Articles on this page are available in 1 other language: Spanish (19) (learn more)

Overview

Distribution

Range

Mexico to n Argentina and central Chile.
  • Clements, J. F., T. S. Schulenberg, M. J. Iliff, D. Roberson, T. A. Fredericks, B. L. Sullivan, and C. L. Wood. 2014. The eBird/Clements checklist of birds of the world: Version 6.9. Downloaded from http://www.birds.cornell.edu/clementschecklist/download/

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Ecology

Habitat

Habitat and Ecology

Systems
  • Terrestrial
  • Freshwater
  • Marine
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Barcode data: Charadrius collaris

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There are 4 barcode sequences available from BOLD and GenBank.

Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.

See the BOLD taxonomy browser for more complete information about this specimen and other sequences.

GTGACATACATCAACCGATGACTATTCTCAACTAACCACAAAGACATCGGCACCCTATACTTAATCTTTGGCGCATGAGCCGGTATAGTCGGTACCGCCCTCAGCTTACTTATTCGTGCAGAACTGGGCCAACCAGGAACCCTCCTAGGTGACGACCAAATCTACAATGTAATTGTCACCGCCCATGCTTTCGTAATAATCTTTTTCATAGTTATACCAATCATAATCGGCGGTTTTGGAAACTGACTGGTGCCACTTATAATTGGCGCACCAGACATGGCATTCCCCCGCATAAATAACATAAGCTTCTGACTTCTACCCCCATCCTTCCTTCTTCTCCTTGCATCATCCACAGTAGAGGCTGGAGCAGGCACAGGATGAACCGTGTACCCACCTTTAGCTGGCAACTTAGCCCACGCCGGAGCTTCAGTAGACCTAGCCATCTTCTCTTTACACCTAGCAGGTGTATCATCCATCCTGGGTGCAATCAACTTCATCACAACCGCCATTAACATGAAACCACCCGCCCTTTCACAATACCAAACTCCCCTATTCGTATGATCCGTACTCATCACAGCCGTCCTATTACTCCTCTCACTCCCAGTCCTTGCTGCCGGCATCACTATACTACTAACAGACCGAAACCTAAATACCACATTCTTTGACCCCGCCGGAGGAGGTGACCCAGTCCTATACCAGCACCTCTTCTGATTCTTCGGCCACCCAGAAGTCTACATCTTAATCCT
-- end --

Download FASTA File

Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Statistics of barcoding coverage: Charadrius collaris

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 4
Specimens with Barcodes: 9
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Conservation

Conservation Status

IUCN Red List Assessment


Red List Category
LC
Least Concern

Red List Criteria

Version
3.1

Year Assessed
2012

Assessor/s
BirdLife International

Reviewer/s
Butchart, S. & Symes, A.

Contributor/s

Justification
This species has an extremely large range, and hence does not approach the thresholds for Vulnerable under the range size criterion (Extent of Occurrence <20,000 km2 combined with a declining or fluctuating range size, habitat extent/quality, or population size and a small number of locations or severe fragmentation). Despite the fact that the population trend appears to be decreasing, the decline is not believed to be sufficiently rapid to approach the thresholds for Vulnerable under the population trend criterion (>30% decline over ten years or three generations). The population size may be small, but it is not believed to approach the thresholds for Vulnerable under the population size criterion (<10,000 mature individuals with a continuing decline estimated to be >10% in ten years or three generations, or with a specified population structure). For these reasons the species is evaluated as Least Concern.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Population

Population
The population is estimated to number 1,000-10,000 individuals, roughly equating to 670-6,700 mature individuals.

Population Trend
Decreasing
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Wikipedia

Collared plover

The collared plover (Charadrius collaris) is a small shorebird in the plover family, Charadriidae. It lives along coasts and riverbanks of the tropical to temperate Americas, from central Mexico south to Chile and Argentina.

This small plover is 18 centimetres (7.1 in) long and weighs 35 grams (1.2 oz). Its upperparts are brown and the underparts white in all plumages. Adults have a black breast band. The male has a white forehead, bordered above by a black frontal bar, and below by a black stripe from the bill to the eye. The midcrown and nape are chestnut and the legs are yellow. In flight, the flight feathers are dark with a white wing bar, and the tail shows white sides.

The female collared plover is usually very similar to the male, but some individuals can be sexed by a brown tinge to the black areas. Immature birds lack any black on the head, and the breast band is replaced by brown patches on each side of the chest. The flight call is a sharp metallic pip.

Two sympatric Charadrius species are very similar: The snowy plover is similar in size and structure to this species, but is paler above, has dark legs, and never has a complete breastband. semipalmated plovers are larger, thicker-billed, and has a pale collar. Ironically, it is the lack of a pale collar which gives the collared plover its English language and scientific names.

The collared plover is found on sandy coasts, estuarine mud, inland riverbanks and open sandy savannas. It breeds from Mexico south through Central America and most of South America. It also occurs on some of the southern Caribbean islands, and both Trinidad and Tobago. It appears to be mainly sedentary, although there is some evidence for limited seasonal movements. Collared plovers feed on insects and other invertebrates, which are obtained by a run-and-pause technique, rather than the steady probing of some other wader groups. This species is not particularly gregarious, and seldom forms flocks. It is usually very wary.

The timing of breeding activity varies depending on location: November to December in western Mexico,[2] March to June in Costa Rica,[3] January in Venezuela, and March in the lowlands of Ecuador. The male's courtship display involves fluffing out his breast feathers and running after the female; the species has no known aerial display.[2] The nest is a bare ground scrape well above the tide or flood line on coasts and river shores or islands, or inland, often next to low cover, such as tufts of grass. The clutch is two pale buff eggs, spotted with brown.[3] Like many ground-nesting species, adults perform a broken-wing display to lure presumed threats away from their nest and young.[4]

Footnotes[edit]

  1. ^ BirdLife International (2012). "Charadrius collaris". IUCN Red List of Threatened Species. Version 2013.2. International Union for Conservation of Nature. Retrieved 26 November 2013. 
  2. ^ a b Hayman, Peter; Marchant, John; Prater, Tony (1986). Shorebirds: an identification guide to the waders of the world. Boston: Houghton Mifflin. p. 296. ISBN 0-395-60237-8. 
  3. ^ a b Stiles, F. Gary; Skutch, Alexander Frank (1989). A guide to the birds of Costa Rica. Ithaca: Comstock. p. 139. ISBN 0-8014-9600-4. 
  4. ^ Greeney, Harold F.; Gelis, Rudolphe A.; White, Richard (2004). "Notes on breeding birds from an Ecuadorian lowland forest" (PDF). Bulletin of the British Ornithologists' Club 124 (1): 28–37. 

References[edit]

  • ffrench, Richard; O'Neill, John Patton & Eckelberry, Don R. (1991): A guide to the birds of Trinidad and Tobago (2nd edition). Comstock Publishing, Ithaca, N.Y.. ISBN 0-8014-9792-2
  • Hilty, Steven L. (2003): Birds of Venezuela. Christopher Helm, London. ISBN 0-7136-6418-5
Creative Commons Attribution Share Alike 3.0 (CC BY-SA 3.0)

Source: Wikipedia

Unreviewed

Article rating from 0 people

Default rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!