Overview

Brief Summary

Buteo lagopus

A large (19-24 inches), dark bird, the Rough-legged Hawk may be best identified by its grayish-brown back, light face, and by the black band on the end of its broad, white tail. Seen from below, this hawk may also be identified by dark belly, black-tipped wings, and dark “wrist” patches. A dark morph also exists that is darker brown above and on the wings but retains this species’ basic color pattern. Like most species of raptors, females are larger than males. The Rough-legged Hawk is found across the Northern Hemisphere. In North America, this species breeds in western Alaska and northern Canada east to Labrador. Rough-legged Hawks migrate south for the winter, when they may be found in southern Canada, Newfoundland, and in the United States south to New Mexico in the west and Virginia in the east. In the Old World, this species breeds in Scandinavia and arctic Russia, wintering south to Eastern Europe, Central Asia, and East Asia. Rough-legged Hawks are birds of open country. In summer, this species breeds on tundra and on rocky sections of the arctic coastline. In winter, this species inhabits open grassland, fields, deserts, and marshes. Rough-legged Hawks eat small mammals, including lemmings, mice, and voles. Rough-legged Hawks soar over open habitat while scanning the ground for prey, dropping down to capture it with their talons. Due to this species’ habitat requirements and hunting technique, it may be easiest to observe Rough-legged Hawks in the air. In winter, may also be seen roosting at dusk in trees near feeding grounds. This species is primarily active during the day.

Threat Status: Least concern

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Unknown

Supplier: DC Birds

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Distribution

occurs (regularly, as a native taxon) in multiple nations

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

National Distribution

Canada

Origin: Native

Regularity: Regularly occurring

Currently: Present

Confidence: Confident

Type of Residency: Year-round

United States

Origin: Native

Regularity: Regularly occurring

Currently: Present

Confidence: Confident

Type of Residency: Year-round

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Global Range: Panboreal. BREEDS: in Noth America, from Aleutians and western and northern Alaska across low arctic and subarctic Canada. See Bechard and Houston (1984) for erroneous nest records. WINTERS: mainly from southern Canada south to southern California, southern Arizona, southern New Mexico, southern Texas, Missouri, Tennessee, Virginia, casually to eastern Texas and the Gulf Coast. Most numerous in winter in the Great Basin and central and northern Great Plains (Root 1988).

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

The breeding range of rough-legged hawk encompasses the high arctic
regions of the United States and Canada. The rough-legged hawk breeds
from western and northern Alaska, northern Yukon Territory, and northern
Labrador south to northern and southeastern MacKenzie District, central
Canada, and northern Quebec and Newfoundland. It also breeds from the
Kodiak islands and Umnak north to Prince Patrick, Victoria, Bylot, and
southwestern Baffin islands (Northwest Territories) [11,12,28,34].

The rough-legged hawk winters from south-central Alaska (casual) and
southern Canada south to southern California and southern Arizona, and
east to southern Texas, Missouri, Tennessee, and Virginia. On the East
Coast wintering rough-legged hawks occur from Cape Cod to Chesapeake Bay
and are occasionally observed in eastern Texas and on the Gulf Coast
[11,22,28].
  • 12. Ehrlich, Paul R.; Dobkin, David S.; Wheye, Darryl. 1988. The birder's handbook: a field guide to the natural history of North American birds. New York: Simon & Schuster, Inc. 785 p. [21559]
  • 22. Johnsgard, Paul A. 1990. Hawks, eagles, and falcons. Washington, DC: Smithsonian Institution Press. 403 p. [21510]
  • 28. Palmer, Ralph S., ed. 1988. Handbook of North American birds. New Haven, CT: Yale University Press. 5 volumes. [23780]
  • 34. Terres, John K. 1980. The Audubon Society encyclopedia of North American birds. New York: Alfred A. Knopf. 1109 p. [16195]
  • 11. DeGraaf, Richard M.; Scott, Virgil E.; Hamre, R. H.; [and others]. 1991. Forest and rangeland birds of the United States: Natural history and habitat use. Agric. Handb. 688. Washington, DC: U.S. Department of Agriculture, Forest Service. 625 p. [15856]

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Regional Distribution in the Western United States

More info on this topic.

This species can be found in the following regions of the western United States (according to the Bureau of Land Management classification of Physiographic Regions of the western United States):

1 Northern Pacific Border
2 Cascade Mountains
3 Southern Pacific Border
4 Sierra Mountains
5 Columbia Plateau
6 Upper Basin and Range
7 Lower Basin and Range
8 Northern Rocky Mountains
9 Middle Rocky Mountains
10 Wyoming Basin
11 Southern Rocky Mountains
12 Colorado Plateau
13 Rocky Mountain Piedmont
14 Great Plains
15 Black Hills Uplift
16 Upper Missouri Basin and Broken Lands

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Occurrence in North America

AK AZ AR CA CO CT DE ID IL
IN IA KS KY LA ME MD MA MI
MN MS MO MT NE NV NH NJ NM
NY NC ND OH OK OR PA RI SC
SD TN TX UT VT VA WA WV WI WY


AB BC MB NB NF NT NS ON PE PQ
SK YT

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Geographic Range

Buteo lagopus has a nearly holarctic distribution. Its geographic range includes most of the United States and all of Canada. Rough-legged hawks spend their winter months in all of the United States except for North Carolina and along the southeast coast of the United States, Kentucky, Alabama, Mississippi, and Arkansas. They are found as far north as Newfoundland and as far west as central Europe and parts of Russia.

Biogeographic Regions: nearctic (Native ); palearctic (Native )

Other Geographic Terms: holarctic

  • Pearson, T., J. Burroughs, E. Forbush, W. Finley, G. Gladden, H. Job, L. Nichols, J. Burdick. 1936. Rough-legged Hawk. Pp. 79-80 in Birds of America, Vol. 1-3, 12 Edition. Garden City, New York: Garden City Publishing Company, Inc..
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Physical Description

Morphology

Physical Description

Adult rough-legged hawks average 1026 g and have a wingspan of 134 cm. Total length averages 53 cm. Females are typically the larger gender. Rough-legged hawks have eight different morphs that vary between sex, age, and location. Both sexes exhibit both light and dark morphs; and coloration varies between juveniles and adults.

All adult morphs have a black band that goes along the edges of the underside of their lesser coverts. Adults also all have dark colored eyes. Juveniles have light colored eyes and a dark band along the underside of their wings.

Light morphs of adult females have brown backs and a pattern of increased markings from breast to belly. They have one dark tail band and heavily marked leg feathers. Light-morph adult males have grayish backs. Their breasts are more heavily marked than the belly and multiple bands exist on the tail. A light-morph adult male has heavily-marked leg feathers.

Dark-morph adult males are almost completely black but can be brownish with several white bands on their dark tail. Dark-morph adult females are dark brown with a single black band underneath their tail. Dark-morph juveniles are similar to adult females but exhibit rusty bands underneath their wings and tails. Some individuals have a pale-brown head.

Range mass: 745 to 1380 g.

Average mass: 1026 g.

Range length: 46 to 59 cm.

Average length: 53 cm.

Range wingspan: 122 to 143 cm.

Average wingspan: 134 cm.

Other Physical Features: endothermic ; homoiothermic; bilateral symmetry ; polymorphic

Sexual Dimorphism: female larger; sexes colored or patterned differently

  • Wheeler, B., W. Clark. 1996. A Photographic Guide to North American Raptors. San Diego, CA: Academic Press Inc..
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Size

Length: 56 cm

Weight: 1278 grams

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Ecology

Habitat

Comments: Nonbreeding: grasslands, field, marshes, sagebrush flats, and open cultivated areas; sometimes rat-infested garbage dumps. Nests on cliffs (typically) or in trees in arctic and subarctic, in tundra, mountain sides, forests with plenty of open ground. Sometimes nests on the ground or on man-made structures. Apparently nests more commonly along coasts and on marine islands. May compete for nest sites with raven, peregrine falcon, and gyrfalcon (latter two often use nests built by rough-legged hawk). May use same nest in successive years.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Habitat and Ecology

Systems
  • Terrestrial
  • Freshwater
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Preferred Habitat

More info for the terms: competition, cover, density

Nesting: Rough-legged hawk nests are usually built on cliffs, river
bluffs, rocky outcroppings and ledges, columnar rocks, artificial
structures such as cairns, on the ground on steep hillsides, and rarely,
in trees [11,22,28]. Sites with an overhanging ledge or caprock are
preferred [22]. There appears to be a tendency to nest in clusters of
breeding pairs; however, this may be a function of nest site
availability [28]. Estimated average breeding density is approximately
one pair per 3.1 square miles (7.8 sq km). Highest recorded density was
one pair per 1.6 square miles (4 sq km); however, there is often only
one pair per 31.2 square miles (78 sq km) [8]. Near the Colville River,
Alaska, nests averaged 2.3 linear miles (3.8 km) apart, ranging from
0.24 to 13.2 miles (0.4-22 km) apart. Rough-legged hawks usually return
to the same nest site from year to year, even in the face of heavy
competition from peregrine falcons (Falco peregrinus) or gyrfalcons (F.
rusticolus) for the same site [22]. Rough-legged hawks are not as
aggressive as the late-migrating peregrine falcons, which often displace
rough-legged hawks from nest sites [22,28].

Hunting: The rough-legged hawk prefers to hunt in open areas: wet
meadows, bogs, marshes, riparian areas, pastures, and shrub-grass
uplands [4,24]. Hunting territory size during the breeding season is
variable; it may be as small as 2 to 2.4 square miles (5-6 sq km) when
prey density is high [22].

Wintering: Rough-legged hawks usually winter in open country:
farmlands [32], plains, prairies, airports and other open urban areas,
coastal marshes, and agricultural lands. The winter home range usually
ranges from 4 to 6 square miles (10-15 sq km) [22]. Competition where
winter ranges overlap those of the red-tailed hawk (Buteo jamaicensis)
is mitigated by behavioral differences in hunting styles; for example,
rough-legged hawks hunt from lower perches, prefer more open areas, and
avoid snow cover more than red-tailed hawks do [37]. The rough-legged
hawk is absent from northern regions where the average minimum January
temperature is less than -10 degrees Fahrenheit (-23 deg C). This hawk
tends to avoid the western coastline and the southeastern corner of the
United States. It is most abundant in areas with less than 40 inches
(1,020 mm) annual precipitation [28].
  • 4. Balda, Russell P.; Masters, Nancy. 1980. Avian communities in the pinyon-juniper woodland: a descriptive analysis. In: DeGraaf, Richard M., technical coordinator. Management of western forests and grasslands for nongame birds: Workshop proceedings; 1980 February 11-14; Salt Lake City, UT. Gen. Tech. Rep. INT-86. Ogden, UT: U.S. Department of Agriculture, Forest Service, Intermountain Forest and Range Experiment Station: 146-169. [17903]
  • 8. Brown, Leslie; Amadon, Dean. 1968. Eagles, hawks and falcons of the world. Vol. 2. New York: McGraw-Hill Book Company. 945 p. [22970]
  • 22. Johnsgard, Paul A. 1990. Hawks, eagles, and falcons. Washington, DC: Smithsonian Institution Press. 403 p. [21510]
  • 24. Kochert, Michael N. 1986. Raptors. In: Cooperrider, Allan Y.; Boyd, Raymond J.; Stuart, Hanson R., eds. Inventory and monitoring of wildlife habitat. Denver, CO: U.S. Department of the Interior, Bureau of Land Management, Denver Service Center: 313-349. [13527]
  • 28. Palmer, Ralph S., ed. 1988. Handbook of North American birds. New Haven, CT: Yale University Press. 5 volumes. [23780]
  • 32. Sibley, Charles G.; Monroe, Burt L., Jr. 1990. Distribution and taxonomy of the birds of the world. New Haven, CT: Yale University Press. 1111 p. [22814]
  • 37. Zarn, Mark. 1975. Rough-legged hawk (Buteo lagopus sanctijohannis): Habitat management series for unique or endangered species: Report No. 14. Technical Note T-N-270. Denver, CO: U.S. Department of the Interior, Bureau of Land Management. 23 p. [24516]
  • 11. DeGraaf, Richard M.; Scott, Virgil E.; Hamre, R. H.; [and others]. 1991. Forest and rangeland birds of the United States: Natural history and habitat use. Agric. Handb. 688. Washington, DC: U.S. Department of Agriculture, Forest Service. 625 p. [15856]

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Associated Plant Communities

More info for the terms: shrub, taiga, tree, tundra

Breeding Habitat: The breeding habitat of rough-legged hawk is open
tundra and mountains; the southern limit of its breeding range coincides
with the latitudinal tree line [11,22]. Rough-legged hawks occasionally
nest in trees at the edge of boreal forest [22]. The rough-legged hawk
is not usually observed in forests, except where there is much open
ground. Kochert [24] listed tundra and taiga as breeding habitat for
the rough-legged hawk.

Wintering Habitat: The rough-legged hawk prefers conifer groves for
roosting and hunts in open, treeless areas [11]. Kochert [24] listed
rough-legged hawk wintering habitat as open shrub and grassland in
temperate areas. Rough-legged-hawks were observed wintering in pinyon
(Pinus spp.)-juniper (Juniperus spp.) woodlands in the southwestern
United States [4].

REFERENCES :
NO-ENTRY
  • 4. Balda, Russell P.; Masters, Nancy. 1980. Avian communities in the pinyon-juniper woodland: a descriptive analysis. In: DeGraaf, Richard M., technical coordinator. Management of western forests and grasslands for nongame birds: Workshop proceedings; 1980 February 11-14; Salt Lake City, UT. Gen. Tech. Rep. INT-86. Ogden, UT: U.S. Department of Agriculture, Forest Service, Intermountain Forest and Range Experiment Station: 146-169. [17903]
  • 22. Johnsgard, Paul A. 1990. Hawks, eagles, and falcons. Washington, DC: Smithsonian Institution Press. 403 p. [21510]
  • 24. Kochert, Michael N. 1986. Raptors. In: Cooperrider, Allan Y.; Boyd, Raymond J.; Stuart, Hanson R., eds. Inventory and monitoring of wildlife habitat. Denver, CO: U.S. Department of the Interior, Bureau of Land Management, Denver Service Center: 313-349. [13527]
  • 11. DeGraaf, Richard M.; Scott, Virgil E.; Hamre, R. H.; [and others]. 1991. Forest and rangeland birds of the United States: Natural history and habitat use. Agric. Handb. 688. Washington, DC: U.S. Department of Agriculture, Forest Service. 625 p. [15856]

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Habitat: Rangeland Cover Types

More info on this topic.

This species is known to occur in association with the following Rangeland Cover Types (as classified by the Society for Range Management, SRM):

More info for the terms: association, forb, fresh, hardwood, marsh, shrub, vine

101 Bluebunch wheatgrass
102 Idaho fescue
103 Green fescue
104 Antelope bitterbrush-bluebunch wheatgrass
105 Antelope bitterbrush-Idaho fescue
106 Bluegrass scabland
107 Western juniper/big sagebrush/bluebunch wheatgrass
109 Ponderosa pine shrubland
110 Ponderosa pine-grassland
201 Blue oak woodland
203 Riparian woodland
206 Chamise chaparral
207 Scrub oak mixed chaparral
208 Ceanothus mixed chaparral
209 Montane shrubland
210 Bitterbrush
211 Creosotebush scrub
212 Blackbush
301 Bluebunch wheatgrass-blue grama
302 Bluebunch wheatgrass-Sandberg bluegrass
303 Bluebunch wheatgrass-western wheatgrass
304 Idaho fescue-bluebunch wheatgrass
305 Idaho fescue-Richardson needlegrass
306 Idaho fescue-slender wheatgrass
307 Idaho fescue-threadleaf sedge
309 Idaho fescue-western wheatgrass
310 Needle-and-thread-blue grama
311 Rough fescue-bluebunch wheatgrass
312 Rough fescue-Idaho fescue
314 Big sagebrush-bluebunch wheatgrass
315 Big sagebrush-Idaho fescue
316 Big sagebrush-rough fescue
317 Bitterbrush-bluebunch wheatgrass
318 Bitterbrush-Idaho fescue
319 Bitterbrush-rough fescue
320 Black sagebrush-bluebunch wheatgrass
321 Black sagebrush-Idaho fescue
322 Curlleaf mountain-mahogany-bluebunch wheatgrass
323 Shrubby cinquefoil-rough fescue
324 Threetip sagebrush-Idaho fescue
401 Basin big sagebrush
402 Mountain big sagebrush
403 Wyoming big sagebrush
404 Threetip sagebrush
405 Black sagebrush
406 Low sagebrush
407 Stiff sagebrush
408 Other sagebrush types
409 Tall forb
411 Aspen woodland
412 Juniper-pinyon woodland
413 Gambel oak
414 Salt desert shrub
415 Curlleaf mountain-mahogany
416 True mountain-mahogany
417 Littleleaf mountain-mahogany
418 Bigtooth maple
419 Bittercherry
420 Snowbrush
421 Chokecherry-serviceberry-rose
422 Riparian
501 Saltbush-greasewood
502 Grama-galleta
503 Arizona chaparral
504 Juniper-pinyon pine woodland
505 Grama-tobosa shrub
506 Creosotebush-bursage
507 Palo verde-cactus
508 Creosotebush-tarbush
509 Transition between oak-juniper woodland and mahogany-oak association
601 Bluestem prairie
602 Bluestem-prairie sandreed
603 Prairie sandreed-needlegrass
604 Bluestem-grama prairie
605 Sandsage prairie
606 Wheatgrass-bluestem-needlegrass
607 Wheatgrass-needlegrass
608 Wheatgrass-grama-needlegrass
609 Wheatgrass-grama
610 Wheatgrass
611 Blue grama-buffalograss
612 Sagebrush-grass
614 Crested wheatgrass
615 Wheatgrass-saltgrass-grama
701 Alkali sacaton-tobosagrass
702 Black grama-alkali sacaton
703 Black grama-sideoats grama
704 Blue grama-western wheatgrass
705 Blue grama-galleta
706 Blue grama-sideoats grama
707 Blue grama-sideoats grama-black grama
708 Bluestem-dropseed
709 Bluestem-grama
710 Bluestem prairie
712 Galleta-alkali sacaton
713 Grama-muhly-threeawn
714 Grama-bluestem
715 Grama-buffalograss
716 Grama-feathergrass
717 Little bluestem-Indiangrass-Texas wintergrass
718 Mesquite-grama
719 Mesquite-liveoak-seacoast bluestem
720 Sand bluestem-little bluestem (dunes)
721 Sand bluestem-little bluestem (plains)
722 Sand sagebrush-mixed prairie
724 Sideoats grama-New Mexico feathergrass-winterfat
725 Vine mesquite-alkali sacaton
727 Mesquite-buffalograss
728 Mesquite-granjeno-acacia
729 Mesquite
730 Sand shinnery oak
731 Cross timbers-Oklahoma
732 Cross timbers-Texas (little bluestem-post oak)
733 Juniper-oak
734 Mesquite-oak
801 Savanna
802 Missouri prairie
803 Missouri glades
804 Tall fescue
805 Riparian
806 Gulf Coast salt marsh
807 Gulf Coast fresh marsh
809 Mixed hardwood and pine
819 Freshwater marsh and ponds
822 Slough

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Habitat: Plant Associations

More info on this topic.

This species is known to occur in association with the following plant community types (as classified by Küchler 1964):

More info for the terms: bog, shrub

K002 Cedar-hemlock-Douglas-fir forest
K003 Silver fir-Douglas-fir forest
K004 Fir-hemlock forest
K005 Mixed conifer forest
K009 Pine-cypress forest
K010 Ponderosa shrub forest
K011 Western ponderosa forest
K012 Douglas-fir forest
K015 Western spruce-fir forest
K016 Eastern ponderosa forest
K017 Black Hills pine forest
K018 Pine-Douglas-fir forest
K019 Arizona pine forest
K020 Spruce-fir-Douglas-fir forest
K021 Southwestern spruce-fir forest
K022 Great Basin pine forest
K024 Juniper steppe woodland
K027 Mesquite bosque
K028 Mosaic of K002 and K026
K029 California mixed evergreen forest
K031 Oak-juniper woodlands
K032 Transition between K031 and K037
K033 Chaparral
K034 Montane chaparral
K037 Mountain-mahogany-oak scrub
K038 Great Basin sagebrush
K039 Blackbrush
K040 Saltbush-greasewood
K041 Creosotebush
K042 Creosotebush-bursage
K043 Paloverde-cactus shrub
K044 Creosotebush-tarbush
K045 Ceniza shrub
K055 Sagebrush steppe
K056 Wheatgrass-needlegrass shrubsteppe
K058 Grama-tobosa shrubsteppe
K059 Trans-Pecos shrub savanna
K060 Mesquite savanna
K061 Mesquite-acacia savanna
K062 Mesquite-live oak savanna
K071 Shinnery
K081 Oak savanna
K082 Mosaic of K074 and K100
K084 Cross Timbers
K086 Juniper-oak savanna
K087 Mesquite-oak savanna
K089 Black Belt
K093 Great Lakes spruce-fir forest
K094 Conifer bog
K095 Great Lakes pine forest
K096 Northeastern spruce-fir forest
K097 Southeastern spruce-fir forest
K098 Northern floodplain forest
K101 Elm-ash forest
K106 Northern hardwoods
K107 Northern hardwoods-fir forest
K108 Northern hardwoods-spruce forest
K109 Transition between K104 and K106

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Habitat: Ecosystem

More info on this topic.

This species is known to occur in the following ecosystem types (as named by the U.S. Forest Service in their Forest and Range Ecosystem [FRES] Type classification):

FRES10 White-red-jack pine
FRES11 Spruce-fir
FRES15 Oak-hickory
FRES17 Elm-ash-cottonwood
FRES18 Maple-beech-birch
FRES19 Aspen-birch
FRES20 Douglas-fir
FRES21 Ponderosa pine
FRES22 Western white pine
FRES23 Fir-spruce
FRES24 Hemlock-Sitka spruce
FRES25 Larch
FRES26 Lodgepole pine
FRES27 Redwood
FRES28 Western hardwoods
FRES29 Sagebrush
FRES30 Desert shrub
FRES31 Shinnery
FRES32 Texas savanna
FRES33 Southwestern shrubsteppe
FRES34 Chaparral-mountain shrub
FRES35 Pinyon-juniper
FRES36 Mountain grasslands
FRES37 Mountain meadows
FRES38 Plains grasslands
FRES39 Prairie
FRES40 Desert grasslands
FRES41 Wet grasslands
FRES42 Annual grasslands

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Habitat: Cover Types

More info on this topic.

This species is known to occur in association with the following cover types (as classified by the Society of American Foresters):

1 Jack pine
5 Balsam fir
21 Eastern white pine
22 White pine-hemlock
23 Eastern hemlock
24 Hemlock-yellow birch
35 Paper birch-red spruce-balsam fir
37 Northern white-cedar
51 White pine-chestnut oak
63 Cottonwood
95 Black willow
107 White spruce
201 White spruce
202 White spruce-paper birch
204 Black spruce
205 Mountain hemlock
206 Engelmann spruce-subalpine fir
207 Red fir
208 Whitebark pine
209 Bristlecone pine
212 Western larch
213 Grand fir
215 Western white pine
218 Lodgepole pine
219 Limber pine
220 Rocky Mountain juniper
223 Sitka spruce
224 Western hemlock
225 Western hemlock-Sitka spruce
226 Coastal true fir-hemlock
227 Western redcedar-western hemlock
228 Western redcedar
229 Pacific Douglas-fir
230 Douglas-fir-western hemlock
231 Port-Orford-cedar
234 Douglas-fir-tanoak-Pacific madrone
237 Interior ponderosa pine
238 Western juniper
243 Sierra Nevada mixed conifer
244 Pacific ponderosa pine-Douglas-fir
245 Pacific ponderosa pine
251 White spruce-aspen
253 Black spruce-white spruce
254 Black spruce-paper birch
256 California mixed subalpine

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Cover Requirements

Nest sites appear to be selected at least partly for a wide view [22,29]
  • 22. Johnsgard, Paul A. 1990. Hawks, eagles, and falcons. Washington, DC: Smithsonian Institution Press. 403 p. [21510]
  • 29. Pasanen, Seppo; Sulkava, Seppo. 1971. On the nutritional biology of the rough-legged buzzard, Buteo lagopus lagopus Brunn., in Finnish Lapland. Aquilo Seria Zoologica. 12: 53-63. [28326]

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Rough-legged hawks inhabit open country and agricultural lands. They are more common in open, early successional areas in which they can soar and seek prey in grasslands and shrublands. Once migration is complete they settle in a suitable nesting spot with enough food nearby to sustain them. Their nests are usually located in trees or on a rocky cliff in which they can overlook a field to catch prey for themselves and their young.

Habitat Regions: temperate ; terrestrial

Terrestrial Biomes: savanna or grassland ; forest ; scrub forest ; mountains

Other Habitat Features: suburban ; agricultural ; riparian

  • Terres, J. 1980. Rough-Legged hawk. Pp. 485 in The Audubon Society Encyclopedia of North American Birds, Vol. 1, 1 Edition. New York: Alfred K. Terres.
  • Bechard, M., T. Swem. 2002. Rough-legged Hawk; Buteo lagopus. The Birds of North America, 641: 1-31.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Depth range based on 1 specimen in 1 taxon.

Environmental ranges
  Depth range (m): 0 - 0
 
Note: this information has not been validated. Check this *note*. Your feedback is most welcome.

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Migration

Non-Migrant: No. All populations of this species make significant seasonal migrations.

Locally Migrant: No. No populations of this species make local extended movements (generally less than 200 km) at particular times of the year (e.g., to breeding or wintering grounds, to hibernation sites).

Locally Migrant: Yes. At least some populations of this species make annual migrations of over 200 km.

Migrates north from wintering grounds in U.S. March-May; arrives in northern breeding areas in Beaufort Sea area by late April-early May. Southward migration occurs in fall, arriving in the U.S. mostly in September-October; present in southern winter range mostly November-February (Palmer 1988).

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Trophic Strategy

Comments: Feeds primarily on microtine rodents and other small mammals (lemmings, mice, ground squirrels, cottontails, etc., including carrion); also eats small birds and game birds, in addition to some insects. Hunts in the air, captures most food on the ground.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Food Habits

More info for the term: tree

During the breeding season, the rough-legged hawk preys primarily on
microtine rodents (Microtus and Peromyscus spp.), brown lemming (Lemmus
sibericus), Nelson's collared lemming (Dicrostonyx groenlandicus),
tundra vole (M. oeconomus), singing vole (M. miurus), northern
red-backed vole (Cleithrionomys rutilis), and other small mammals [4].
Lemmings may comprise 80 to 85 percent of the summer diet [28]. In the
Northwest Territories brown lemmings comprised 83 percent of
rough-legged hawk summer diet, with lesser amounts of collared lemming
and arctic ground squirrel (Spermophilus parryi) [37], and
occassionally, Alaska hare (Lepus othus) [28]. Other food items include
insects and carrion [12]. Rough-legged hawks have been observed
consuming ringed seal (Phoca hispida) and caribou (Rangifer tarandus)
carcasses [39]. Springer reported that up to 30 percent of breeding
season diet in Alaska was avian prey, and consisted mostly of fledgling
passerines, ptarmigan (Lagopus spp.), and occasionally lesser
golden-plover (Pluvialis dominica) [33]. Palmer and Mindell [28]
reported that avian prey of rough-legged hawks in Alaska included grouse
(probably spruce grouse [Dendrapagus canadensis]) chicks, shorebirds,
lesser golden-plover, red-necked phalarope (Phalaropus lobatus),
whimbrel (Numenius phaeopus) chicks and juveniles, and other small birds
such as wagtail (Motacilla spp.), American tree sparrow (Spizella
arborea), Lapland longspur (Calcarius lapponicus), and snow bunting
(Plectrophenax nivalis) [28].

Winter diet is almost exclusively small mammals [4]. Palmer and Mindell
[28] estimated that voles comprise up to 80 or 90 percent of the winter
diet of rough-legged hawks, but occasionally birds as large as
ring-necked pheasant (Phasianus colchicus) and gray partridge (Perdix
perdix) may be taken [22]. On occasion weasels (Mustela spp.), ground
squirrels (Spermophilus spp.), rats (Rattus spp.), house mouse (Mus
musculus), and shrews (Crystotis, Sorex, and Blarina spp.) are eaten
[28]. In Iowa, wintering rough-legged hawks consumed meadow vole
(Microtus pennsylvanicus), western harvest mouse (Reithrodontomys
megalotis), and occasionally eastern cottontail (Silvilagus floridanus).
At another site in Iowa, deer mouse (Peromyscus maniculatus) and house
mouse were important in winter diets [37]. Wintering rough-legged hawks
have been observed fishing, and are also known to take frogs [28,37]. A
rough-legged hawk was observed stealing prey from a northern harrier
(Circus cyaneus), and rough-legged hawks were observed with other
raptors as prey, including sharp-shinned hawk [Accipiter striatus]) [28]
and short-eared owl (Asio flammeus) [27].

Hunting Style: Much hunting is done from perches, including relatively
low sites such as fenceposts, poles, and even slightly elevated sites
such as rocks or mounds [22]. The rough-legged hawk frequently hovers
over one spot at an altitude of 50 to 132 feet (15-40 m) [28]. There is
also an appreciable amount of low-altitude flap and glide hunting for
mice; a rough-legged hawk often will quarter back and forth over open
fields [28,34].
  • 4. Balda, Russell P.; Masters, Nancy. 1980. Avian communities in the pinyon-juniper woodland: a descriptive analysis. In: DeGraaf, Richard M., technical coordinator. Management of western forests and grasslands for nongame birds: Workshop proceedings; 1980 February 11-14; Salt Lake City, UT. Gen. Tech. Rep. INT-86. Ogden, UT: U.S. Department of Agriculture, Forest Service, Intermountain Forest and Range Experiment Station: 146-169. [17903]
  • 12. Ehrlich, Paul R.; Dobkin, David S.; Wheye, Darryl. 1988. The birder's handbook: a field guide to the natural history of North American birds. New York: Simon & Schuster, Inc. 785 p. [21559]
  • 22. Johnsgard, Paul A. 1990. Hawks, eagles, and falcons. Washington, DC: Smithsonian Institution Press. 403 p. [21510]
  • 27. Maxson, Stephen J.; Herr, Andrea M. 1990. Rough-legged hawk preys on short-eared owl. Loon. 62(2): 108. [22378]
  • 28. Palmer, Ralph S., ed. 1988. Handbook of North American birds. New Haven, CT: Yale University Press. 5 volumes. [23780]
  • 33. Springer, Alan M. 1975. Observations on the summer diet of rough-legged hawks from Alaska. The Condor. 77: 338-339. [24592]
  • 34. Terres, John K. 1980. The Audubon Society encyclopedia of North American birds. New York: Alfred A. Knopf. 1109 p. [16195]
  • 37. Zarn, Mark. 1975. Rough-legged hawk (Buteo lagopus sanctijohannis): Habitat management series for unique or endangered species: Report No. 14. Technical Note T-N-270. Denver, CO: U.S. Department of the Interior, Bureau of Land Management. 23 p. [24516]
  • 39. Smith, Thomas G. 1975. Rough-legged hawks, Buteo lagopus (Pontoppidan) as carrion feeders in the Arctic. Canadian Field-Naturalist. 89: 190. [24515]

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Food Habits

Rough-legged hawks are swift hunters than spot and capture prey with great precison. Rough-legged hawks will perch high in trees or soar in the sky where they can scan a field or grassy area for small prey. After the prey have been spotted, hawks take flight as quietly as possible (unless already in flight) and circle above a few times to ensure there is no competition with other birds of prey. They dive and spear prey with their large talons. They return to a perch to consume the meal. Typical prey include mice, shrews, black tailed prairie dogs Cynomys ludovicianus, small birds, and other squirrel species (Spermophilus and Tamias).

Animal Foods: birds; mammals; reptiles

Primary Diet: carnivore (Eats terrestrial vertebrates)

  • Seery, D., D. Matiatos. 2000. Response of wintering buteos to plague epizootics in prairie dogs. Western North American Naturalist, 60: 420-425.
  • Reid, D., C. Krebs, A. Kenney. 1997. Patterns of Predation on Noncyclic Lemmings. Ecological Monographs, 67: 89-108.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Associations

Predators

More info for the term: natural

Rough-legged hawks have few natural enemies. Terrestrial predators
include arctic fox (Alopex lagopus) and red fox (Vulpes vulpes), but
nests are usually so inaccessible and so well guarded as to preclude
much nest predation by foxes. Gray wolves (Canis lupus) and golden eagles
(Aquila chrysaetos) have been observed eating young rough-legged hawks
in nests in Alaska [37].
  • 37. Zarn, Mark. 1975. Rough-legged hawk (Buteo lagopus sanctijohannis): Habitat management series for unique or endangered species: Report No. 14. Technical Note T-N-270. Denver, CO: U.S. Department of the Interior, Bureau of Land Management. 23 p. [24516]

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Ecosystem Roles

Rough-legged hawks help to control the populations of small mammals. Their nests are usually built where there is high prey density.

These hawks are hosts to many parasites, including several nematodes in the genus Physaloptera. A hematozoan documented in this species is a Leucocytozoon species.

Commensal/Parasitic Species:

  • Morgan, B. 1943. The Physalopterinae (Nematoda) of Aves. Transactions of the American Microscopical Society, 62/1: 72-80.
  • Stabler, R., P. Holt. 1965. Hematozoa from Colorado Birds. II. Falconiformes and Strigiformes. The Journal of Parasitology, 51/6: 927-928.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Predation

Their are many known predators of Buteo lagopus but most are predators of nestlings. Humans cause death in many rough-legged hawks by shooting, trapping, hitting them with cars, and building structures that the hawks fly into. Known predators of Buteo lagopus also include artic foxes (Vulpes lagopus), grizzly bears (Ursus arctos), and many other species of birds of prey. Most adult hawks are killed by these predators while trying to scare them away from their nests but artic foxes and other hawks are known to get into the nest and eat the eggs or nestlings.

Known Predators:

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Known prey organisms

Buteo lagopus preys on:
Dicrostonyx
Lagopus
Limicolae
Anseres
Microtus
Arvicola
Mustela nivalis
Spermophilus washingtoni
Microtus xanthognathus
Clethrionomys glareolus

Based on studies in:
Russia (Tundra)

This list may not be complete but is based on published studies.
  • V. I. Osmolovskaya, Geographical distribution of raptors in Kazakhstan plains and their importance for pest control, Tr. Acad. Sci. USSR Inst. Geogr. 41:5-77 (1948). (In Russian.)
  • T. Dunaeva and V. Kucheruk, Material on the ecology of the terrestrial vertebrates of the tundra of south Yamal, Bull. Soc. Nat. Moscou (N.S., Zool. Sect.) 4(19):1-80 (1941).
  • Myers, P., R. Espinosa, C. S. Parr, T. Jones, G. S. Hammond, and T. A. Dewey. 2006. The Animal Diversity Web (online). Accessed February 16, 2011 at http://animaldiversity.org. http://www.animaldiversity.org
Creative Commons Attribution 3.0 (CC BY 3.0)

© SPIRE project

Source: SPIRE

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

General Ecology

Productivity fluctuates greatly in relation to prey density. Winter territory encompasses about 10-16 sq km (Zarn 1974); may aggregate and roost in groups where food is abundant. Nesting territory probably as small as 5-6 sq km when prey density high (Palmer 1988).

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Habitat-related Fire Effects

More info for the terms: density, fire exclusion, fire frequency, fire intensity, frequency, prescribed fire, shrub

There has only been one review of the relationship between raptor
habitat and fire and no specific information was available for
rough-legged hawk [36].

Fire Effects on Prey Species: Fire usually causes temporary declines in
populations. Vegetation recovery after fire usually increases available
vegetative biomass. Small mammal population declines are compensated
for in 1 or 2 years [23]. In a study of the effects of vegetation
manipulation on small mammal populations, Cornely and others [9]
compared burned plots to untreated plots and plots that had been mowed.
Montane vole (Microtus montanus) populations were low immediately
following a November 1978 prescribed fire, but were higher than any
other treatments on burned plots in January 1980. Immediately after
burning, rodent populations were lower on burned plots than on untreated
plots [9].

Open habitats that are frequented by rough-legged hawks and dependent on
fire include grassland, semidesert grass-shrub, and sagebrush (Artemisia
spp.)-grassland. Grasslands are maintained by frequent fire (1- to
10-year average fire return intervals). Fire exclusion in the deciduous
forest-prairie ecotone has reduced available rough-legged hawk winter
habitat. Increased shrub densities have occurred in the last 80 years
in semidesert grass-shrub habitats. These habitats typically have
average fire-free intervals of 10 years; the causal mechanism for the
increase in shrub density is not well understood; primary causes are
probably increased grazing, and increased fire intensity and frequency due
to fire exclusion and cheatgrass (Bromus tectorum) invasion.
Sagebrush-grass habitats, with fire-free intervals ranging from 20 to
100 years, have also been altered by cheatgrass invasion which probably
has increased fire frequency [26].
  • 9. Cornely, J. E.; Britton, C. M.; Sneva, F. A. 1983. Manipulation of flood meadow vegetation and observations on small mammal populations. Prairie Naturalist. 15: 16-22. [14509]
  • 23. Kayll, A. J. 1968. The role of fire in the boreal forest of Canada. Information Report PS-X-7. Chalk River, ON: Department of Forestry and Rural Development of Canada, Petawawa Forest Experiment Station. 15 p. [24962]
  • 26. Lehman, Robert N.; Allendorf, John W. 1989. The effects of fire, fire exclusion and fire management on raptor habitats in the western United States. In: Proceedings of the western raptor management symposium and workshop; 1987 October 26-28; Boise, ID. Scientific and Technical Series No. 12. Washington, DC: National Wildlife Federation: 236-244. [22324]
  • 36. White, Clayton M. 1994. Population trends and current status of selected western raptors. Studies in Avian Biology. 15: 161-172. [24512]

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Timing of Major Life History Events

Breeding: Age at first breeding is 2 to 3 years [22]. Rough-legged
form pair bonds that are maintained for at least the duration of the
breeding season and possibly longer. There is some evidence that pair
bonding occurs in wintering areas; birds roost and perch in twos and
sometimes migrate in twos [28]. After the loss of a mate, a new mate is
usually acquired fairly rapidly [22]. There is usually only one brood
per season [12].

Spring Migration: Rough-legged hawks travel in loose flocks; up to 10
birds may be seen at a time, though hundreds might pass a hawk station
in a day. Rough-legged hawks are not averse to crossing wide bodies of
water, which is unusual for a buteo. They migrate across boreal forest
to find open country [28]. In the western part of rough-legged hawk
range, spring migration begins in late March or early April, with the
largest flights in late April. Breeding pairs arrive on the breeding
grounds in late April to early May [37]. In the eastern part of its
range, rough-legged hawk migration occurs from early March to late April
or the first week of May; the peak period is in late March [20].

Nest: The nest is constructed of sticks, bones, other debris, weeds,
and grass, and is lined with grass, down, feathers, and the fur of prey
animals [12]. Nests tend to be larger in areas where more sticks are
available. Typical nests range in size from 24 to 30 inches (61-76 cm)
across and 20 to 22 inches (50-55 cm) deep [37]. Nests are used
repeatedly and become larger as new material is added [22].

Clutch: Eggs have been observed in rough-legged hawk nests from May to
June, sometimes as late as July [34]. Earliest egg dates were May 2 in
Labrador and May 18 in arctic Canada and Alaska. Latest egg dates were
June 23 in Labrador and July 13 in arctic Canada and Alaska [28]. In
captivity eggs are laid at 2-day intervals; on average, clutches of five
eggs take 10 days to lay [22]. Clutch size is variable and ranges from
two to seven eggs; clutches are smaller when prey is scarce [12].
Clutches of five to seven eggs are common in good lemming (Lemmus and
Dicrostonyx spp.) years; clutches of two or three eggs are more common
in poor lemming years [22].

Incubation: Eggs are incubated for 28 to 31 days, mostly by the female.
The male feeds her, guards the nest, and incubates the eggs for only
short periods [28,37]. Eggs hatch asynchronously [12].

Development of Young: Rough-legged hawk chicks are semialtricial; at
hatching they are immobile and downy with eyes open. They are fed by
both parents. Age of first flight is usually between 36 and 40 days
[12]. Most rough-legged hawk young leave the nest in early July to
mid-August at approximately 6 weeks of age but continue to depend on the
parents for food for a short period thereafter [37]. Dependence on the
parents for food sometimes extends to fall migration [28].

Fall Migration: There is usually no large and distinct peak for
autumnal rough-legged hawk flights as there is in the spring [20]. At a
hawk-watching station on the shore of Lake Superior, peak flights of
migrating rough-legged hawks occurred from October 13 through the 31st.
The rough-legged hawk arrives in wintering areas in September and
October, and is settled from November through March [22].

Longevity: The average life span of the rough-legged hawk is 20.7
months [28]. Rough-legged hawks have been reported as old as 6 years 9
months [34] and 18 years 1 month [28].

Population Fluctuations: There are wide fluctuations in local winter
populations of rough-legged hawk in the southwestern United States [4].
Localized nonseasonal migrations of rough-legged hawk occur when prey
populations crash in usual breeding areas and the hawks move to areas of
more abundant prey [12].

Diurnal Patterns in Winter: Most rough-legged hawks are active during
sunlight hours and retire to night perches by 4:30 p.m. [28]. Peak
activity is usually observed during periods of high wind velocity, clear
sky, rising air pressure, low relative humidity and high temperature [37].

Diurnal Patterns in Summer: In Finland, rough-legged buzzards were
observed active by 4 a.m. in June and July. They remained active
throughout the day until 8 p.m. (sometimes as late as 10 p.m.) [29].
Rough-legged hawks have occasionally been observed hunting between 12 a.m.
and 3 a.m. in arctic Alaska [37].
  • 4. Balda, Russell P.; Masters, Nancy. 1980. Avian communities in the pinyon-juniper woodland: a descriptive analysis. In: DeGraaf, Richard M., technical coordinator. Management of western forests and grasslands for nongame birds: Workshop proceedings; 1980 February 11-14; Salt Lake City, UT. Gen. Tech. Rep. INT-86. Ogden, UT: U.S. Department of Agriculture, Forest Service, Intermountain Forest and Range Experiment Station: 146-169. [17903]
  • 12. Ehrlich, Paul R.; Dobkin, David S.; Wheye, Darryl. 1988. The birder's handbook: a field guide to the natural history of North American birds. New York: Simon & Schuster, Inc. 785 p. [21559]
  • 20. Heintzelman, Donald S. 1979. Guide to hawk watching in North America. University Park, PA: The Pennsylvania State University Press. 284 p. [24546]
  • 22. Johnsgard, Paul A. 1990. Hawks, eagles, and falcons. Washington, DC: Smithsonian Institution Press. 403 p. [21510]
  • 28. Palmer, Ralph S., ed. 1988. Handbook of North American birds. New Haven, CT: Yale University Press. 5 volumes. [23780]
  • 29. Pasanen, Seppo; Sulkava, Seppo. 1971. On the nutritional biology of the rough-legged buzzard, Buteo lagopus lagopus Brunn., in Finnish Lapland. Aquilo Seria Zoologica. 12: 53-63. [28326]
  • 34. Terres, John K. 1980. The Audubon Society encyclopedia of North American birds. New York: Alfred A. Knopf. 1109 p. [16195]
  • 37. Zarn, Mark. 1975. Rough-legged hawk (Buteo lagopus sanctijohannis): Habitat management series for unique or endangered species: Report No. 14. Technical Note T-N-270. Denver, CO: U.S. Department of the Interior, Bureau of Land Management. 23 p. [24516]

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Life History and Behavior

Behavior

Communication and Perception

Rough-legged hawks use sight and vocalizations to communicate with others. They use many calls for communication with other hawks such as a warning call (a high pitch shriek), a courtship call (a low whistle that turns into a hiss), and a "normal" call (a high-pitched whistle into a shriek). Rough-legged hawks are usually silent when away from the breeding site except when in competition with another male or threatened. Males may broadcast 100 calls per minute; much more often than females.

Communication Channels: visual ; acoustic

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Cyclicity

Comments: Hunting crepuscular to considerable extent (Palmer 1988).

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Life Expectancy

Lifespan/Longevity

Rough-legged hawks can live up to 18 years in the wild. However, the average life span is about 2 years, largely because most young birds do not survive. Once they survive their fledging stage and first year, rough-legged hawk annual survival improves. Deaths often result from illegal shooting or trapping activites, collisions with human structures, such as powerlines or radio towers, and collisions with vehicles. In captivity, the longest living reported rough-legged hawk was 17 years old. However, a rough-legged hawk at the Pocatello Zoo, in Idaho, came in as an injured adult in 1987 and remains alive as of July 2009, making her over 24 years old.

Range lifespan

Status: wild:
18 (high) years.

Range lifespan

Status: captivity:
24 (high) years.

Average lifespan

Status: wild:
1.7 years.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Lifespan, longevity, and ageing

Maximum longevity: 18.8 years (wild) Observations: The average longevity of these animals does not exceed 2 years (http://www.fs.fed.us/database/feis/).
Creative Commons Attribution 3.0 (CC BY 3.0)

© Joao Pedro de Magalhaes

Source: AnAge

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Reproduction

Egg dates: May-June in Labrador; May-July (peak in May or June in various areas in Alaska and arctic Canada. Average hatching date in southwestern Alaska: mid-June; mid-July in northern Yukon. Clutch size is 2-7, largest when lemmings are abundant). Incubation, mainly by female, lasts 28-31 days. Young are tended by both parents, fly well at about 5-6 weeks; some may be independent a month or less after attaining flight (Palmer 1988). First breeds probably at 2 years. Number of breeding pairs and/or breeding success usually increase with lemming/vole abundance.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Buteo lagopus will usually migrate solo (very uncommon to fly in groups) and find a mate once they have reached their destination. Males will soar and circle until a female joins them. Rough-legged hawks perform courtship displays in the late winter, once it has began to get warmer and flying conditions improve. After a male is joined by a female, both sexes soar together with their tails and wings fully spread. Males then perform a "Sky-Dance" dislay, in which they soar high, suddenly dive, climb again, free fall, and finally, climb back up to a normal soaring height. Male rough-legged hawks defend their mates from other males by taking flight and chasing rival males.

Male and female rough-legged hawks build a nest together after they have found a suitable site on a rocky cliff. Males carry most of the building supplies while females construct the nest of twigs, grass, molted feathers, and fur from prey. Even objects such as caribou bones are sometimes incorporated into nests. Nests take three to four weeks to build and are usually 60 to 90 cm in diameter and 25 to 60 cm deep.

Mating System: monogamous

Rough-legged hawks breed once a year, usually between April and June, but breeding has also been reported in July. There are 2 to 7 eggs per clutch and they take a minimum of 31 days to hatch. Fledging usually takes more than 40 days, although some fly weakly at 31 days old. The young are not fully independent of the parents until 2 to 4 weeks after they leave the nest, at 55 to 70 days old. The period of independence sometimes extends into migration. Sexual maturity of males and females is reached at 2 to 3 years.

Breeding interval: Breeding occurs once a year.

Breeding season: Breeding typicalls occurs from April to June, occasionally July.

Range eggs per season: 2 to 7.

Average eggs per season: 4.

Range time to hatching: 31 (low) days.

Range fledging age: 31 (low) days.

Average fledging age: 40 days.

Range time to independence: 55 to 70 days.

Range age at sexual or reproductive maturity (female): 2 to 3 years.

Range age at sexual or reproductive maturity (male): 2 to 3 years.

Key Reproductive Features: seasonal breeding ; gonochoric/gonochoristic/dioecious (sexes separate); fertilization

Both male and female Buteo lagopus provide for and protect their young from the time the eggs are laid until the young hawks are independent (55 to 70 days post-hatching). After the eggs are laid, the female will incubate them, while the male will hunt for food for both parents. The male will continue to hunt for both adults until the young hatch. Once the young have hatched, the female will begin to hunt to ensure that there will be enough food for both the young and the adults. Both parents will also guard the nest and ward off other birds and predators.

Parental Investment: altricial ; pre-fertilization (Provisioning, Protecting: Female); pre-hatching/birth (Provisioning: Female, Protecting: Male, Female); pre-weaning/fledging (Provisioning: Male, Female, Protecting: Male, Female); pre-independence (Provisioning: Male, Female, Protecting: Male, Female)

  • Smith, C. 1987. Parental roles and nestling foods in the rough-legged hawk, Buteo lagopus. ONT. FIELD-NAT, 101: 101-103.
  • Terres, J. 1980. Rough-Legged hawk. Pp. 485 in The Audubon Society Encyclopedia of North American Birds, Vol. 1, 1 Edition. New York: Alfred K. Terres.
  • Bechard, M., T. Swem. 2002. Rough-legged Hawk; Buteo lagopus. The Birds of North America, 641: 1-31.
  • Morneau, 1994. Breeding density and brood size of rough-legged hawks in northwestern Quebec. The Journal of Raptor Research, 28/4: 259-262.
  • Pearson, T., J. Burroughs, E. Forbush, W. Finley, G. Gladden, H. Job, L. Nichols, J. Burdick. 1936. Rough-legged Hawk. Pp. 79-80 in Birds of America, Vol. 1-3, 12 Edition. Garden City, New York: Garden City Publishing Company, Inc..
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Statistics of barcoding coverage: Buteo lagopus

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 6
Specimens with Barcodes: 8
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Barcode data: Buteo lagopus

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There are 6 barcode sequences available from BOLD and GenBank.  Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.  See the BOLD taxonomy browser for more complete information about this specimen and other sequences.

TTTTCTCCAACCACAAAGACATTGGCACCCTATACCTAATCTTCGGTGCCTGAGCCGGTATAGTCGGCACCGCCCTCAGCCTACTTATTCGTGCAGAACTCGGCCAACCAGGTACACTCCTAGGTGACGACCAGATCTACAACGTAATCGTTACCGCACATGCCTTCGTAATAATTTTCTTTATAGTTATACCAATTATGATCGGAGGCTTCGGAAACTGACTTGTTCCACTCATAATCGGCGCCCCCGATATAGCCTTCCCACGCATAAACAACATAAGCTTCTGACTACTTCCTCCATCCTTCCTCCTTCTCCTAGCCTCCTCAACAGTAGAAGCAGGAGCCGGCACTGGATGAACTGTCTATCCCCCACTAGCTGGCAACATAGCCCATGCCGGAGCTTCAGTAGACCTAGCCATCTTCTCCCTACACTTAGCCGGAGTCTCGTCCATTCTAGGAGCAATCAACTTTATCACAACCGCCATCAACATAAAGCCCCCAGCCCTCTCCCAGTACCAAACACCCCTATTCGTATGATCTGTCCTCATTACCGCTGTCCTTCTACTACTCTCACTTCCAGTCCTAGCCGCCGGCATTACCATACTACTTACAGACCGAAACCTAAACACAACATTCTTTGACCCCGCCGGCGGAGGTGATCCCATCCTATACCAACATCTCTTCTGATTCTTCGGGCACCCAGAAGTTTACATCCTAATCCTGCCAGGATTTGGAATTATCTCC
-- end --

Download FASTA File
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Conservation

Conservation Status

National NatureServe Conservation Status

Canada

Rounded National Status Rank: N5B,N5N : N5B: Secure - Breeding, N5N: Secure - Nonbreeding

United States

Rounded National Status Rank: N5B,N5N : N5B: Secure - Breeding, N5N: Secure - Nonbreeding

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

NatureServe Conservation Status

Rounded Global Status Rank: G5 - Secure

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

IUCN Red List Assessment


Red List Category
LC
Least Concern

Red List Criteria

Version
3.1

Year Assessed
2013

Assessor/s
BirdLife International

Reviewer/s
Butchart, S.

Contributor/s

Justification
This species has an extremely large range, and hence does not approach the thresholds for Vulnerable under the range size criterion (Extent of Occurrence <20,000 km2 combined with a declining or fluctuating range size, habitat extent/quality, or population size and a small number of locations or severe fragmentation). The population trend appears to be stable, and hence the species does not approach the thresholds for Vulnerable under the population trend criterion (>30% decline over ten years or three generations). The population size is very large, and hence does not approach the thresholds for Vulnerable under the population size criterion (<10,000 mature individuals with a continuing decline estimated to be >10% in ten years or three generations, or with a specified population structure). For these reasons the species is evaluated as Least Concern.

History
  • 2012
    Least Concern
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Buteo lagopus is rated as "Least Concern" on the IUCN Red List. Protected under the U.S. Migratory Bird Act, these birds cannot be hunted or killed except for scientific purposes.

US Migratory Bird Act: protected

US Federal List: no special status

CITES: no special status

State of Michigan List: no special status

IUCN Red List of Threatened Species: least concern

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Population

Population
The global population is estimated to number > c.500,000 individuals (Rich et al. 2004), while national population sizes have been estimated at < c.1,000 wintering individuals in Korea and c.100-10,000 breeding pairs in Russia (Brazil 2009).

Population Trend
Stable
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Management

Management Considerations

More info for the terms: cover, density, presence

The rough-legged hawk is one of North America's most abundant raptors
[12]. Although no historical data on rough-legged hawk populations are
available, it is probable that the rough-legged hawk is currently stable
in North America [36]. White and Cade [38] assert that rough-legged
hawks are probably stable as a breeding population in Alaska, except
where oil and gas drilling sites, roads, pipeline development, and other
installations destroy nest habitat. The estimated North American winter
population of rough-legged hawks was 49,600 based on 1986 Christmas bird
count data [12]. The maximum winter densities of rough-legged hawk
occurred in Montana and Idaho, with estimated state populations of 5,250
and 3,650 birds, respectively [22]. Several studies on the abundance of
rough-legged hawks are available [3,6,15]. Conservation and management
of the rough-legged hawk depends on factors affecting habitat in Canada
and the United States [7].

Population sizes and local abundance of rough-legged hawk are strongly
influenced by local prey populations [22]. Local rough-legged hawk
populations have been observed to increase and decrease with rodent prey
availability; local population size is apparently a function of hawk
movement to areas with abundant prey (rather than an absolute increase
or decrease). For example, on the Seward Peninsula, there were 35
nesting pairs of rough-legged hawks in 1968, 43 pairs in 1969, and 82
pairs in 1970; however, only 10 pairs were found and two young fledged
in 1971 following a severe autumn in 1970 which held microtine
populations low. In 1972, there were 44 nesting pairs [37]. In Norway
high density of breeding pairs of rough-legged buzzards corresponded
with high density of voles [19]. Palmer and Mindell [28], however,
asserted that fluctuations in vole populations probably influence but
are not the sole cause of rough-legged hawk population fluctuations
since rough-legged hawks shift to other prey when voles are scarce. The
degree to which rough-legged hawk breeding success is independent of
vole population is related to the availability and use of alternate prey
[28]. Microtine rodent population fluctuations appear to be random
rather than cycling at 4-year or 10-year intervals, as has been
previously asserted, which further complicates understanding of the
relationship of rough-legged hawk populations to prey populations [18].
In Finland rough-legged buzzard nesting density was reported to be
independent of small mammal stocks; good nesting success occurred even
in poor vole years [29]. Winter rough-legged hawk populations are often
concentrated in areas of high prey density [37].

At a hawk migration station on Lake Superior, rough-legged hawks were
the most numerous raptor observed in 1979, even though 1979 was probably
a low population year for rough-legged hawks [13]. Migration counts of
rough-legged hawks at Bake Oven Knob, Pennsylvania, were variable,
increasing and decreasing in what appeared to be 3- to 5-year cycles.
Cycles were also reported for migration counts at Hawk Mountain, Maine
[21]. In New Jersey wintering population densities of rough-legged
hawks varied widely between years but showed no obvious upward or
downward trend [7].

Rough-legged hawks banded in California bred in several locations, from
Alaska to Banks Island in the Northwest Territories. Encounters with
banded rough-legged hawks suggest that rough-legged hawks from the
western part of the breeding range migrate to the western parts of the
winter range. Rough-legged hawks also show strong fidelity to the same
winter area in subsequent years; this suggests that the loss of
wintering habitat to residential development could be detrimental to
rough-legged hawk populations [16]. Wintering concentrations of
rough-legged hawks in the Great Plains and the Intermountain West were
correlated primarily with climate and the presence of protected areas
such as wildlife refuges.

The rough-legged hawk is most common in the Great Basin and the Northern
Great Plains. Winter populations are high in Montana, northern Oregon,
southern Washington, and northeastern Maine north to Newfoundland [30].
A drive-by survey in southeastern Idaho revealed that rough-legged hawks
were the most abundant raptor, appearing most often on agricultural land
[10]. Wintering rough-legged hawks are widely distributed throughout
New Jersey, but appear to prefer coastal areas. Abundance in New Jersey
was significantly correlated (p < 0.002) with wetlands; rough-legged
hawks also appear to avoid areas with snow cover [7].

Mortality Factors: The rough-legged hawk is often relatively
unsuspicious of human approach. Prior to their legal protection,
rough-legged hawks were shot in large numbers in wintering areas of the
United States or were caught in pole traps. In Utah large numbers of
migrant rough-legged hawks were reported killed by cars while feeding on
road-killed jackrabbits (Lepus spp.) [35,37]. In 1967 mortality from
dieldrin poisoning was documented in rough-legged buzzards in Britain.
Consumption of only a few animals that had eaten dieldrin-treated grain
was sufficient to kill the hawks [37].

REFERENCES :
NO-ENTRY
  • 3. Andersen, D. E.; Rongstad, O. J.; Mytton, W. R. 1985. Line transect analysis of raptor abundance along roads. Wildlife Society Bulletin. 13(4): 533-539. [24591]
  • 6. Bildstein, Keith Louis. 1978. Behavioral ecology of red-tailed hawks (Buteo jamaicensis), rough-legged hawks (B. lagopus), and northern harriers (Circus cyaneus). Columbus, OH: Ohio State University. 364 p. Dissertation. [24993]
  • 7. Bosakowski, Thomas; Smith, Dwight G. 1992. Demography of wintering rough-legged hawks in New Jersey. Journal of Raptor Research. 26(2): 61-65. [24445]
  • 10. Craig, Timothy H. 1978. A car survey of raptors in southeastern Idaho 1974-1976. Raptor Research. 12(1/2): 40-45. [24444]
  • 12. Ehrlich, Paul R.; Dobkin, David S.; Wheye, Darryl. 1988. The birder's handbook: a field guide to the natural history of North American birds. New York: Simon & Schuster, Inc. 785 p. [21559]
  • 15. Li, X. J.; Burton, P. J.; Leadem, C. L. 1994. Interactive effects of light and stratification on the germination of some British Columbia conifers. Canadian Journal of Botany. 72: 1635-1646. [24594]
  • 16. Garrison, Barrett A.; Bloom, Peter H. 1993. Natal origins and winter site fidelity of rough-legged hawks wintering in California. Journal of Raptor Research. 27(2): 116-118. [24961]
  • 18. Garsd, Armando; Howard, Walter E. 1981. A 19-year study of microtine population fluctuations using time-series analysis. Ecology. 62(4): 930-937. [24593]
  • 19. Hagen, Yngvar. 1969. Norwegian studies on the reproduction of birds of prey and owls in relation to micro-rodent population fluctuations. Fauna. 22: 73-126. [24960]
  • 21. Heintzelman, Donald S. 1986. The migration of hawks. Bloomington, IN: Indiana University Press. 369 p. [24447]
  • 22. Johnsgard, Paul A. 1990. Hawks, eagles, and falcons. Washington, DC: Smithsonian Institution Press. 403 p. [21510]
  • 28. Palmer, Ralph S., ed. 1988. Handbook of North American birds. New Haven, CT: Yale University Press. 5 volumes. [23780]
  • 29. Pasanen, Seppo; Sulkava, Seppo. 1971. On the nutritional biology of the rough-legged buzzard, Buteo lagopus lagopus Brunn., in Finnish Lapland. Aquilo Seria Zoologica. 12: 53-63. [28326]
  • 30. Root, Terry. 1988. Atlas of wintering North American birds. Chicago: University of Chicago Press. 312 p. [24443]
  • 35. White, Clayton M. 1969. Population trends in Utah raptors. In: Hickey, Joseph J., ed. Peregrine falcon populations: the biology and decline. Madison, WI: University of Wisconsin Press: 596. [24446]
  • 36. White, Clayton M. 1994. Population trends and current status of selected western raptors. Studies in Avian Biology. 15: 161-172. [24512]
  • 37. Zarn, Mark. 1975. Rough-legged hawk (Buteo lagopus sanctijohannis): Habitat management series for unique or endangered species: Report No. 14. Technical Note T-N-270. Denver, CO: U.S. Department of the Interior, Bureau of Land Management. 23 p. [24516]
  • 38. White, Clayton M.; Cade, Tom J. 1971. Cliff-nesting raptors and ravens along the Colville River in arctic Alaska. Living Bird. 10: 107-150. [24513]
  • 13. Escott, Nicholas G. 1985. Fall migration of the rough-legged hawk at Marathon, Ontario. In: Harwood, Michael, ed. Proceedings of the hawk migration conference: IV; [Date of conference unknown]; [Location of conference unknown]. [Place of publication unknown]: Hawk Migration Association: 27-39. On file with: U.S. Department of Agriculture, Forest Service, Intermountain Research Station, Fire Sciences Laboratory, Missoula, MT. [24584]

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Relevance to Humans and Ecosystems

Benefits

Economic Importance for Humans: Negative

There are no known adverse effects of Buteo lagopus on humans.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Economic Importance for Humans: Positive

Buteo lagopus helps control pest (mice, moles, rats) populations through predation.

Positive Impacts: controls pest population

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Wikipedia

Rough-legged buzzard

The tail is white with a dark terminal band.
The feet are feathered.

The rough-legged buzzard (Buteo lagopus), also called the rough-legged hawk is a medium-large bird of prey. It is found in Arctic and Subarctic regions of North America and Eurasia during the breeding season and migrates south for the winter.[2] It was traditionally also known as the rough-legged falcon[3] in such works as John James Audubon's The Birds of America.

Nests are typically located on cliffs, bluffs or in trees. Clutch sizes are variable with food availability but 3–5 eggs are usually laid.[4] These hawks hunt over open land, feeding primarily on small mammals.[2] Along with the kestrels, kites and osprey, this is one of the few birds of prey to hover regularly.[5]

Description[edit]

This fairly large raptorial species is 46–60 cm (18–24 in) with wingspan ranging from 120 to 153 cm (47 to 60 in).[2][6] Individuals can weigh from 600 to 1,660 g (1.32 to 3.66 lb) with females typically being larger and heavier than males.[7][8] Weights appear to increase from summer to winter in adults, going from an average of 822 to 1,027 g (1.812 to 2.264 lb) in males and from 1,080 to 1,278 g (2.381 to 2.818 lb) in females.[9][10] Among the members of the Buteo genus, it is sixth heaviest, the fifth longest, and the fourth longest winged.[11] Among standard measurements in adults, the wing chord is 37.2–48.3 cm (14.6–19.0 in), the tail is 18.6–25.5 cm (7.3–10.0 in), culmen is 3.2–4.5 cm (1.3–1.8 in) and the tarsus is 5.8–7.8 cm (2.3–3.1 in).[11][12][13] The plumage is predominantly brown in colour and often shows a high degree of speckling.[2] A wide variety of plumage patterns are exhibited in light vs. dark morphs, males vs. females and adults vs. juveniles. Extensive field experience is required to distinguish between certain plumage variations.[14] Compared to its more common cousins, the common buzzard and the red-tailed hawk, it is slightly larger, though may be outweighed by the latter.

Its feet are feathered to the toes (hence its scientific name, lagopus, meaning "hare-footed") as an adaptation to its arctic home range. Lagopus is derived from Ancient Greek lago (λαγως), meaning "hare", and pous (πους), meaning "foot".[15] Its talons are relatively small, reflecting their preferred choice of prey. A broad brown chestband is present in most plumages and a square dark carpal patch contrasting with the white under-wing is an easily identifiable characteristic in light morph individuals.[2] The species exhibits a wide variety of plumage patterns including light and dark morphs.

Distinguishing characteristics in all plumages include long white tail feathers with one or more dark subterminal bands. The wing tips are long enough to reach or extend past the tail when the animal is perched.[2] The common buzzard can be similar-looking, with a similar long-tailed shape and can be notoriously variable in plumage. The rough-legged is longer-winged and more eagle-like in appearance. The red-tailed hawk is chunkier-looking and differs in its darker head, broader, shorter wings, barring on the wings and the tail, dark leading edge to the wings (rather than black wrist patch) and has no white base to the tail. The ferruginous hawk is larger, with a bigger, more prominent bill and has a whitish comma at the wrist and all-pale tail.[16]

It is the only hawk of its size (other than the very different-looking Osprey) to regularly hover over one spot, by beating its wings quickly.

Taxonomy[edit]

The rough-legged hawk is a member of the genus Buteo, a group of moderately large raptors exhibiting broad wings, short tails and wide robust bodies.[2][17] This group is known a hawks in North America but referred to as buzzards in Europe.[2]

There are at least 3 recognized subspecies of Buteo lagopus:

  • B. l. lagopus is the nominate subspecies. It breeds in northern Europe and Asia and has relatively dark plumage. The dorsal feathers are a homogeneous brown colour, contrasting well with the paler head.[2]
  • B. l. sanctijohannis breeds in North America. It has pale, speckled dorsal plumage and is slightly smaller than B. l. lagopus.[2]
  • B. l. kamtchatkensis breeds from north Siberia to Pacific North America. It has paler plumage when compared with B. l. sanctijohannis and it is, on average, the largest of the three subspecies.[2][11]

Habitat and distribution[edit]

The rough-legged hawk breeds in tundra and taiga habitats of North America and Eurasia between the latitudes of 61 and 76° N. Rough-legged hawks occurring in North America migrate to the central United States for the winter, while Eurasian individuals migrate to southern Europe and Asia. It is the only member of its diverse genus found in both of the Northern continents and has a complete circumpolar distribution. During these winter months, from November to March, preferred habitats include marshes, prairies and agricultural regions where rodent prey is most abundant.[2]

Breeding sites are usually located in areas with plenty of unforested, open ground.[4] Depending on snow conditions, migrants arrive at breeding grounds during April and May.[2] Home ranges vary with food supply but are commonly reported to be 10–15 km2 (3.9–5.8 sq mi) during the winter, but little is known about home ranges during the breeding season.[4] Although frequently attacked in skirmishes by other highly territorial birds such as gyrfalcons and skuas, the rough-legged buzzard is not strongly territorial.[2]

Behaviour[edit]

Diet[edit]

This species is carnivorous, typically feeding on small mammals, which make up 62–98% of its diet. Lemmings and voles are the major prey items of this species, seasonally comprising up to 80–90% of their prey, but this varies with seasonal availability.[2][11][18] Some evidence suggests that these hawks may be able to see vole scent marks which are only visible in the ultraviolet range, allowing them to cue in on prey.[19] The rough-legged hawk will also supplement its diet with mice, rats, gerbils, pikas and insects.[2][18] Besides mammals, birds are the second most favored type of prey for Rough-legs. Most avian prey species are small passerines such as snow buntings, Lapland longspur and American tree sparrow. However, they will also prey on birds slightly larger than the passerines typically targeted, especially ptarmigan, as well as waterfowl, shorebirds (such as Ruffs) and short-eared owls. They usually target bird prey which are young and inexperienced, with relatively large avian prey often being snatched in their fledging stage.[11] When small mammals are scarce, the rough-legged hawk will also feed on larger, medium-sized mammals including prairie dogs, ground squirrels, muskrats and weasels. During winter, shrub-steppe habitats seem to encourage a strong dependence on rabbit prey.[2] In developed areas of England, rough-legged buzzards have been recorded preying most regularly on relatively large prey such as common wood pigeon and invasive European rabbits.[11]

This avian predator hunts opportunistically, occasionally supplementing their diet with carrion, but focusing primarily on the most locally abundant small vertebrates. Rough-legged hawks will steal prey from other individuals of the same species as well as other species such as the red-tailed hawk, Northern Harrier, American kestrel and common raven. Prey sizes typically range from 6.5–2,587 g (0.23–91.25 oz) and adults require 80–120 g (2.8–4.2 oz) of food daily.[11] These raptors hunt during the daytime.[11] Like most Buteos, rough-legged buzzards have been reported both still-hunting (watching for prey from a perch and then stooping) and watching for prey while in flight. Unlike other large raptors, they may engage in hovering flight above the ground while search for prey.[2]

Reproduction[edit]

Sexual maturity is reached at about two years old. Breeding generally occurs during May but is variable depending upon dates of arrival at breeding grounds. The rough-legged hawk is thought to be monogamous, mating with a single individual for multiple years.[2] No evidence currently suggest otherwise.

Nests are built soon after arrival to breeding grounds and require 3–4 weeks to complete. Twigs, sedges and old feathers are used as building materials. Nests are 60–90 cm (24–35 in) in diameter and 25–60 cm (9.8–23.6 in) in height.[2] Cliff ledges and rocky outcroppings are preferred nesting sites. Females can lay 1–7 eggs but will typically lay 3–5.[2][4] Average egg size is 56.4 mm (2.22 in) in length by 44.7 mm (1.76 in) in width. Minimum incubation period is 31 days, provided almost exclusively by the female. The male feeds the female during this incubation period. After hatching, young require 4–6 weeks before fledging the nest. Fledglings depend on parents to provide food for 2–4 weeks after leaving the nest.[2]

Longevity and mortality[edit]

Rough-legged buzzards that survive to adulthood can live to an age of 19 years in the wild. One female being kept in an Idaho zoo is over 25 years of age. However, perhaps a majority of individuals in the wild do not survive past their first two years of life. The threats faced by young Rough-legs can include starvation when prey is not numerous, freezing when Northern climes are particularly harsh during brooding, destruction by humans, and predation by various animals. The chances of survival increase incrementally both when they reach the fledging stage and when they can start hunting for themselves. Death of flying immatures and adults are often the result of human activity, including collisions with powerlines, buildings and vehicles, incidental ingestion of poison or lead from prey or illegal hunting and trapping.[20]

Most predation recorded on this species is on the young at the nest. Arctic foxes, brown bears and wolverines have all eaten eggs and young of this species if they are capable of accessing nests on foot. Avian scavengers, especially ravens, will also readily predate nests. Adults, being a large raptorial bird, have fewer natural predators but may die in conflicts, especially if they are defending their own nests and are occasionally predated by other large raptorial birds. Raptors who prey on rough-legged buzzards of most ages may include numerous eagles as well as large falcons, Eurasian eagle owls, great horned owls and other large Buteo hawks, including those of their own species.[20]

Vocalization[edit]

Adult rough-legged hawks will vocalize alarm calls when intruders approach a nesting site. It is described as a downward slurring whistle, sounding like kiu wiyuk or a lengthy descending kee-eer similar to that of the red-tailed hawk. This cry is given in flight or from a perch every 15–30 s. During courtship, both sexes have been recorded to give a whistling sound that changes to a hiss. Following copulation, females will give a clucklike sound and males vocalize a whistling noise. Fledglings will give begging calls while waiting for parents to provide food.[2]

References[edit]

  1. ^ BirdLife International (2013). "Buteo lagopus". IUCN Red List of Threatened Species. Version 2013.2. International Union for Conservation of Nature. Retrieved 26 November 2013. 
  2. ^ a b c d e f g h i j k l m n o p q r s t u v w Bechard, M. J. and Swem, T. R. 2002. Rough-legged Hawk (Buteo lagopus). In The birds of North America, No. 641 (A. Poole and F. Gill, eds.). The Birds of North America, Inc., Philadelphia, PA.
  3. ^ Richardson, J.; Swainson, W.; Kirby, W. (1831). Fauna Boreali-americana, Or, The Zoology of the Northern Parts of British America: The birds. J. Murray. 
  4. ^ a b c d Rough-legged Hawk. Lcvirtualwildlife.ca. Retrieved on 2011-12-18.
  5. ^ Birds of Prey. Birdofpreytrail.com. Retrieved on 2011-12-18.
  6. ^ Porter, R. F. (1990) Flight Identification of European Raptors, Third Edition. Academic Press, ISBN 978-0-85661-027-1
  7. ^ CRC Handbook of Avian Body Masses by John B. Dunning Jr. (Editor). CRC Press (1992), ISBN 978-0-8493-4258-5.
  8. ^ del Hoyo, J; Elliot, A; Sargatal, J (1996). Handbook of the Birds of the World 3. Barcelona: Lynx Edicions. ISBN 84-87334-20-2. 
  9. ^ Brown, L. and D. Amadon. 1968. Eagles, hawks and falcons of the world. Vol. 2. McGraw-Hill, New York.
  10. ^ Snyder, N. F. R. and J. W. Wiley. 1976. Sexual size dimorphism in hawks and owls of North American. Ornithology Monograph, No. 20.
  11. ^ a b c d e f g h Ferguson-Lees, J.; Christie, D. (2001). Raptors of the World. London: Christopher Helm. ISBN 0-7136-8026-1. 
  12. ^ Cade, Tom J. (1955). "Variation of the Common Rough-Legged Hawk in North America". The Condor 57 (6): 313–346. doi:10.2307/1364791. JSTOR 1364791. 
  13. ^ Friedmann, H. 1950. The birds of Middle and North America. U.S. National Museum Bulletin 50.
  14. ^ Brown, L. and Amadon, D. (1968). Eagles, hawks and falcons of the world. Vol. 2. McGraw-Hill, New York.
  15. ^ Alopex lagopus, p. 5, "Remarks." Smith College, Northampton, Massachusetts. Retrieved: 2011-06-04.
  16. ^ Rough-legged Hawk, Identification, All About Birds – Cornell Lab of Ornithology. Allaboutbirds.org. Retrieved on 2012-08-22.
  17. ^ Hawks – Genus Buteo – Introduction. Oiseaux-birds.com. Retrieved on 2011-12-18.
  18. ^ a b Springer, A. M. (1975). "Observations on the summer diet of Rough-legged Hawks from Alaska". Condor 77 (3): 338–339. doi:10.2307/1366233. 
  19. ^ Koivula, M. and Viitala, J. (1999). "Rough-legged Buzzards use vole scent marks to assess hunting areas". J. Avian Biol. 30 (3): 329–332. doi:10.2307/3677362. JSTOR 3677362. 
  20. ^ a b Good, G. (2008). Buteo lagopus. Animal Diversity Web.
Creative Commons Attribution Share Alike 3.0 (CC BY-SA 3.0)

Source: Wikipedia

Unreviewed

Article rating from 0 people

Default rating: 2.5 of 5

Names and Taxonomy

Taxonomy

Common Names

rough-legged hawk
American roughleg

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

The accepted scientific name of the rough-legged hawk is Buteo lagopus
(Pontoppidan) [32]. The American subspecies is B. l. sanctijohannis
(Gmelin). Some authors include B. l. kamtschatkensis Dementiev
(Siberian roughleg) in occurrences of rough-legged hawks in northwestern
Alaska [1]; a different interpretation treats these as intermediate
between B. l. sanctijohannis and kamtschatkensis and places them with
sanctijohannis [28]. The type subspecies, B. l. lagopus (rough-legged
buzzard), is found only in Eurasia [1,28,37].
  • 28. Palmer, Ralph S., ed. 1988. Handbook of North American birds. New Haven, CT: Yale University Press. 5 volumes. [23780]
  • 32. Sibley, Charles G.; Monroe, Burt L., Jr. 1990. Distribution and taxonomy of the birds of the world. New Haven, CT: Yale University Press. 1111 p. [22814]
  • 37. Zarn, Mark. 1975. Rough-legged hawk (Buteo lagopus sanctijohannis): Habitat management series for unique or endangered species: Report No. 14. Technical Note T-N-270. Denver, CO: U.S. Department of the Interior, Bureau of Land Management. 23 p. [24516]
  • 1. American Ornithologists' Union. 1957. Checklist of North American birds. 5th ed. Baltimore, MD: The Lord Baltimore Press, Inc. 691 p. [21235]

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!