Articles on this page are available in 1 other language: Chinese (Simplified) (6) (learn more)

Ecology

Habitat

Habitat and Ecology

Systems
  • Terrestrial
  • Freshwater
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Barcode data: Vanellus indicus

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There are 2 barcode sequences available from BOLD and GenBank.  Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.  See the BOLD taxonomy browser for more complete information about this specimen and other sequences.

CCTATACGTAATCTTCGGCGCATGAGCAGGTATAGTCGGCACCGCCCTTAGCCTACTCATCCGCGCGGAACTAGGCCAACCAGGGACTCTACTGGGAGATGACCAAATCTACAACGTAATCGTCACCGCCCATGCCTTCGTAATAATTTTCTTCATAGTAATGCCAATCATAATCGGCGGCTTCGGCAACTGATTAGTCCCACTCATAATCGGTGCACCTGACATAGCATTCCCACGCATAAATAACATAAGCTTCTGACTACTACCCCCCTCATTCCTACTCCTCCTCGCTTCCTCTACAGTAGAAGCCGGAGCAGGCACAGGATGAACCGTTTACCCGCCCTTAGCTGGCAACCTAGCCCATGCTGGAGCTTCAGTAGATCTAGCTATTTTCTCTCTCCACTTAGCAGGTGTATCTTCCATCCTGGGTGCAATCAACTTCATCACGACCGCCATCAACATAAAACCCCCTGCCCTCTCACAATACCAAACACCCCTATTTGTATGATCTGTACTTATCACTGCAGTCTTACTGCTCCTATCACTCCCAGTTCTCGCCGCTGGCATCACCATACTACTAACAGACCGAAATCTAAACACCACATTCTTCGACCCCGCTGGAGGAGGTGACCC
-- end --

Download FASTA File
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Statistics of barcoding coverage: Vanellus indicus

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 4
Specimens with Barcodes: 4
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Conservation

Conservation Status

IUCN Red List Assessment


Red List Category
LC
Least Concern

Red List Criteria

Version
3.1

Year Assessed
2009

Assessor/s
BirdLife International

Reviewer/s
Bird, J., Butchart, S.

Contributor/s

Justification
This species has an extremely large range, and hence does not approach the thresholds for Vulnerable under the range size criterion (Extent of Occurrence <20,000 km2 combined with a declining or fluctuating range size, habitat extent/quality, or population size and a small number of locations or severe fragmentation). The population trend is not known, but the population is not believed to be decreasing sufficiently rapidly to approach the thresholds under the population trend criterion (>30% decline over ten years or three generations). The population size is very large, and hence does not approach the thresholds for Vulnerable under the population size criterion (<10,000 mature individuals with a continuing decline estimated to be >10% in ten years or three generations, or with a specified population structure). For these reasons the species is evaluated as Least Concern.

History
  • 2008
    Least Concern
  • 2004
    Least Concern
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Wikipedia

Red-wattled Lapwing

The Red-wattled Lapwing (Vanellus indicus) is a lapwing or large plover, a wader in the family Charadriidae. It has characteristic loud alarm calls which are variously rendered as did he do it or pity to do it[2] leading to colloquial names like the did-he-do-it bird.[3] Usually seen in pairs or small groups not far from water but may form large flocks in the non-breeding season (winter).[4]

Contents

Description

Red-wattled Lapwings are large waders, about 35 cm long. The wings and back are light brown with a purple sheen, but head and chest and front part of neck are black. Prominently white patch runs between these two colours, from belly and tail, flanking the neck to the sides of crown. Short tail is tipped black. A red fleshy wattle in front of each eye, black-tipped red bill, and the long legs are yellow. In flight, prominent white wing bars formed by the white on the secondary coverts.[5]

V. i. aigneri from Turkey

Race aigneri is slightly paler and larger than the nominate race and is found in Turkey, Iran, Iraq, Afghanistan and the Indus valley. The nominate race is found all over India. The Sri Lankan race lankae is smaller and dark while atronuchalis the race in north-eastern India and eastern Bangladesh has a white cheek surrounded by black.[6]

Males and females are similar in plumage but males have a 5% longer wing and tend to have a longer carpal spur. The length of the birds is 320-350mm, wing of 208-247mm with the nominate averaging 223mm, Sri Lanka 217mm. The Bill is 31-36mm and tarsus of 70-83mm. Tail length is 104-128mm.[4]

It usually keeps in pairs or trios in well-watered open country, ploughed fields, grazing land, and margins and dry beds of tanks and puddles. They occasionally form large flocks, ranging from 26 to 200 birds.[7] It is also found in forest clearings around rain-filled depressions. It runs about in short spurts and dips forward obliquely (with unflexed legs) to pick up food in a typical plover manner.[8] They are said to feed at night being especially active around the full moon.[4] Is uncannily and ceaselessly vigilant, day or night, and is the first to detect intrusions and raise an alarm, and was therefore considered a nuisance by hunters. Flight rather slow, with deliberate flaps, but capable of remarkable agility when defending nest or being hunted by a hawk.[5]

V. i. atronuchalis

Its striking appearance is supplemented by its noisy nature, with a loud and scolding did-he-do-it call, often uttered at night.[6]

Leucistic abnormal plumage is rare.[9]

The local names include titeeri (Hindi), tateehar (Sindhi), titodi (Gujarati), hatatut (Kashmiri), balighora (Assamese), yennappa chitawa (Telugu),[2] aal-kaati (Tamil, meaning "human indicator").[2]

Distribution

View of the wattles

It breeds from West Asia (Iraq, SW Iran, the Arabian/Persian Gulf) eastwards across South Asia (Baluchistan, Afghanistan, Pakistan, the entire Indian subcontinent up to Kanyakumari and up to 1800m in Kashmir/Nepal), with another sub-species further east in Southeast Asia. May migrate altitudinally in spring and autumn (e.g. in N. Baluchistan or NW Pakistan), and spreads out widely in the monsoons[5] on creation of requisite habitats, but by and large the populations are resident.[10]

This species is declining in its western range, but is abundant in much of South Asia, being seen at almost any wetland habitat in its range.

Behaviour and ecology

Call of Red-wattled Lapwing
Fledglings and eggs on a scrape nest. The cryptically plumaged chick typically lies still when alarmed.[5]

The breeding season is mainly March to August. The courtship involves the male puffing its feathers and pointing its beak upwards. The male then shuffles around the female. Several males may display to females and they may be close together.[7] The eggs are laid in a ground scrape or depression sometimes fringed with pebbles, goat or hare droppings.[11] About 3–4 black-blotched buff eggs shaped a bit like a peg-top (pyriform), 42x30 mm on average. Nests are difficult to find since the eggs are cryptically coloured and usually matches the ground pattern.[5] In residential areas, they sometimes take to nesting on roof-tops.[12][13][14] They have been recorded nesting on the stones between the rails of a railway track, the adult leaving the nest when trains passed.[15] Nests that have been threatened by agricultural operations have been manually translocated by gradually shifting the eggs.[16] When nesting they will attempt to dive bomb or distract potential predators.[17][18][19][20] Both the male and female incubate the eggs and divert predators using distraction displays or flash their wings to deter any herbivores that threaten the nest. Males appear to relieve the females incubating at the nest particularly towards the hot part of noon.[21] The eggs hatch in 28 to 30 days. The reproductive success is about 40%. Egg mortality is high (~43%) due to predation by mongooses, crows and kites. Chicks had a lower mortality (8.3%) and their survival improved after the first week.[22]

Like other lapwings, they soak their belly feathers to provide water to their chicks as well as to cool the eggs during hot weather.[23][24]

The chick leaves the nest and follows the parents soon after hatching

They bathe in pools of water when available and will often spend time on preening when leaving the nest or after copulation. They sometimes rest on the ground with the tarsi laid flat on the ground and at other times may rest on one leg.[25]

In flight. Note the diagnostic white wing bar, and broad black band on tail

Healthy adult birds have few predators. Some species of tapeworm and trematodes have been described as endoparasites.[26][27]

Diet

The diet of the lapwing includes a range of insects, snails and other invertebrates, mostly picked from the ground. They may also feed on some grains. They feed mainly during the day but they may also feed at night. They may sometimes make use of the legs to disturb insect prey.[28]

In culture

In parts of India, a local belief is that the bird sleeps on its back with the legs upwards and an associated Hindi metaphor Tithiri se asman thama jayega ("can the pee-wit support the heavens?") is used when referring to persons undertaking tasks beyond their ability or strength.[2]

In parts of Rajasthan it is believed that the laying of eggs by the lapwing on high ground was an indication of good rains to come.[29] The eggs are known to be collected by practitioners of folk medicine.[30][31][32]

References

  1. ^ BirdLife International (2012). "Vanellus indicus". IUCN Red List of Threatened Species. Version 2012.1. International Union for Conservation of Nature. Retrieved 16 July 2012. 
  2. ^ a b c d Jerdon, TC (1864). The Birds of India. George Wyman & Co. pp. 648–649. 
  3. ^ Symons,CT (1917). "Note on the breeding habits of the Did-he-do-it Sarcogrammus indicus". Spolia Zeylanica 10 (39): 397–398. 
  4. ^ a b c Hayman, P., J. Marchant, T. Prater (1986). Shorebirds: an identification guide to the waders of the world. Croom Helm, London. pp. 274–275. 
  5. ^ a b c d e Ali, S & S D Ripley (1980). Handbook of the birds of India and Pakistan 2 (2 ed.). Oxford University Press. pp. 212–215. 
  6. ^ a b Pamela C. Rasmussen and John C. Anderton (2005). Birds of South Asia: The Ripley Guide. Smithsonian Institution & Lynx Edicions. ISBN 84-87334-67-9. OCLC 60359701. 
  7. ^ a b Vyas, Rakesh (1997). "Flocking and courtship display in Redwattled Lapwing (Vanellus indicus)". Journal of Bombay Natural Hist. Soc. 94: 406–407. 
  8. ^ Ali, Salim (1996). Book of Indian Birds, Salim Ali centenary edition. Mumbai: Bombay Natural History Society/Oxford University Press. p. 139. 
  9. ^ Mehra SP, N Singh and S Mehra (2008). "Sighting of a partially albino Red-wattled Lapwing Vanellus indicus in Udaipur, Rajasthan". Indian Birds 4 (3): 120. 
  10. ^ Saini,SS (1972). "Unexpected summer visitors in the Himalayas – Redwattled Lapwing". Newsletter for Birdwatchers 12 (8): 5–6. 
  11. ^ Sharma, SK (1992). "Use of droppings of Indian Hare for nest making by Redwattled Lapwing". Newsletter for Birdwatchers 32 (7&8): 19. 
  12. ^ Mundkur,Taej (1985). "Observations on the roof-nesting habit of the Redwattled Lapwing (Vanellus indicus) in Poona, Maharashtra". J. Bombay Nat. Hist. Soc. 82 (1): 194–196. 
  13. ^ Tehsin, Raza H; Lokhandwala,Juzer (1982). "Unusual nesting of Redwattled Lapwing (Vanellus indicus)". J. Bombay Nat. Hist. Soc. 79 (2): 414. 
  14. ^ Reeves,SK (1975). "Unusual nesting by Red-wattled Lapwing". Newsletter for Birdwatchers 15 (2): 5–6. 
  15. ^ McCann, Charles (1941). "Curious nesting site of the Red-wattled Lapwing (Lobivanellus indicus indicus Bodd.)". J. Bombay Nat. Hist. Soc. 42 (2): 439–440. 
  16. ^ Sridhar,S; Karanth,P (1991). "Dilemma near the nest of a pair of red-wattled lapwings". Newsletter for Birdwatchers 31 (7&8): 7–9. 
  17. ^ Rangaswami,S (1980). "Lapwing fighting off cobra". Newsletter for Birdwatchers 20 (1): 13. 
  18. ^ Bhatnagar,RK (1978). "Interaction of a Redwattled Lapwing and a dog". Newsletter for Birdwatchers 18 (1): 9. 
  19. ^ Bhagwat,VR (1991). "Lapwings and snake". Newsletter for Birdwatchers 31 (5&6): 10–11. 
  20. ^ Kalsi, RS; Khera, S (1987). "Agonistic and distraction behaviour of the Redwattled Lapwing, Vanellus indicus indicus". Pavo 25 (1&2): 43–56. 
  21. ^ Naik, RM; George, PV; Dixit, Dhruv B (1961). "Some observations on the behaviour of the incubating Redwattled Lapwing, Vanellus indicus indicus (Bodd.)". J. Bombay Nat. Hist. Soc. 58 (1): 223–230. 
  22. ^ Desai,JH; Malhotra,AK (1976). "A note on incubation period and reproductive success of the Redwattled Lapwing, Vanellus indicus at Delhi Zoological Park". J. Bombay Nat. Hist. Soc. 73 (2): 392–394. 
  23. ^ Sundararaman, V. (1989). "Belly-soaking and nest wetting behaviour of Redwattled Lapwing, Vanellus indicus (Boddaert)". Journal of Bombay Natural Hist. Soc. 86: 242. 
  24. ^ Kalsi, R. S. & S. Khera (1990). "Growth and development of the Red-wattled Lapwing Vanellus indicus". Stilt 17: 57–64. 
  25. ^ Kalsi,RS; Khera,S (1992). "Some observations on maintenance behaviour of the Red-wattled Lapwing Vanellus indicus (Boddaert)". J. Bombay Nat. Hist. Soc. 89 (3): 368–372. 
  26. ^ Jadhav. V.; Nanware S. S.; Rao S. S. (1994). "Two new tapeworm Panuwa ahilyai n. sp. and Panuwa shindei n. sp. from Vanellus indicus at Aurangabad, M.S., India". Rivista di Parassitologia 55 (3): 379–384. 
  27. ^ Siddiqi, AH, Jairajpuri MS (1962). "Uvitellina indica n. sp. (Trematoda: Cyclocoeliidae) from a redwattled lapwing, Lobivanellus indicus (Boddaert)". Z Parasitenkd. 21: 212–4. doi:10.1007/BF0026033. PMID 13912529. 
  28. ^ Babi,AZ (1987). "Feeding behaviour of red-wattled lapwing". Newsletter for Birdwatchers 27 (1–2): 15. 
  29. ^ Saxena VS (1974). "Unusual nesting by Red-wattled Lapwing". Newsletter for Birdwatchers 14 (11): 3–5. 
  30. ^ Ganesh Tamang (2003). "An Ethnobiological Study of the Tamang People" (PDF). Our Nature 1: 37–41. 
  31. ^ Negi, Chandra S. Negi and Veerendra S. Palyal (2007). "Traditional Uses of Animal and Animal Products in Medicine and Rituals by the Shoka Tribes of District Pithoragarh, Uttaranchal, India" (PDF). Ethno-Med. 1 (1): 47–54. 
  32. ^ Srinivas, K.V. & S. Subramanya (2000). "Stealing of Redwattled Lapwing Vanellus indicus (Boddaert) and Yellow-wattled Lapwing Vanellus malabaricus (Boddaert) eggs by cowherds". Journal of Bombay Natural Hist. Soc. 97 (1): 143–144. 

Other sources

Creative Commons Attribution Share Alike 3.0 (CC BY-SA 3.0)

 

Source: Wikipedia

Unreviewed

Article rating from 0 people

Average rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!