Articles on this page are available in 1 other language: Spanish (17) (learn more)

Overview

Brief Summary

Rupornis magnirostris, an old world term for the Roadside Hawk is the most common bird seen in Central and South America. Molecular evidence recently reclaimed the hawk in the monophyletic group of Buteo, the distinguished name for buzzards (Amaral, 2009). Magnirostris refers to its large beak needed for it general omnivorous diet. Single or paired individuals are common along roadsides, as their name implies, perched on light post or tall trees. Roadside hawks can also be found in second growth forests, open shrub lands, pastures, or forest outskirts. Still-hunting from an aerial perch is displayed to capture mostly amphibians and lizards, but also small mammals such as bats, birds, squirrels, and mice (Panasci and Whitacre, 2000).  Ground-hunting is performed to capture insects including Orthoptera, Arachnoidae, and Hymenoptera (Haverschmidt, 1962).

Typically, the roadside hawk is stationary and solitary. However, it is extremely territorial. Piercing vocalizations are a common form of communication. When nests are being guarded, distinct calls and flying patterns are observed as well as during mating times. The bird is small in size reaching 33-41 cm in length and 250 to 300 grams in weight (Haverschmidt, 1962).The body is mostly grey colored with a yellow banded tail and clustered bands throughout its chest. Males and females display the same coloration but differ in size with the male being smaller (Rodriguez-Flores and Arizmendi, 2010). Nests are built from twigs and leaves in tall trees. Average nests dimensions are about 34.7 cm in length and 26.3 cm in width inhabiting one to two eggs on average for about four to six weeks (Rodriguez-Flores and Arizmendi, 2010). 

Creative Commons Attribution 3.0 (CC BY 3.0)

© Shannon Insley

Supplier: Shannon Insley

Unreviewed

Article rating from 0 people

Default rating: 2.5 of 5

Ecology

Habitat

Habitat and Ecology

Systems
  • Terrestrial
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Barcode data: Buteo magnirostris

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There are 9 barcode sequences available from BOLD and GenBank.

Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.

See the BOLD taxonomy browser for more complete information about this specimen and other sequences.

GTGACATTTATCAACCGATGACTATTCTCAACCAACCACAAAGACATTGGTACACTATACCTAATCTTCGGCGCCTGAGCTGGTATAGTCGGCACCGCCCTCAGCCTACTCATTCGCGCAGAACTCGGCCAACCAGGCACACTCCTAGGCGACGACCAAATCTACAACGTAATCGTTACTGCACATGCCTTTGTAATAATCTTCTTCATAGTTATACCAATCATGATTGGAGGATTCGGAAACTGACTTGTCCCACTCATAATTGGAGCCCCCGACATAGCCTTTCCACGCATAAACAACATAAGCTTCTGGCTACTCCCTCCATCCTTCCTCCTCCTACTGGCCTCCTCAACAGTAGAAGCAGGAGCCGGCACTGGATGAACTGTCTACCCCCCATTAGCTGGCAACATAGCCCATGCCGGAGCTTCAGTAGACTTGGCCATCTTCTCCTTACACTTAGCTGGAGTCTCATCCATTCTAGGAGCAATCAACTTTATCACAACCGCCATCAACATAAAACCCCCAGCCCTCTCCCAGTACCAAACACCCCTATTCGTATGATCTGTCCTCATTACCGCCGTCCTTCTATTACTTTCACTCCCAGTCCTAGCCGCTGGCATCACTATACTACTCACAGACCGAAACCTAAACACAACATTCTTTGACCCTGCCGGCGGAGGCGATCCTATCCTATACCAACACCTCTTCTGATTCTTTGGACACCCAGAAGTCTA
-- end --

Download FASTA File

Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Statistics of barcoding coverage: Buteo magnirostris

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 9
Specimens with Barcodes: 15
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Conservation

Conservation Status

IUCN Red List Assessment


Red List Category
LC
Least Concern

Red List Criteria

Version
3.1

Year Assessed
2012

Assessor/s
BirdLife International

Reviewer/s
Butchart, S. & Symes, A.

Contributor/s

Justification
This species has an extremely large range, and hence does not approach the thresholds for Vulnerable under the range size criterion (Extent of Occurrence <20,000 km2 combined with a declining or fluctuating range size, habitat extent/quality, or population size and a small number of locations or severe fragmentation). The population trend appears to be increasing, and hence the species does not approach the thresholds for Vulnerable under the population trend criterion (>30% decline over ten years or three generations). The population size is very large, and hence does not approach the thresholds for Vulnerable under the population size criterion (<10,000 mature individuals with a continuing decline estimated to be >10% in ten years or three generations, or with a specified population structure). For these reasons the species is evaluated as Least Concern.

History
  • Least Concern (LC)
  • Least Concern (LC)
  • Least Concern (LC)
  • Lower Risk/least concern (LR/lc)
  • Lower Risk/least concern (LR/lc)
  • Lower Risk/least concern (LR/lc)
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5