Articles on this page are available in 1 other language: Chinese (Simplified) (6) (learn more)

Overview

Comprehensive Description

Summary

"Large waders with a distinctive red fleshy wattle in front of each eye and black-tipped red bill. They are usually seen in pairs and have a characteristic alarm call that sounds like """"did-you-do-it"""", hence called as the did-you-do-it bird."
Creative Commons Attribution 3.0 (CC BY 3.0)

© India Biodiversity Portal

Source: India Biodiversity Portal

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Physical Description

Morphology

"A familiar plover, bronze-brown above white below, with black face, breast and crown and a crimson wattle or fleshy projection above and in front of each eye. Sexes alike."
Creative Commons Attribution 3.0 (CC BY 3.0)

© India Biodiversity Portal

Source: India Biodiversity Portal

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Size

Slightly larger than the Partridge ; more leggy and with a longer neck.
Creative Commons Attribution 3.0 (CC BY 3.0)

© India Biodiversity Portal

Source: India Biodiversity Portal

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Ecology

Habitat

Habitat and Ecology

Systems
  • Terrestrial
  • Freshwater
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

General Habitat

"Pairs or small parties, in open country near water."
Creative Commons Attribution 3.0 (CC BY 3.0)

© India Biodiversity Portal

Source: India Biodiversity Portal

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Life History and Behavior

Behavior

Behaviour

"The Red-wattled Lapwing is our commonest and most familiar plover. It haunts open country, ploughed fields and grazing land, and is almost invariably present on the margins and beds of jheels and tanks whence the water has lately receded. Pairs or parties of 3 or 4 birds are also usually to be met with in forest glades and clearings. Here they are often a source of great annoyance to the shikari, ruining his stalk by their uncanny and ceaseless vigilance and giving away his presence to the sambhar or other quarry grazing in the open by their frantic calls and agitated behaviour. They spend their time running about on the ground in short spurts, feeding in the typical plover manner on insects, grubs, molluscs, etc., and seem to be quite as active and wide awake at night as during daytime. Its ordinary flight is slow, attained by deliberate flaps of the wings. The bird alights again after a short distance, usually running a few steps on doing so. When thoroughly scared, however, it is capable of considerable speed and much dextrous turning and twisting on the wing. Its call is the all-too-familiar, loud and penetrating Did-he-do-it ? or Pity-to-do-it uttered either placidly or frantically, just once or twice or repeatedly, depending upon the intensity of the prevailing emotion."
Creative Commons Attribution 3.0 (CC BY 3.0)

© India Biodiversity Portal

Source: India Biodiversity Portal

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Reproduction

"The season is principally between March and August. The nest is merely a natural depression or scrape in the ground, unlined, sometimes margined with pebbles. It is situated on waste or fallow land, more or less water-logged in the rains and with deep imprints of cattle hoofs. The drying-up beds of village tanks also offer suitable sites. The eggs—normally 4, broad at one end, abruptly pointed at the other—are some shade of stone or grey-brown in colour, blotched with blackish. They, as well as the newly hatched downy young harmonise with the soil to perfection and it is difficult to locate the eggs or chicks even in a circumscribed area except by patiently watching the movements of the parents. Both sexes guard the young assiduously and launch fierce attacks upon other birds and mammals straying into their proximity."
Creative Commons Attribution 3.0 (CC BY 3.0)

© India Biodiversity Portal

Source: India Biodiversity Portal

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Barcode data: Vanellus indicus

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There are 2 barcode sequences available from BOLD and GenBank.

Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.

See the BOLD taxonomy browser for more complete information about this specimen and other sequences.

CCTATACGTAATCTTCGGCGCATGAGCAGGTATAGTCGGCACCGCCCTTAGCCTACTCATCCGCGCGGAACTAGGCCAACCAGGGACTCTACTGGGAGATGACCAAATCTACAACGTAATCGTCACCGCCCATGCCTTCGTAATAATTTTCTTCATAGTAATGCCAATCATAATCGGCGGCTTCGGCAACTGATTAGTCCCACTCATAATCGGTGCACCTGACATAGCATTCCCACGCATAAATAACATAAGCTTCTGACTACTACCCCCCTCATTCCTACTCCTCCTCGCTTCCTCTACAGTAGAAGCCGGAGCAGGCACAGGATGAACCGTTTACCCGCCCTTAGCTGGCAACCTAGCCCATGCTGGAGCTTCAGTAGATCTAGCTATTTTCTCTCTCCACTTAGCAGGTGTATCTTCCATCCTGGGTGCAATCAACTTCATCACGACCGCCATCAACATAAAACCCCCTGCCCTCTCACAATACCAAACACCCCTATTTGTATGATCTGTACTTATCACTGCAGTCTTACTGCTCCTATCACTCCCAGTTCTCGCCGCTGGCATCACCATACTACTAACAGACCGAAATCTAAACACCACATTCTTCGACCCCGCTGGAGGAGGTGACCC
-- end --

Download FASTA File

Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Statistics of barcoding coverage: Vanellus indicus

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 4
Specimens with Barcodes: 4
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Conservation

Conservation Status

IUCN Red List Assessment


Red List Category
LC
Least Concern

Red List Criteria

Version
3.1

Year Assessed
2015

Assessor/s
BirdLife International

Reviewer/s
Butchart, S. & Symes, A.

Contributor/s

Justification
This species has an extremely large range, and hence does not approach the thresholds for Vulnerable under the range size criterion (Extent of Occurrence <20,000 km2 combined with a declining or fluctuating range size, habitat extent/quality, or population size and a small number of locations or severe fragmentation). The population trend is not known, but the population is not believed to be decreasing sufficiently rapidly to approach the thresholds under the population trend criterion (>30% decline over ten years or three generations). The population size is very large, and hence does not approach the thresholds for Vulnerable under the population size criterion (<10,000 mature individuals with a continuing decline estimated to be >10% in ten years or three generations, or with a specified population structure). For these reasons the species is evaluated as Least Concern.

History
  • Least Concern (LC)
  • Least Concern (LC)
  • Least Concern (LC)
  • Lower Risk/least concern (LR/lc)
  • Lower Risk/least concern (LR/lc)
  • Lower Risk/least concern (LR/lc)
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5