Articles on this page are available in 1 other language: Spanish (19) (learn more)

Overview

Distribution

occurs (regularly, as a native taxon) in multiple nations

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

National Distribution

United States

Origin: Native

Regularity: Regularly occurring

Currently: Present

Confidence: Confident

Type of Residency: Year-round

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Global Range: (>2,500,000 square km (greater than 1,000,000 square miles)) RESIDENT: southern Arizona (formerly), Sonora, Durango, Zacatecas, and central and southeastern Texas (see Kopeny 1988 for details) south through Middle America (including Isla Taboga off Panama), and in South America from Colombia, Venezuela (also the Netherlands Antilles, Margarita Island, and Trinidad) and the Guianas south, east of Andes, to extreme eastern Peru, Bolivia, and central Argentina (AOU 1983). In the U.S., winter distribution is mainly coastal Texas (Root 1988).

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Physical Description

Size

Length: 58 cm

Weight: 884 grams

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Ecology

Habitat

Marismas Nacionales-San Blas Mangroves Habitat

This taxon is found in the Marismas Nacionales-San Blas mangroves ecoregion contains the most extensive block of mangrove ecosystem along the Pacific coastal zone of Mexico, comprising around 2000 square kilometres. Mangroves in Nayarit are among the most productive systems of northwest Mexico. These mangroves and their associated wetlands also serve as one of the most important winter habitat for birds in the Pacific coastal zone, by serving about eighty percent of the Pacific migratory shore bird populations.

Although the mangroves grow on flat terrain, the seven rivers that feed the mangroves descend from mountains, which belong to the physiographic province of the Sierra Madre Occidental. The climate varies from temperate-dry to sub-humid in the summer, when the region receives most of its rainfall (more than 1000 millimetres /year).

Red Mangrove (Rhizophora mangle), Black Mangrove (Avicennia germinans), Buttonwood (Conocarpus erectus) and White Mangrove trees (Laguncularia racemosa) occur in this ecoregion. In the northern part of the ecoregion near Teacapán the Black Mangrove tree is dominant; however, in the southern part nearer Agua Brava, White Mangrove dominates. Herbaceous vegetation is rare, but other species that can be found in association with mangrove trees are: Ciruelillo (Phyllanthus elsiae), Guiana-chestnut (Pachira aquatica), and Pond Apple (Annona glabra).

There are are a number of reptiles present, which including a important population of Morelet's Crocodile (Crocodylus moreletii) and American Crocodile (Crocodylus acutus) in the freshwater marshes associated with tropical Cohune Palm (Attalea cohune) forest. Also present in this ecoregion are reptiles such as the Green Iguana (Iguana iguana), Mexican Beaded Lizard (Heloderma horridum) and Yellow Bellied Slider (Trachemys scripta). Four species of endangered sea turtle use the coast of Nayarit for nesting sites including Leatherback Turtle (Dermochelys coriacea), Olive Ridley Turtle (Lepidochelys olivacea), Hawksbill Turtle (Eretmochelys imbricata) and Green Turtle (Chelonia mydas).

A number of mammals are found in the ecoregion, including the Puma (Puma concolor), Ocelot (Leopardus pardalis), Jaguar (Panthera onca), Southern Pygmy Mouse (Baiomys musculus), Saussure's Shrew (Sorex saussurei). In addition many bat taxa are found in the ecoregion, including fruit eating species such as the Pygmy Fruit-eating Bat (Artibeus phaeotis); Aztec Fruit-eating Bat (Artibeus aztecus) and Toltec Fruit-eating Bat (Artibeus toltecus); there are also bat representatives from the genus myotis, such as the Long-legged Myotis (Myotis volans) and the Cinnamon Myotis (M. fortidens).

There are more than 252 species of birds, 40 percent of which are migratory, including 12 migratory ducks and approximately 36 endemic birds, including the Bumblebee Hummingbird, (Atthis heloisa) and the Mexican Woodnymph (Thalurania ridgwayi). Bojórquez considers the mangroves of Nayarit and Sinaloa among the areas of highest concentration of migratory birds. This ecoregion also serves as wintering habitat and as refuge from surrounding habitats during harsh climatic conditions for many species, especially birds; this sheltering effect further elevates the conservation value of this habitat.

Some of the many representative avifauna are Black-bellied Whistling Duck (Dendrocygna autumnalis), Great Blue Heron (Ardea herodias), Roseate Spoonbill (Ajaia ajaja), Snowy Egret (Egretta thula), sanderling (Calidris alba), American Kestrel (Falco sparverius), Blue-winged Teal (Anas discors), Mexican Jacana (Jacana spinosa), Elegant Trogan (Trogan elegans), Summer Tanager (Piranga rubra), White-tailed Hawk (Buteo albicaudatus), Merlin (Falco columbarius), Plain-capped Starthroat (Heliomaster constantii), Painted Bunting (Passerina ciris) and Wood Stork (Mycteria americana).

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© World Wildlife Fund & C. Michael Hogan

Supplier: C. Michael Hogan

Trusted

Article rating from 1 person

Average rating: 5.0 of 5

Habitat and Ecology

Systems
  • Terrestrial
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Comments: Open country, primarily savanna, prairie, and arid habitats of mesquite, cacti, and bushes, very rarely in open forest (AOU 1983). In Texas: near coast on prairies, cordgrass flats, and scrub-live oak; farther inland on prairie, mesquite and oak savanna, and mixed savanna-chaparral. Suitable habitat in Texas is similar to desireable range condition for cattle grazing (Kopeny 1988). Sources of habitat loss in Texas are proliferation of woody vegetation and agricultural expansion (Kopeny 1988). Along Caribbean coast of Venezuela: hot climate, rocky plateaus, low escarpments. Aruba, Curacao, and Bonaire: mostly acacia- and acacia-cactus-desert. Argentina: open country but not pampas. Nests in wet palm savanna in some areas (Palmer 1988).

Nests in low tree, large shrub, or crown of yucca, typically lone standing, usually 1-4 m above ground; usually on slight eminence. May reuse old nest. Oak, mesquite, Acacia, or Rosa bracteata often used in Texas.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Migration

Non-Migrant: Yes. At least some populations of this species do not make significant seasonal migrations. Juvenile dispersal is not considered a migration.

Locally Migrant: No. No populations of this species make local extended movements (generally less than 200 km) at particular times of the year (e.g., to breeding or wintering grounds, to hibernation sites).

Locally Migrant: No. No populations of this species make annual migrations of over 200 km.

Increased numbers along Gulf Coast in winter suggest local migrations in Texas (Palmer 1988). Probably some seasonal shifting occurs also in Latin America but poorly documented (Palmer 1988).

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Trophic Strategy

Comments: Opportunistic; eats various vertebrates and invertebrates, whatever is available (Kopeny 1988). Hunts chiefly in flight (low soaring search), dropping down on prey; sometimes hunts from perch, pirates food from other raptors, takes prey flushed by farm equipment or fires (apparently attracted to fires from up to several miles away); may capture and eat insects in flight (National Geographic Society 1983, Palmer 1988).

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

General Ecology

See Farquhar (1988) for information on space utilization in Texas.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Life History and Behavior

Reproduction

Lays clutch of 1-4 (usually 2) eggs, principally March-April in Texas; nest with downy young in February in Costa Rica). Nests in dry season in Venezuela (replacement clutches may extend into rainy season). Incubation averages 31 days (Texas). Age at first flight: 47 days at 1 nest, average of 54 days in 1 season, 57 days in another season (Texas); fledges May-June in Texas. Fledglings fed by parents for up to 7 months after leaving nest in Texas (Farquhar 1988). First breeds probably usually at 2 years, perhaps sometimes at 1 year. Scant evidence that 2 broods sometimes may be raised (Texas).

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Barcode data: Buteo albicaudatus

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There are 5 barcode sequences available from BOLD and GenBank.  Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.  See the BOLD taxonomy browser for more complete information about this specimen and other sequences.

GTGACATTTATCAATCGATGATTATTCTCAACCAACCACAAAGACATCGGCACCCTATACCTAATCTTCGGTGCCTGGGCCGGTATAGTCGGCACCGCCCTTAGCCTACTCATCCGTGCAGAACTTGGCCAACCTGGCACACTCCTAGGTGACGACCAGATCTACAATGTAATCGTTACTGCACATGCCTTCGTAATAATCTTCTTCATAGTTATACCAATCATGATTGGAGGATTCGGAAACTGACTTGTTCCACTCATAATTGGCGCCCCCGATATAGCCTTTCCACGTATAAACAACATAAGCTTCTGACTACTTCCTCCATCCTTCCTTCTCCTCCTAGCCTCCTCAACAGTAGAAGCAGGAGCCGGCACTGGATGAACTGTCTATCCCCCACTAGCAGGCAACATAGCCCATGCCGGAGCTTCAGTAGACCTAGCCATCTTCTCCCTACACTTAGCCGGAGTCTCATCCATTCTAGGAGCAATCAACTTCATCACAACCGCCATCAACATAAAACCCCCAGCCCTCTCCCAGTACCAAACACCCCTATTCGTATGATCTGTCCTCATTACCGCCGTTCTTCTACTACTTTCACTCCCAGTTCTAGCCGCCGGCATCACTATACTACTTACAGACCGAAACCTAAACACAACATTCTTTGACCCCGCCGGCGGAGGCGATCCTATCCTATACCAACATCTCTTTTGATTCTTCGGACATCCAGAAGTTT
-- end --

Download FASTA File
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Statistics of barcoding coverage: Buteo albicaudatus

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 5
Specimens with Barcodes: 7
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Conservation

Conservation Status

IUCN Red List Assessment


Red List Category
LC
Least Concern

Red List Criteria

Version
3.1

Year Assessed
2012

Assessor/s
BirdLife International

Reviewer/s
Butchart, S. & Symes, A.

Contributor/s

Justification
This species has an extremely large range, and hence does not approach the thresholds for Vulnerable under the range size criterion (Extent of Occurrence <20,000 km2 combined with a declining or fluctuating range size, habitat extent/quality, or population size and a small number of locations or severe fragmentation). The population trend appears to be increasing, and hence the species does not approach the thresholds for Vulnerable under the population trend criterion (>30% decline over ten years or three generations). The population size is extremely large, and hence does not approach the thresholds for Vulnerable under the population size criterion (<10,000 mature individuals with a continuing decline estimated to be >10% in ten years or three generations, or with a specified population structure). For these reasons the species is evaluated as Least Concern.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

National NatureServe Conservation Status

United States

Rounded National Status Rank: N3 - Vulnerable

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

NatureServe Conservation Status

Rounded Global Status Rank: G4 - Apparently Secure

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Population

Population Trend
Increasing
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Management

Management Requirements: Prescribed burning is potentially an important factor in the maintenance of habitat in Texas (i.e., for brush removal; see Kopeny 1988).

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Wikipedia

White-tailed Hawk

The White-tailed Hawk (Geranoaetus albicaudatus) is a large bird of prey species found in tropical or subtropical environments across the Americas.

Description[edit]

The White-tailed Hawk is a large, stocky hawk. It is close in size to the Swainson's and Red-tailed Hawks, its mean measurements falling slightly ahead of the first and slightly behind the latter. It can attain a total length of 44–60 cm (17–24 in) and a wingspan of 118–143 cm (46–56 in). A body mass of 880–1,240 g (1.9–2.7 lb) was reported in B. a. hysopodius and 865–1,010 g (1.91–2.2 lb) in B. a. colonus. Among standard measurements, the wing chord is 39–46.2 cm (15–18.2 in), the tail is 19.4–22 cm (7.6–8.7 in) and the tarsus is 8–9.2 cm (3.1–3.6 in).[2] Adult birds are grey above and white below and on the rump, with faint pale grey or rufous barring. The short tail is white with a narrow black band near the end that is conspicuous in flight. A rusty-red shoulder patch is just as characteristic when the bird is sitting with wings closed. The wings are dark above, admixed with grey near the bases of the blackish primary remiges. The underwing is whitish, with indistinct brownish barring on the underwing coverts that extends onto the flanks and thighs. The iris is hazel, the cere is pale green, the beak is black with a horn-colored base, and the feet are yellow with black talons.[3]

Immature birds are somewhat darker than adults; they may appear nearly black in faint light, in particular individuals which have little white below. The wing lining is conspicuously spotted black-and-white; the rusty shoulder patch is absent in younger birds. The tail changes from brown with several dark bars to greyish with a hazy dark band as the birds approach maturity. The bare parts are colored much like in the adult.[3]

Its call is a high-pitched cackling ke ke ke..., with a tinkling quality that reminds some of the bleating of a goat or the call of the Laughing Gull.[3]

The White-tailed Hawk is hard to confuse with any other bird, except that in the Southern Hemisphere winter, young birds are sometimes mistaken for migrant Red-backed Hawks.[3]

Subspecies[edit]

Three subspecies are known:[3]

Intermediate in size and coloration. No dark morph.
Small and pale. Dark morph is ashy grey all over, except for the tail and underwing coverts; sometimes extensively marked rufous on the underside. Dark-morph immatures are sometimes black all over, except for the tail.
Large and dark; throat usually black (except in western Argentina). The dark morph appears blackish above, blackish-brown below.

Distribution and ecology[edit]

Adult B. a. hypospodius at Laguna Atascosa National Wildlife Refuge, Texas, USA

The White-tailed Hawk can be found anywhere from coastal Texas and the Rio Grande Valley[4] to central Argentina as well as many Caribbean islands, although mostly the southern ones. For habitat it prefers open or semi-open regions up to 2,000 ft (c. 600 m) ASL, with few trees to hinder its flight. It is not a migratory bird, though some populations may make regional movements when food is scarce. It likes to perch on bushes, trees, telephone poles or even stand around on the ground, as well as to soar. Generally, it prefers arid habitat and rarely occurs in very rainy locales.[3]

Though it will disappear from unsuitable locations after habitat fragmentation, it has a wide range and is not considered to be a globally threatened species by the IUCN.[5]

Its preferred hunting technique is to hover and observe the surroundings for signs of potential prey, gliding to another place when nothing is found. The diet of the White-tailed Hawk varies with its environment. Rabbits make up the majority of the hawk's diet in southern Texas, while lizards of 12 in (30 cm) in length and more are the preferred prey in the Dutch West Indies. Other animals such as cotton rats, snakes, frogs, arthropods (especially grasshoppers, cicadas and beetles), and smallish birds such as passerines or quails are also eaten; it will snatch chickens when no other source of food is available. In the open cerrado of Brazil, mixed-species feeding flocks will react to a White-tailed Hawk with almost as much alarm as they do when seeing such dedicated predators of birds as the Aplomado Falcon.[6] The White-tailed Hawk is also known to feed on carrion and to gather with other birds at brushfires to catch small animals fleeing the flames.[7] In the tropics, White-tailed Hawks rank amongst the main predators of the small monkeys known as marmosets.[8]

Breeding pairs of White-tailed Hawks build nests out of freshly broken twigs, often of thorny plants, 5–15 ft (1.5–5 m) or more above the ground on top of a tree or yucca, preferably one growing in an elevated location giving good visibility from the nest. The nest's interior is cushioned it with dried grasses and other fine materials; green twigs of mesquite or other aromatic plants are often placed in the nest too, perhaps to deter parasites. Like many Accipitridae, White-tailed Hawks do not like to abandon a nest site, and nests built up over the years can thus reach sizes of up to three feet (1 m) across. The eggs are white, often lightly spotted with brown or lavender; between one and three (usually two) are laid per clutch. When approached on the nest, the adults will get airborne and observe the intruder from above, unlike related hawks, which usually wait much longer to flush and then launch a determined attack.[3]

Footnotes[edit]

  1. ^ BirdLife International (2012). "Buteo albicaudatus". IUCN Red List of Threatened Species. Version 2012.1. International Union for Conservation of Nature. Retrieved 16 July 2012. 
  2. ^ Ferguson-Lees, J.; Christie, D. (2001). Raptors of the World. London: Christopher Helm. ISBN 0-7136-8026-1. 
  3. ^ a b c d e f g HCT (2008)
  4. ^ a b "White-tailed Hawk". The Birds of North America Online. Cornell Laboratory of Ornithology. Retrieved 2009-01-06. 
  5. ^ Faria et al. (2006), BLI (2008)
  6. ^ Ragusa-Netto (2000)
  7. ^ eNature (2007), HCT (2008)
  8. ^ [1]

References[edit]

Creative Commons Attribution Share Alike 3.0 (CC BY-SA 3.0)

Source: Wikipedia

Unreviewed

Article rating from 0 people

Average rating: 2.5 of 5

Names and Taxonomy

Taxonomy

Comments: Relationship between this species and South American B. POLYOSOMA and B. POECILOCHROUS needs clarification (AOU 1983).

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!