Janeiro: Technical Books Editora. p. 41. ISBN 978-85-61368-00-5. 
  9. ^ de Lyra-Neves, Rachel M.; Oliveira, Maria A.B.; Telino-Júnior, Wallace R.; dos Santos, Ednilza M. (2007). "Comportamentos interespecíficos entre Callithrix jacchus (Linnaeus) (Primates, Callitrichidae) e algumas aves de Mata Atlântica, Pernambuco, Brasil" [Interspecific behaviour between Callithrix jacchus (Linnaeus) (Callitrichidae, Primates) and some birds of the Atlantic forest, Pernanbuco State, Brazil]. Revista Brasileira de Zoologia (in Portuguese with English abstract) 24 (3): 709–716. doi:10.1590/S0101-81752007000300022. 
  10. ^ Ragusa-Netto, J. (2000). "Raptors and "campo-cerrado" bird mixed flock led by Cypsnagra hirundinacea (Emberizidae: Thraupinae)". Revista Brasileira de Biologia (in English with Portuguese abstract) 60 (3): 461–467. doi:10.1590/S0034-71082000000300011. PMID 11188872. 
Creative Commons Attribution Share Alike 3.0 (CC BY-SA 3.0)

Source: Wikipedia

Unreviewed

Article rating from 0 people

Default rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!