Articles on this page are available in 1 other language: Spanish (18) (learn more)

Overview

Brief Summary

Buteo jamaicensis

A large (19-25 inches) hawk, the Red-tailed Hawk is most easily identified by its dark brown back, pale underparts, and rusty-red tail visible from above or below. In some parts of this species’ range, exceptionally light or dark subspecies occur, having more or less pigment in the back, breast, and tail than the nominative subspecies. Male and female Red-tailed Hawks are similarly-plumaged in all seasons; however, like most species of raptors, females are larger than males. The Red-tailed Hawk breeds from Alaska and northern Canada south through the United States, the West Indies, Mexico, and parts of Central America. In winter, northerly-breeding populations migrate south to the southern half of the U.S.Southerly-breeding populations migrate short distances, if at all. Red-tailed Hawks are birds of semi-open country. This species inhabits open woodland, shrubby fields, and even urban areas where food is plentiful. Red-tailed Hawks primarily eat small mammals, including lemmings, mice, and voles, but may eat small birds and reptiles when the opportunity presents itself. Red-tailed Hawks are most easily seen soaring over open habitat while scanning the ground for prey, dropping down to capture it with their talons. With the aid of binoculars, it may also be possible to see individual Red-tailed Hawks perching in trees or tall posts near their hunting grounds. This species is primarily active during the day.

Threat Status: Least concern

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Unknown

Supplier: DC Birds

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

The Red-tailed Hawk is a bird of prey, one of three species colloquially known in the United States as the "chickenhawk," though it rarely preys on standard sized chickens (All About Birds). It breeds throughout most of North America, from western Alaska and northern Canada to as far south as Panama and the West Indies, and is one of the most common buteos in North America. Red-tailed Hawks can acclimate to all the biomes within its range. There are fourteen recognized subspecies, which vary in appearance and range. It is one of the largest members of the genus Buteo in North America, typically weighing from 690 to 1600 grams (1.5 to 3.5 pounds) and measuring 45–65 cm (18 to 26 in) in length, with a wingspan from 110 to 145 cm (43 to 57 in). The Red-tailed Hawk displays sexual dimorphism in size, with females averaging about 25% heavier than males (Preston and Beane 1993).

Creative Commons Attribution Share Alike 3.0 (CC BY-SA 3.0)

© Wikipedia editors and contributors

Supplier: Cyndy Parr

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Distribution

Geographic Range

Red-tailed hawks are native only to the Nearctic region. They are found throughout the United States and Canada, and into Mexico and Central America. Many birds are year round occupants although the birds of the far north migrate south during the fall to escape the harsh winter.

Biogeographic Regions: nearctic (Native )

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 1 person

Average rating: 4.0 of 5

Global Range: (>2,500,000 square km (greater than 1,000,000 square miles)) BREEDS: western and central Alaska, central Yukon, western Mackenzie, northern Saskatchewan, northern Manitoba, central Ontario, southern Quebec, New Brunswick, Prince Edward Island, and Nova Scotia south to southeastern Alaska, Baja California, Sonora, Chihuahua, Nuevo Leon, southern Texas, Gulf Coast, and Florida, and highlands of Middle America to Costa Rica and western Panama (east to Canal Zone); in Tres Marias and Socorro islands off western Mexico; and in northern Bahamas (Grand Bahama, Abaco, Andros), Greater Antilles, and northern Lesser Antilles (Saba south to Nevis) (AOU 1983). WINTERS: southern Canada south through remainder of breeding range, also in lowlands of Central America. In the U.S., most abundant in winter in California-western Nevada and in the farming and ranching region of the central U.S. (Root 1988). Accidental in England and Bermuda (AOU 1983).

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 1 person

Average rating: 3.0 of 5

Red-tailed hawks breed from central Alaska, the Yukon, and the Northwest
Territories east to southern Quebec and the Maritime Provinces and south
to Florida, the West Indies, and Central America.  They winter from
southern Canada south throughout the remainder of the breeding range
[1,8,13].

Buteo jamaicensis ssp. alascensis breeds (probably resident) from
southeastern coastal Alaska (Yakutat Bay) to Queen Charlotte Islands and
Vancouver Island, British Columbia [49].

Eastern red-tailed hawks breed from southern Ontario, southern Quebec,
Maine, and Nova Scotia south through eastern Nebraska, eastern Kansas,
and eastern Oklahoma to eastern Texas, Louisiana, Mississippi, Alabama,
and northern Florida.  They winter from eastern Nebraska, northeastern
Iowa, southern Michigan, southern Ontario, central New York, and
southern Maine south to the Gulf coast and southern Florida.  Occasional
breeding occurs from northern Minnesota to northern New England [49].

Western red-tailed hawks breed from central interior Alaska, the Yukon,
the Northwest Territories, and Saskatchewan south to Baja California,
Sonora, and western New Mexico.  They range east to Colorado, Wyoming, and
Montana and to northeastern Manitoba, south-central Ontario, central and
eastern Quebec, Prince Edward Island, and Cape Breton Island.  Western
red-tailed hawks winter from southwestern British Columbia to southern
Minnesota south and southwest to Guatemala and northern Nicaragua [49].

Buteo jamaicensis ssp. fuertesi breed from northern Chihuahua to Brewster
County, Kerr County, and Corpus Christi in southern Texas south to
south-central Nuevo Leon.  They winter in central Sonora, southwestern
Arizona, New Mexico, and southern Louisiana [49].

Harlani red-tailed hawks breed from the Valley of the Yukon and the
Mount Logan area, Alaska, to northern British Columbia east of the Coast
Ranges and southeast to the Red Deer region of Alberta.  They winter from
Kansas, southern Missouri, and Arkansas south to Texas and Louisiana
[49].

Krider's red-tailed hawks breed from southern Alberta, southern
Saskatchewan, southern Manitoba, and extreme western Ontario south to
south-central Montana, Wyoming, western Nebraska, ane western Minnesota.
They winter from South Dakota and southern Minnesota south to Arizona,
New Mexico, Durango, Zacatecas, Texas and Louisiana [49].

Florida red-tailed hawks are year-round residents in peninsular Florida
north to Tampa Bay and the Kissimmee Prairie, formerly to San Mateo and
Cedar Keys [49].
  • 1.  American Ornithologists' Union. 1983. Checklist of North American birds.        6th ed. Lawrence, KS: Allen Press, Inc. 877 p.  [21234]
  • 8.  Campbell, R. Wayne; Dawe, Neil K.; McTaggart-Cowan, Ian; [and others]
  • 13.  DeGraaf, Richard M.; Scott, Virgil E.; Hamre, R. H.; [and others]
  • 49.  American Ornithologists' Union. 1957. Checklist of North American birds.        5th ed. Baltimore, MD: The Lord Baltimore Press, Inc. 691 p.  [21235]

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Regional Distribution in the Western United States

More info on this topic.

This species can be found in the following regions of the western United States (according to the Bureau of Land Management classification of Physiographic Regions of the western United States):

    1  Northern Pacific Border
    2  Cascade Mountains
    3  Southern Pacific Border
    4  Sierra Mountains
    5  Columbia Plateau
    6  Upper Basin and Range
    7  Lower Basin and Range
    8  Northern Rocky Mountains
    9  Middle Rocky Mountains
   10  Wyoming Basin
   11  Southern Rocky Mountains
   12  Colorado Plateau
   13  Rocky Mountain Piedmont
   14  Great Plains
   15  Black Hills Uplift
   16  Upper Missouri Basin and Broken Lands

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Occurrence in North America

AL AK AZ AR CA CO CT DE FL GA
HI ID IL IN IA KS KY LA ME MD
MA MI MN MS MO MT NE NV NH NJ
NM NY NC ND OH OK OR PA RI SC
SD TN TX UT VT VA WA WV WI WY


AB BC MB NB NF NT NS ON PE PQ
SK YT



MEXICO

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Geographic Range

Red-tailed hawks are native only to the Nearctic region. They are found throughout the United States and Canada, and into Mexico and Central America. Many birds are year round occupants although the birds of the far north migrate south during the fall to escape the harsh winter.

Biogeographic Regions: nearctic (Native )

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

occurs (regularly, as a native taxon) in multiple nations

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

National Distribution

Canada

Origin: Native

Regularity: Regularly occurring

Currently: Present

Confidence: Confident

Type of Residency: Breeding

United States

Origin: Native

Regularity: Regularly occurring

Currently: Present

Confidence: Confident

Type of Residency: Year-round

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Physical Description

Morphology

Physical Description

Red-tailed hawks average 48 to 65 centimeters in length. Their wingspan is approximately 4 feet, or 122 centimeters. There is sexual dimorphism in size: females are 25% larger than males. This kind of sexual dimorphism, where females are larger than males, is common in birds of prey.

Red-tailed hawk plumage ranges from light auburn to deep brown. The underbelly is lighter than the rest of the body, with a dark belly band across it. The cere (the soft skin at the base of the beak), the legs, and the feet are all yellow. The tail is uniformly red, and it is this trait that gives red-tailed hawks their name.

Immature red-tailed hawks look similar to adults. One difference is that immatures have yellowish-gray eyes that become dark brown as adults.

Range mass: 795 to 1224 g.

Range length: 45 to 65 cm.

Average wingspan: 122 cm.

Other Physical Features: endothermic ; bilateral symmetry ; polymorphic

Sexual Dimorphism: female larger

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Physical Description

Red-tailed hawks are 48 to 65 centimeters in length. Their wingspan is approximately 4 feet, or 122 centimeters. Females and males are similar in appearance, but females are 25% larger than males. This kind of sexual dimorphism, where females are larger than males, is common in birds of prey. Mass is reported from 795 to 1224 grams, with mass varying by sex, season, and geographically. Red-tailed hawks range from light auburn to deep brown in color. Their underbelly is lighter than the rest of the body, with a dark band across it. The cere (the soft skin at the base of the beak), the legs and the feet are all yellow. The tail is brownish-red, and it is this trait that gives red-tailed hawks their name.

Immature red-tailed hawks look similar to adults, but... Immatures also have yellowish-gray eyes that become dark brown as adults.

There are at least 14 subspecies of Buteo jamaicensis. These subspecies are separated based differences in their color and differences in where they breed and spend the winter.

Range mass: 795 to 1224 g.

Range length: 45 to 65 cm.

Average wingspan: 122 cm.

Other Physical Features: endothermic ; bilateral symmetry ; polymorphic

Sexual Dimorphism: female larger

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Size

Length: 56 cm

Weight: 1224 grams

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Ecology

Habitat

Cover Requirements

More info for the terms: cover, tree

Red-tailed hawk nests are generally built on sites that provide a
commanding view of the area and unobstructed access to the nest.  Nests
are typically high in a tree that is taller than those surrounding it.
Some researchers have found that red-tailed hawk nests are often located
well up a slope or on a ridge or hilltop [38,44].  However, Speiser and
Bosakowski [44], reported that in the highlands of southeastern New
York
and northern New Jersey red-tailed hawks most often nested between lower
and middle slopes, seldom near the top of a slope and never directly on
a ridgetop.  Red-tailed hawks seem to prefer trees with open crowns
[38].  Roost trees for raptors are usually large enough to provide
safety from any predatory threat from the ground.  They are typically
the largest trees in the stand; the crown near the top or the middle
portion of the tree is open and have stout lateral limbs with easy
access [50].  Red-tailed hawks are probably more efficient predators in
open areas than in areas with high vegetative cover.
  • 38.  Palmer, Ralph S., editor. 1988. Handbook of North American birds. Volume        5. New Haven, CT: Yale University Press. 463 p.  [22303]
  • 44.  Speiser, Robert; Bosakowski, Thomas. 1988. Nest site preferences of        red-tailed hawks in the highlands of southeastern New York and northern        New Jersey. Journal of Field Ornithology. 59(4): 361-368.  [22701]
  • 50.  Call, Mayo. 1979. Habitat management guides for birds of prey. Techical        Note 338. Denver, CO: U.S. Department of the Interior, Bureau of Land        Management, Denver Service Center. 70 p.  [22451]

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Preferred Habitat

More info for the terms: cacti, hardwood, shrubs, tree, tundra

Red-tailed hawks occupy a wide variety of open to semiopen habitats.
They generally avoid tundra and dense, unbroken woodland [1,9,25,13].
Open to semiopen coniferous, deciduous and mixed woodlands, woodland
edges, grasslands, parklands, rangelands, river bottomlands, and
agricultural fields with scattered trees are preferred.  Forest
clearings, alpine meadows, estuaries, and marshes are also commonly used
[6,8,22,34,39].  Hardwood draws surrounded by native prairie are
important habitats in the Great Plains [9].  In Wyoming and Montana,
red-tailed hawks nested in several habitats, but nests were most
numerous in riparian zones.  Upland draws with adjacent grassland or
agricultural tracts were also commonly used [51].

Nesting habitat - Red-tailed hawks usually nest in a tall tree in or at
the edge of woodlands, or in an isolated tree in an open area [1,9,13].
Red-tailed hawks frequently select the largest and tallest tree
available [1,13].  In treeless areas red-tailed hawks nest on rocky
cliffs or talus slopes, or in shrubs or cacti [13,28].  In the Sonoran
Desert, red-tailed hawks often nest in large saguaro (Carnegiea
gigantea) with projecting limbs [38].  Red-tailed hawks also nest on
artificial nest structures, the crossbars of utility poles, and towers
[25,38,44].  They sometimes add to an existing raven, crow (Corvus
spp.), gray squirrel (Sciurus spp.), or buteo (Buteo spp.) nest [38].
The nest is generally constructed next to the trunk of a tree in a
crotch or fork from 30 to 90 feet (9-27 m) above the ground [13,46].
Where tall trees are unavailable nests may be located almost on the
ground.  Red-tailed hawk nests are at most 6 feet (0.9 m) above the
ground in paloverde (Cercidium spp.) [38].  Nests are often reused from
year to year provided that the nests are not occupied by earlier nesting
raptors [20,51].  The mean distance between occupied nests in Wyoming
and Montana was 1.5 miles (2.4 km) [51].

Red-tailed hawks nest in a wide variety of tree species [8,43,44,45,51].
In central Missouri, 99 percent of red-tailed hawk nests were in
deciduous hardwoods.  Sycamore (Platanus occidentalis) was the most
frequently selected species (40%).  Other species included white
oak (Quercus alba), 32 percent; black oak (Q. velutina), 19.1 percent;
shingle oak (Q. imbricaria), 1.9 percent; eastern redcedar (Juniperus
virginiana), 1.9 percent; red oak (Q. rubra), 0.9 percent; American elm
(Ulmus americana), 0.9 percent; green ash (Fraxinus pennsylvanica), 0.9
percent; shagbark hickory (Carya ovata), 0.9 percent; mockernut hickory
(C. tomentosa), 0.9 percent; and eastern cottonwood (Populus
deltoides), 0.9 percent [45].

In Snohomish County, Washington, only black cottonwood (Populus
trichocarpa) and red alder (Alnus rubra) were utilized for nesting. No
nests were found in conifers [43].  In the highlands of southeastern New
York and northern New Jersey, red-tailed hawks built nests in 10
different species of trees, with the majority in oaks (82%) [44].  In
Wyoming and Montana, the majority (51%)of red-tailed hawk nests were
found in coniferous trees.  Forty-seven percent of the nests were found
in deciduous trees and 2 percent were located on cliffs [51].  In
British Columbia, coniferous trees (48%; 8 species) were used slightly
more that deciduous trees (44%; 4 species).  Black cottonwood (38%),
Douglas-fir (Pseudotsuga menziesii) (19%), and ponderosa pine (Pinus
ponderosa) (19%) were used most often [8].
 
Only 13 percent of the red-tailed hawk nests in a study area in
Wisconsin were located in closed-canopy woodlots.  Fifty-eight percent
of the nests were located in open groves, generally less than 1 acre
(0.4 ha) in size.  Twenty-nine percent were located in isolated trees
along fencelines and ditchbanks. The majority of the nest trees were on
well-drained upland sites [19].  Houston and Bechard [21] documented the
increase of nesting red-tailed hawks following the expansion of trees
into the prairie regions of Saskatchewan [44].

Foraging habitat - Red-tailed hawks generally forage in open habitats
containing lagomorphs, small rodents, and snakes.  During the nesting
season red-tailed hawks usually forage within 1.9 miles (3 km) of the
nest [25].  They are often observed hunting in clearcuts and
non-forested areas [35].  Red-tailed hawks usually search for prey from
elevated perches [20,23,38].  Consequently, they commonly occupy areas
that provide a relative abundance of potential perching sites [23].
James [23] found that 40 percent or more or the average red-tailed hawk
home range contained at least 10 perches per 40 acres (16.2 ha).  Snags
are commonly used for perches [12,14,31].  Red-tailed hawks in central
Iowa tend to select perches in groves of trees and along woodland edges
[53].  Foraging habitat in the Midwest is limited by large expanses of
cereal crops [9].

Winter habitat - Winter habitat for red-tailed hawks is generally the
same as the nesting habitat, except that high elevation areas are not
used [25].  Wintering red-tailed hawks in Illinois avoided plowed fields
and showed a preference for high perches in areas with groups of trees
or small woodlots [9].
  • 1.  American Ornithologists' Union. 1983. Checklist of North American birds.        6th ed. Lawrence, KS: Allen Press, Inc. 877 p.  [21234]
  • 6.  Brown, David E. 1982. Alpine and subalpine grasslands. In: Brown, David        E., ed.  Biotic communities of the American Southwest--United States and        Mexico. Desert Plants. 4(1-4): 109-111.  [8894]
  • 8.  Campbell, R. Wayne; Dawe, Neil K.; McTaggart-Cowan, Ian; [and others]
  • 9.  Castrale, John S. 1991. Eastern woodland buteos. In: Pendleton, Beth        Giron; Krahe, Diane L., eds. Proceedings of the midwest raptor        management symposium and workshop; [Date of conference unknown]
  • 12.  DeGraaf, Richard M. 1978. New life from dead trees. National Wildlife.        16(4): 28-31.  [13650]
  • 13.  DeGraaf, Richard M.; Scott, Virgil E.; Hamre, R. H.; [and others]
  • 14.  Dickson, James G.; Conner, Richard N.; Williamson, J. Howard. 1983. Snag        retention increases bird use of a clear-cut. Journal of Wildlife        Management. 47(3): 799-804.  [13855]
  • 19.  Gates, J. M. 1972. Red-tailed hawk populations and ecology in        east-central Wisconsin. Wilson Bulletin. 84: 421-433.  [22707]
  • 20.  Young, Leonard S. 1989. Effects of agriculture on raptors in the western        United States: an overview. In: Proceedings of the western raptor        symposium and workshop; 1987 October 26-28; Boise, ID. NWF Scientific        and Technical Series No. 12. Washington, DC: National Wildlife        Federation: 209-218.  [22649]
  • 21.  Houston, C. S.; Bechard, M. J. 1983. Trees and the red-tailed hawk in        southern Saskatchewan. Blue Jay. 41: 99-109.  [22705]
  • 22.  Ingraldi, Michael F. 1992. The ecology of red-tailed hawks in an        urban/suburban environment. Syracuse, NY: New York State University. 78        p. Thesis.  [22695]
  • 23.  Janes, Stewart W. 1985. Habitat selection in raptorial birds. In: Cody,        Martin L., ed. Habitat selection in birds. [Place of publication        unknown]
  • 25.  Kochert, Michael N. 1986. Raptors. In: Cooperrider, Allan Y.; Boyd,        Raymond J.; Stuart, Hanson R., eds. Inventory and monitoring of wildlife        habitat. Denver, CO: U.S. Department of the Interior, Bureau of Land        Management, Denver Service Center: 313-349.  [13527]
  • 28.  Lanier, John W.; Foss, Carol F. 1988. Habitat management for raptors on        large forested tracts and shorelines. In: Proceedings of the northeast        raptor management symposium and workshop; 1988 May 16-18; [Location of        conference unknown]
  • 31.  Mannan, Robert William. 1977. Use of snags by birds, Douglas-fir region,        Western Oregon. Corvallis, OR: Oregon State University. 114 p. Thesis.        [9896]
  • 34.  Medin, Dean E. 1992. Birds of a Great Basin sagebrush habitat in        east-central Nevada. Res. Pap. INT-452. Ogden, UT: U.S. Department of        Agriculture, Forest Service, Intermountain Research Station. 4 p.        [17779]
  • 35.  Nelson, Brad B.; Titus, Kimberly. 1988. Silviculture practices and        raptor habitat associations in the Northeast. In: Pendleton, Beth Giron;        LeFranc, Maurice N., Jr.; Moss, Mary Beth, eds. Proceedings of the        northeast raptor management symposium and workshop; 1988 May 16-18;        Syracuse, NY. NWF Science and Technology Series No. 13. Washington, DC:        National Wildlife Federation: 171-179.  [22697]
  • 38.  Palmer, Ralph S., editor. 1988. Handbook of North American birds. Volume        5. New Haven, CT: Yale University Press. 463 p.  [22303]
  • 39.  Ralph, C. John; Paton, Peter W. C.; Taylor, Cathy A. 1991. Habitat        association patterns of breeding birds ans small mammals in        Douglas-fir/hardwood stands in nw California and sw Oregon. In:        Ruggiero, Leonard F.; Aubry, Keith B.; Carey, Andrew B.; Huff, Mark H.,        technical coordinators. Wildlife and vegetation of unmanaged Douglas-fir        forests. Gen. Tech. Rep. PNW-GTR-285. Portland, OR: U.S. Department of        Agriculture, Forest Service, Pacific Northwest Research Station:        379-393.  [17329]
  • 43.  Speiser, Robert. 1990. Nest site characteristics of red-tailed hawks in        western Washington. Northwestern Naturalist. 71(3): 95-97.  [22702]
  • 44.  Speiser, Robert; Bosakowski, Thomas. 1988. Nest site preferences of        red-tailed hawks in the highlands of southeastern New York and northern        New Jersey. Journal of Field Ornithology. 59(4): 361-368.  [22701]
  • 45.  Toland, Brian R. 1990. Nesting ecology of red-tailed hawks in central        Missouri. Transactions, Missouri Academy of Science. 24: 1-16.  [22703]
  • 46.  Verner, Jared; Boss, Allan S., tech. coords. 1980. California wildlife        and their habitats: western Sierra Nevada. Gen. Tech. Rep. PSW-37.        Berkeley, CA: U.S. Department of Agriculture, Forest Service, Pacific        Southwest Forest and Range Experiment Station. 439 p.  [10237]
  • 51.  Phillips, Robert L.; Wheeler, Anne H.; Lockhart, J. Michael; [and        others]
  • 53.  Fischer, David L.; Ellis, Kevin L.; Meese, Robert J. 1984. inter habitat        selection of diurnal raptors in central Utah. Raptor Research. 18(3):        98-102.  [22704]

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Associated Plant Communities

More info for the term: tundra

Red-tailed hawks occur in nearly every open to semiopen plant community
in North America [8,25].  They avoid tundra and dense forests [1,25].
  • 1.  American Ornithologists' Union. 1983. Checklist of North American birds.        6th ed. Lawrence, KS: Allen Press, Inc. 877 p.  [21234]
  • 8.  Campbell, R. Wayne; Dawe, Neil K.; McTaggart-Cowan, Ian; [and others]
  • 25.  Kochert, Michael N. 1986. Raptors. In: Cooperrider, Allan Y.; Boyd,        Raymond J.; Stuart, Hanson R., eds. Inventory and monitoring of wildlife        habitat. Denver, CO: U.S. Department of the Interior, Bureau of Land        Management, Denver Service Center: 313-349.  [13527]

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Habitat: Cover Types

More info on this topic.

This species is known to occur in association with the following cover types (as classified by the Society of American Foresters):

More info for the term: cover

   Red-tailed hawks probably occur in most SAF Cover Types

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Habitat: Plant Associations

More info on this topic.

This species is known to occur in association with the following plant community types (as classified by Küchler 1964):

   Red-tailed hawks probably occur in most Kuchler Plant Associations

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Habitat: Ecosystem

More info on this topic.

This species is known to occur in the following ecosystem types (as named by the U.S. Forest Service in their Forest and Range Ecosystem [FRES] Type classification):

FRES10 White-red-jack pine
FRES11 Spruce-fir
FRES12 Longleaf-slash pine
FRES13 Loblolly-shortleaf pine
FRES14 Oak-pine
FRES15 Oak-hickory
FRES16 Oak-gum-cypress
FRES17 Elm-ash-cottonwood
FRES18 Maple-beech-birch
FRES19 Aspen-birch
FRES20 Douglas-fir
FRES21 Ponderosa pine
FRES22 Western white pine
FRES23 Fir-spruce
FRES24 Hemlock-Sitka spruce
FRES25 Larch
FRES26 Lodgepole pine
FRES27 Redwood
FRES28 Western hardwoods
FRES29 Sagebrush
FRES30 Desert shrub
FRES31 Shinnery
FRES32 Texas savanna
FRES33 Southwestern shrubsteppe
FRES34 Chaparral-mountain shrub
FRES35 Pinyon-juniper
FRES36 Mountain grasslands
FRES37 Mountain meadows
FRES38 Plains grasslands
FRES39 Prairie
FRES40 Desert grasslands
FRES41 Wet grasslands
FRES42 Annual grasslands
FRES44 Alpine

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Red-tailed hawks live in a variety of habitats. In their habitat, they need open areas for hunting and several scattered perches. Some of the habitats that red-tailed hawks live in are scrub desert, grasslands, farm fields, pastures, parks, woodlands, and tropical rainforests. Red-tailed hawks prefer to build their nests at the edge of forests, in wooded fence rows, or in large trees surrounded by open areas.

Habitat Regions: temperate ; tropical ; terrestrial

Terrestrial Biomes: desert or dune ; savanna or grassland ; forest ; rainforest ; scrub forest

Other Habitat Features: urban ; suburban ; agricultural ; riparian

  • Preston, C., R. Beane. 1993. Red-tailed hawk (Buteo jamaicensis). Pp. 1-24 in A Poole, F Gill, eds. The Birds of North America, Vol. 52. Washington DC and Philadelphia, PA: The Academy of Natural Sciences and The American Ornithologists' Union.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Habitat and Ecology

Systems
  • Terrestrial
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Red-tailed hawks inhabit a wide range of habitats over a wide range of altitudes. These habitats are typically open areas with scattered, elevated perches, and include scrub desert, plains and montane grasslands, agricultural fields, pastures, urban parks, patchy coniferous and deciduous woodlands, and tropical rainforests. Red-tailed hawks prefer to build their nests at the edge of forests, in wooded fence rows, or in large trees surrounded by open areas.

Habitat Regions: temperate ; tropical ; terrestrial

Terrestrial Biomes: desert or dune ; savanna or grassland ; forest ; rainforest ; scrub forest

Other Habitat Features: urban ; suburban ; agricultural ; riparian

  • Preston, C., R. Beane. 1993. Red-tailed hawk (Buteo jamaicensis). Pp. 1-24 in A Poole, F Gill, eds. The Birds of North America, Vol. 52. Washington DC and Philadelphia, PA: The Academy of Natural Sciences and The American Ornithologists' Union.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Comments: Wide variety of open woodland and open country with scattered trees, rarely in denser forest (AOU 1983), but nests in forest and takes prey from forest canopy in Puerto Rico (Recher and Recher 1966, Santana 1988). Elevated perches are important element of habitat.

Nests in trees to 37 m above ground, frequently high in tallest tree near edge of woods; also, in treeless country, in top of shrub, cactus, or on cliff. Often returns to same nesting area in successive years.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Migration

Non-Migrant: Yes. At least some populations of this species do not make significant seasonal migrations. Juvenile dispersal is not considered a migration.

Locally Migrant: Yes. At least some populations of this species make local extended movements (generally less than 200 km) at particular times of the year (e.g., to breeding or wintering grounds, to hibernation sites).

Locally Migrant: Yes. At least some populations of this species make annual migrations of over 200 km.

Northern populations mainly migratory (some breeders resident on or near territories all year), generally arrive in northern breeding areas in March and April (yearlings may still be migrating as late as May and June), depart by September-October (Bent 1937), may continue southward movement into December. Migrations may be influenced by food supply. Most migrants from north migrate no farther south than northern Mexico (Palmer 1988).

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Trophic Strategy

Food Habits

More info for the term: tree

Red-tailed hawks are versatile, opportunistic predators [38].  Prey
items of red-tailed hawks are numerous.  Generally, any animal the size
of a jackrabbit (Lepus spp.) or smaller, including domestic animals, is
potential prey.  Red-tailed hawks primarily eat small mammals but also
eat birds, reptiles, and some insects [13,16,20,38].  In Wyoming,
Wisconsin, and Michigan, researchers found that mammals accounted for 93
percent, 85 percent, and 40 percent, respectively, of the prey species
taken [22].

Some prey items reported to be taken by red-tailed hawks include meadow
voles (Microtus pennsylvanicus), red-backed voles (Clethrionomys
gapperi), short-tail shrews (Blarina brevicauda), deer mice (Peromyscus
maniculatus), chipmunks (Tamias spp.), tree squirrels (Sciurus spp.),
ground squirrels (Citellus spp.), pikas (Ochotona princeps), prairie
dogs (Cynomys spp.), jackrabbits, cottontails (Sylvilagus spp.), skunks
(Mephitis spp. and Spilogale spp.), raccoons (Procyon lotor), woodchucks
(Marmota spp.), ring-necked pheasants (Phasianus colchicus), grouse, and
various songbirds [5,20,22,30,38].
  • 5.  Blumstein, Daniel T. 1989. Food habits of red-tailed hawks in Boulder        County, Colorado. Journal of Raptor Research. 23(2): 53-55.  [22691]
  • 13.  DeGraaf, Richard M.; Scott, Virgil E.; Hamre, R. H.; [and others]
  • 16.  DuBois, Kristi; Becker, Dale; Thornbrugh, Joe. 1987. Identification of        Montana's birds of prey. Montana Outdoors. 18(6): 11-31.  [3606]
  • 20.  Young, Leonard S. 1989. Effects of agriculture on raptors in the western        United States: an overview. In: Proceedings of the western raptor        symposium and workshop; 1987 October 26-28; Boise, ID. NWF Scientific        and Technical Series No. 12. Washington, DC: National Wildlife        Federation: 209-218.  [22649]
  • 22.  Ingraldi, Michael F. 1992. The ecology of red-tailed hawks in an        urban/suburban environment. Syracuse, NY: New York State University. 78        p. Thesis.  [22695]
  • 30.  Luttich, S.; Rusch, D. H.; Meslow, E. C.; Keith, L. B. 1970. Ecology of        red-tailed hawk predation in Alberta. Ecology. 51: 190-203.  [22709]
  • 38.  Palmer, Ralph S., editor. 1988. Handbook of North American birds. Volume        5. New Haven, CT: Yale University Press. 463 p.  [22303]

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Food Habits

Red-tailed hawks feed on a wide variety of prey, using their powerful claws as weapons. Eighty to eighty-five percent of their diet consists of small Rodentia. Mammals as large as Sylvilagus floridanus may also taken. Squamata and other Aves make up the rest of the diet. Male Agelaius phoeniceus are common prey because they are so visible when guarding their nests. Red-tailed hawks do most of their hunting from a perch. They are not known to store food.

Animal Foods: birds; mammals; reptiles

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Food Habits

Red-tailed hawks feed on a wide variety of prey, using their powerful claws as weapons. Eighty to eighty-five percent of their diet consists of small rodents. Mammals as large as eastern cottontail rabbits may also taken. Reptiles and other birds make up the rest of the diet. Male red-winged blackbirds are common prey because they are so visible when guarding their nests. Red-tailed hawks do most of their hunting from a perch. They are not known to store food.

Animal Foods: birds; mammals; reptiles

Primary Diet: carnivore (Eats terrestrial vertebrates)

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Comments: Opportunistic. Rodents, lagomorphs, birds, and reptiles common in diet but also eats various other vertebrates and sometimes invertebrates as available. Among several hunting methods, perch-and-wait most common and yields greatest success (Palmer 1988). Also perches and hunts along highways.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Associations

Predators

Information was not found in the literature regarding predation on
red-tailed hawks or their clutches.  However, species that kill other
raptors and destroy their clutches probably also kill  red-tailed
hawks.  Some raptor predators include great horned owls (Bubo
virginianus) and golden eagles (Aquila chrysaetos).  Other potential
predators include coyotes (Canis latrans), bobcats (Lynx rufus), skunks,
and crows.

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Ecosystem Roles

Red-tailed hawks play an important role in local ecosystems by helping to control the populations of small mammals, including rodents and rabbits. They also provide habitat for some small bird species, including Passer domesticus, that live in active red-tailed hawk nests.

Some smaller bird species mob hawks. Red-tailed hawks also steal food and have food stolen by other large birds, including Aquila chrysaetos, Haliaeetus leucocephalus and Cynomys ludovicianus.

Ecosystem Impact: creates habitat

Commensal/Parasitic Species:

  • Passer domesticus

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Predation

Adult red-tailed hawks are large formidable birds, and have few predators. Most predation on this species occurs to eggs and nestlings. Bubo virginianus are known predators of red-tailed hawk nestlings. Corvus are known predators of eggs and nestlings.

Known Predators:

  • great horned owls (Bubo_virginianus)
  • crows (Corvus)

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Ecosystem Roles

Red-tailed hawks play an important role in local ecosystems by helping to control the populations of small mammals, including rodents and rabbits. They also provide habitat for some small bird species, including house sparrows, that live in active red-tailed hawk nests.

Red-tailed hawks have antagonistic relationships with many bird species. Some smaller bird species mob hawks. Red-tailed hawks also steal prey and have prey stolen by other large birds, including golden eagles, bald eagles and ferruginous hawks.

Ecosystem Impact: creates habitat

Commensal/Parasitic Species:

  • house sparrow

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Predation

Adult red-tailed hawks are large formidable birds, and have few predators. Most predation on this species occurs to eggs and nestlings. Great horned owls are known predators of red-tailed hawk nestlings. Corvids are known predators of eggs and nestlings.

Known Predators:

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Known prey organisms

  • D. I. Rasmussen, Biotic communities of Kaibab Plateau, Arizona, Ecol. Monogr. 11(3):228-275, from p. 261 (1941).
  • P. G. Howes, The Giant Cactus Forest and Its World: A Brief Biology of the Giant Cactus Forest of Our American Southwest (Duell, Sloan, and Pearce, New York; Little, Brown, Boston; 1954), from pp. 222-239, from p. 227.
  • R. D. Bird, Biotic communities of the Aspen Parkland of central Canada, Ecology, 11:356-442, from p. 383 (1930).
  • Waide RB, Reagan WB (eds) (1996) The food web of a tropical rainforest. University of Chicago Press, Chicago
  • Myers, P., R. Espinosa, C. S. Parr, T. Jones, G. S. Hammond, and T. A. Dewey. 2006. The Animal Diversity Web (online). Accessed February 16, 2011 at http://animaldiversity.org. http://www.animaldiversity.org
Creative Commons Attribution 3.0 (CC BY 3.0)

© SPIRE project

Source: SPIRE

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Population Biology

Number of Occurrences

Note: For many non-migratory species, occurrences are roughly equivalent to populations.

Estimated Number of Occurrences: 81 to >300

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Global Abundance

10,000 to >1,000,000 individuals

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

General Ecology

Habitat-related Fire Effects

More info for the terms: cover, fire suppression, fresh, natural, shrubs

Red-tailed hawks occur in the following 10 major fire-dependent plant
associations in the western United States:  grasslands, semidesert
shrub-grasslands, sagebrush (Artemisia spp.)-grasslands, chaparral,
pinyon-juniper (Pinus spp.-Juniperus spp.) woodland, ponderosa pine,
Douglas-fir, spruce-fir (Picea spp.-Abies spp.), redwood (Sequoia
sempervirens), and giant sequoia (Sequoiadendron giganteum) forests
[29].

Suppression of fires in large expanses of treeless areas may benefit
red-tailed hawks.  In southern Saskatchewan, the control of fires on the
once open prairies and the planting of trees and shrubs has resulted in
a semiopen, tree-grassland mosaic and consequent territory expansion and
population increase of red-tailed hawks [38].

Although fire may reduce potential nest trees, it may also create snags
for perch sites and enhance the foraging habitat of red-tailed hawks.
Red-tailed hawks often perch on snags created by lightning strikes [3].
They often use fresh burns when foraging due to increased prey
visibility [15,27,32,36].  Regular prescribed burning helps to maintain
habitat for many prey species of red-tailed hawks [10,15,27,29,32].
Several studies indicate that many prey populations increase rapidly
subsequent to burning in response to increased food availability
[15,27].  Fire suppression in grasslands was detrimental to small bird
and mammal populations due to organic matter accumulation and reduced
plant vigor [47].

The suppression of natural fire in chaparral has resulted in reduced
seral stage diversity and less edge [15] which has probably affected
red-tailed hawks in these communities.  Red-tailed hawks are more
abundant in recently burned chaparral areas than in unburned areas due
to greater visibility and less cover for prey [36].  Additionally,
red-tailed hawks are favored by fires that open up or clear
pinyon-juniper woodlands [32].  Raptors associated with pinyon-juniper
woodlands depend upon edges of openings created by fire and scattered
islands of unburned woodlands [15].

In the first year following a severe fire in grassland, ponderosa pine,
Douglas-fir, and mountain big sagebrush (Artemisia tridentata ssp.
vaseyana) habitat types on the Salmon National Forest, several
red-tailed hawks were observed within the burn.  They were not observed
in the area before the fire [10].  Following a fire in a mountain big
sagebrush community on the Bridger-Teton National Forest, red-tailed
hawks were more commonly observed using an area that experienced a
severe fall fire than in a nearby area burned by a low-severity spring
fire [33].  Red-tailed hawks have also been observed hunting on recently
burned areas in Colorado County, Texas [2].
 
Although fire is often beneficial to red-tailed hawk prey species, Yensen
and others [48] reported that in the Snake River Birds of Prey Area,
southwestern Idaho, fire may reduce populations of Townsend's ground
squirrels (Spermophilus townsendii).
  • 2.  Baker, R. H. 1940. Effects of burning and grazing on rodent populations.        Journal of Mammalogy. 21: 223.  [2849]
  • 3.  Baker, W. Wilson. 1974. Longevity of lightning-struck trees and notes on        wildlife use. In: Proceedings, annual Tall Timbers fire ecology        conference; 1973 March 22-23; Tallahassee, FL. No. 13. Tallahassee, FL:        Tall Timbers Research Station: 497-504.  [19015]
  • 10.  Collins, Thomas C. 1980. A report on the Moose Creek Fire of August,        1979. Unpublished report on file with: U.S. Department of Agriculture,        Forest Service, Salmon National Forest, North Fork Ranger District,        North Fork, ID. 27+ p.  [666]
  • 15.  Dodd, Norris L. 1988. Fire management and southwestern raptors. In:        Gliski, R. L.; Pendleton, Beth Giron; Moss, Mary Beth; [and others]
  • 27.  Landers, J. Larry. 1987. Prescribed burning for managing wildlife in        southeastern pine forests. In: Dickson, James G.; Maughan, O. Eugene,        eds. Managing southern forests for wildlife and fish: a proceedings;        [Date of conference unknown]
  • 29.  Lehman, Robert N.; Allendorf, John W. 1989. The effects of fire, fire        exclusion and fire management on raptor habitats in the western United        States. In: Proceedings of the western raptor management symposium and        workshop; 1987 October 26-28; Boise, ID. Scientific and Technical Series        No. 12. Washington, DC: National Wildlife Federation: 236-244.  [22324]
  • 32.  Mason, Robert B. 1981. Response of birds and rodents to controlled        burning in pinyon-juniper woodlands. Reno, NV: University of Nevada. 55        p. Thesis.  [1545]
  • 33.  McGee, John Michael. 1976. Some effects of fire suppression and        prescribed burning on birds and small mammals in sagebrush. Laramie, WY:        University of Wyoming. 114 p. Dissertation.  [16998]
  • 36.  Nichols, R.; Menke, J. 1984. Effects of chaparral shrubland fire on        terrestrial wildlife. In: DeVries, Johannes J., ed. Shrublands in        California: literature review and research needed for management.        Contribution No. 191. Davis, CA: University of California, Water        Resources Center: 74-97.  [5706]
  • 38.  Palmer, Ralph S., editor. 1988. Handbook of North American birds. Volume        5. New Haven, CT: Yale University Press. 463 p.  [22303]
  • 47.  Wagle, R. F. 1981. Fire: its effects on plant succession and wildlife in        the Southwest. Tucson, AZ: University of Arizona. 82 p.  [4031]
  • 48.  Yensen, Eric; Quinney, Dana L.; Johnson, Kathrine; [and others]

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Timing of Major Life History Events

More info for the term: hibernation

Age at sexual maturity - Red-tailed hawks are generally sexually mature
at 2 years of age [38].

Breeding season - The breeding season generally occurs from late January
to September depending on geographic area [16,22,38,46].  Full clutches
may be expected as early as February in warmer parts of California and
in other states bordering Mexico and/or the Gulf coast.  For most of the
contiguous United States, clutches are laid in March.  In the northern
states and southern Canada, clutches are laid from March to early May.
In interior Alaska clutches are laid from April to late May [38].

Clutch size and incubation - Red-tailed hawks lay two to four eggs, with
three most common [16,22,38,46].  Clutch size may vary with prey
availability [38].  The eggs are incubated for 28 to 34 days [22,38].
If the first clutch is destroyed, red-tailed hawks may lay a replacement
clutch within 3 or 4 weeks [38].

Fledging - Nestlings fledge in 42 to 46 days [16,20,22,38].  Males
fledge earlier than females [38].  Fledglings continue to be fed by
parents and remain within the nesting territory for 30 days or more
after fledging [20].

Migration - Red-tailed hawks migrate as individuals.  Some established
breeders (especially in the southern United States) remain on or near
their territories all year.  Near Fairbanks, Alaska, a mature red-tailed
hawk spent three consecutive winters in the same territory [38].

Spring migration starts in February and March in northern Mexico and the
southern United States.  Early arrivals reach the northern states while
the ground is still under snow.  Along the Canadian border in the Great
Lakes region some red-tailed hawks are still migrating in late May and
June [38].  Western red-tailed hawks arrival in Yellowstone National
Park in the spring is probably dependent on the appearance of the ground
squirrels, which come out of hibernation about the first of April [52].

Fall migration from Canada and the adjoining northern states begins in
August and continues through early October.  Eastern red-tailed hawks
begin to migrate south from New England and other northern parts of
their range early in September [52].  Further south, red-tailed hawks
begin migrating from early October to mid-December [38].

Longevity - Red-tailed hawks have been reported to live up to 16 years
in the wild and 29 years in captivity [22].  The average longevity for a
red-tailed hawk that survives to maturity is 6 to 7 years [38].
  • 16.  DuBois, Kristi; Becker, Dale; Thornbrugh, Joe. 1987. Identification of        Montana's birds of prey. Montana Outdoors. 18(6): 11-31.  [3606]
  • 20.  Young, Leonard S. 1989. Effects of agriculture on raptors in the western        United States: an overview. In: Proceedings of the western raptor        symposium and workshop; 1987 October 26-28; Boise, ID. NWF Scientific        and Technical Series No. 12. Washington, DC: National Wildlife        Federation: 209-218.  [22649]
  • 22.  Ingraldi, Michael F. 1992. The ecology of red-tailed hawks in an        urban/suburban environment. Syracuse, NY: New York State University. 78        p. Thesis.  [22695]
  • 38.  Palmer, Ralph S., editor. 1988. Handbook of North American birds. Volume        5. New Haven, CT: Yale University Press. 463 p.  [22303]
  • 46.  Verner, Jared; Boss, Allan S., tech. coords. 1980. California wildlife        and their habitats: western Sierra Nevada. Gen. Tech. Rep. PSW-37.        Berkeley, CA: U.S. Department of Agriculture, Forest Service, Pacific        Southwest Forest and Range Experiment Station. 439 p.  [10237]
  • 52.  Bent, Arthur Cleveland. 1962. Life histories of North American wild        fowl. Part 1. New York: Dover Publications, Inc. 244 p.  [20027]

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Breeding density (pairs /sq. km) varies from 0.03 (Utah) to 0.78 (California); mostly less than 0.025 (but 0.2-0.6 pairs/sq. km in different habitats in Puerto) (Santana 1988, Rothfels and Lein 1983). In Puerto Rico, remains paired and defends territory throughout the year (Santana 1988). Also territorial in winter in at least some parts of the U.S. In a largely sedentary population in Wisconsin, mean seasonal home ranges varied as follows: fall male 390 ha (n=1), female 123 ha (n=2); winter male 157 ha (n=3), female 167 ha (n=6); spring male 163 ha (n=2), female 85 ha (n=6); summer male 117 ha (n=1), female 117 ha (n=5) (Petersen 1979). Most forage within 3 kilometers of the nest (Kochert 1986). See Palmer (1988) for discussion of interactions with other hawks and Great Horned Owl.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Life History and Behavior

Behavior

Communication and Perception

Adult red-tailed hawks make a call that sounds like "kee-eeee-arrr." It is often described as sounding like a steam whistle. Young red-tailed hawks communicate with their parents by making soft, low "peep"-ing sounds.

Red-tailed hawks also communicate through body language. In an aggressive posture, the body and head of a red-tailed hawk are held upright, and its feathers are standing up. In submission, the hawk's head is lower to the ground and the feathers are smooth. Red-tailed hawks also display many aerial behaviors. In the talon-drop, during courtship, they swoop down trying to touch one another with their talons. Undulating-flight is an up and down movement that is mainly used in territorial display. In the dive-display, the bird performs a steep dive. This display signals that his territory is occupied.

Red-tailed hawks have excellent vision. This allows them to see prey movements very far away.

Communication Channels: visual ; acoustic

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Communication and Perception

Adult red-tailed hawks make what is called a horse scream, "kee-eeee-arrr." It is often described as sounding like a steam whistle. The length and pitch of this call varies with the age, gender, and geographic region of the individual red-tailed hawk.

Young red-tailed hawks communicate with their parents by making soft, low "peep"-ing sounds. As they get older, they sounds they make deepen in tone, and are usually sounds of hunger.

Red-tailed hawks also communicate through body language. In an aggressive posture, the body and head of the  red-tailed hawk are held upright and its feathers are standing up. In submission, the hawk's head is lower to the ground and the feathers are smooth. Red-tailed hawks also display many aerial behaviors. In the talon-drop, during courtship, they swoop down trying to touch one another with their talons. Undulating-flight is an up and down movement that is mainly used in territorial display. Finally, in the dive-display the bird performs a steep dive. This is also a territorial display.

Red-tailed hawks have extraordinarily keen vision, which allows them to detect prey movements at great distances.

Communication Channels: visual ; acoustic

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Cyclicity

Comments: Rain and fog reduce flying activity and foraging time in forest birds in Puerto Rico (Santana 1988).

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Life Expectancy

Lifespan/Longevity

Red-tailed hawks are relatively long-lived birds. While many of these birds die young (most live less than two years), those that survive the first few years can live for many years. The oldest known wild red-tailed hawk lived to at least 21.5 years old. In captivity, red-tailed hawks have lived for at least 29.5 years.

Range lifespan

Status: wild:
29.5 (high) years.

Range lifespan

Status: captivity:
29.5 (high) years.

Average lifespan

Status: wild:
346 months.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Lifespan/Longevity

Red-tailed hawks are relatively long-lived birds. While many of these birds die young (most live less than two years), those that survive the first few years can live for many years. The oldest known wild red-tailed hawk lived to at least 21.5 years old. In captivity, red-tailed hawks have lived for at least 29.5 years.

Range lifespan

Status: wild:
29.5 (high) years.

Range lifespan

Status: captivity:
29.5 (high) years.

Average lifespan

Status: wild:
346 months.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Lifespan, longevity, and ageing

Maximum longevity: 29.5 years (captivity) Observations: The average longevity for these animals once they reach maturity is about 6 to 7 years. In the wild they do not live more than 16 years (http://www.fs.fed.us/database/feis/).
Creative Commons Attribution 3.0 (CC BY 3.0)

© Joao Pedro de Magalhaes

Source: AnAge

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Reproduction

Red-tailed hawks usually begin breeding when they are three years old. They are monogamous, and mate with the same individual for many years. In fact, red-tailed hawks usually only change mates when their original mate dies. During courtship, the male and female soar together in circles for up to 10 minutes before mating.

Mating System: monogamous

Red-tailed hawk nests are usually 28 to 38 inches wide. They are often used for several years in a row, and can be up to 3 feet tall. The male and female work together to build the nest in a tall tree, 4 to 21 meters above the ground. Where there are not trees to build nests in, red-tailed hawks build their nests on cliff ledges or on man-made structures such as buildings. The nests are made of twigs and lined with bark, pine needles, corn cobs, husks, stalks, aspen catkins and other soft plant materials. The hawks put fresh bark, twigs, and pine needles in the nest throughout the breeding season to keep it clean.

The female lays 1 to 5 eggs around the first week of April. The eggs are laid every other day and are incubated for 28 to 35 days. Both parents incubate the eggs. Males bring food to the female while she is on the nest. The newly-hatched chicks are helpless (altricial). During the nestling stage, the female broods the young, and the male provides most of the food to the female and the chicks. The female feeds the chicks by tearing the food into small pieces. The chicks begin to leave the nest after 42 to 46 days. They learn to fly and hunt, and leave the nest for good after 10 weeks or so.

Breeding interval: Red-tailed hawks breed each spring.

Breeding season: Breeding occurs in the spring.

Range eggs per season: 1 to 5.

Range time to hatching: 28 to 35 days.

Average time to hatching: 30 days.

Range fledging age: 42 to 46 days.

Range time to independence: 10 (high) weeks.

Average age at sexual or reproductive maturity (female): 3 years.

Average age at sexual or reproductive maturity (male): 3 years.

Key Reproductive Features: seasonal breeding ; gonochoric/gonochoristic/dioecious (sexes separate); fertilization

Average eggs per season: 3.

Average age at sexual or reproductive maturity (male)

Sex: male:
730 days.

Average age at sexual or reproductive maturity (female)

Sex: female:
730 days.

Both parents incubate the eggs. When the chicks are nestlings, the female broods them to protect them from predators and hot and cold temperatures. The male provides most of the food to the female and the chicks, and the female feeds the nestlings by tearing the food into small pieces. The chicks begin to leave the nest after 42 to 46 days. After they leave the nest, young red-tailed hawks usually stay close to their parents. They begin to fly about 3 weeks after they first begin to leave the nest, and begin to catch their own food 6 to 7 weeks after that. They become completely independent from their parents by about 10 weeks after fledging, at about 112 to 116 days old.

Parental Investment: altricial ; pre-fertilization (Provisioning, Protecting: Female); pre-hatching/birth (Provisioning: Female, Protecting: Male, Female); pre-weaning/fledging (Provisioning: Male, Female, Protecting: Male, Female); pre-independence (Provisioning: Male, Female, Protecting: Male, Female)

  • Preston, C., R. Beane. 1993. Red-tailed hawk (Buteo jamaicensis). Pp. 1-24 in A Poole, F Gill, eds. The Birds of North America, Vol. 52. Washington DC and Philadelphia, PA: The Academy of Natural Sciences and The American Ornithologists' Union.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Red-tailed hawks usually begin breeding when they are three years old. They are monogamous, and mate with the same individual for many years. In fact, red-tailed hawks usually only change mates when their original mate dies. During courtship, the male and female soar together in circles, with flights lasting 10 minutes or more. Mating usually takes place following these flights. The male and female land on a perch and preen each other. The female then tilts forward, allowing the male to mount her. Copulation lasts 5 to 10 seconds.

Mating System: monogamous

Red-tailed hawk nests are usually 28 to 38 inches in diameter. They are sometimes used for several years, and can be up to 3 feet tall. The male and female both construct the nest in a tall tree, 4 to 21 meters above the ground. Where trees are scarce, they are sometimes built on cliff ledges or artificial structures such as on buildings. The nests are constructed of twigs and lined with bark, pine needles, corn cobs, husks, stalks, aspen catkins and other soft plant matter. Fresh bark, twigs, and pine needles are deposited into the nest throughout the breeding season to keep the nest clean. Owls compete with the red-tailed hawks for nest sites. Each species is known to kill the young and destroy the eggs of the other in an attempt at taking a nest site.

The female lays 1 to 5 eggs around the first week of April. The eggs are laid approximately every other day and are incubated for 28 to 35 days. Both parents incubate the eggs. Males may spend less time incubating than females, but bring food to the female while she is on the nest. The young hatch over the course of 2 to 4 days, and are altricial at hatching. During the nestling stage, the female broods the young, and the male provides most of the food to the female and the chicks. The female feeds the nestlings by tearing the food into small pieces. The chicks begin to leave the nest after 42 to 46 days. The fledgling period lasts up to 10 weeks, during which the chicks learn to fly and hunt.

Breeding interval: Red-tailed hawks breed each spring.

Breeding season: Breeding occurs in the spring.

Range eggs per season: 1 to 5.

Range time to hatching: 28 to 35 days.

Average time to hatching: 30 days.

Range fledging age: 42 to 46 days.

Range time to independence: 10 (high) weeks.

Average age at sexual or reproductive maturity (female): 3 years.

Average age at sexual or reproductive maturity (male): 3 years.

Key Reproductive Features: seasonal breeding ; gonochoric/gonochoristic/dioecious (sexes separate); fertilization

Average eggs per season: 3.

Average age at sexual or reproductive maturity (male)

Sex: male:
730 days.

Average age at sexual or reproductive maturity (female)

Sex: female:
730 days.

Both parents incubate the eggs. Males may spend less time incubating than females, but bring food to the female while she is on the nest. The newly hatched chicks are altricial (helpless). During the nestling stage, the female broods the young, and the male provides most of the food to the female and the chicks. The female feeds the nestlings by tearing the food into small pieces. The chicks begin to leave the nest after 42 to 46 days. After they leave the nest, young red-tailed hawks usually stay in one place, close to their parents. They begin to fly about 3 weeks after they first begin to leave the nest, and begin to catch their own food 6 to 7 weeks after that. They become completely independent from their parents by about 10 weeks after fledging, at about 112 to 116 days old.

Parental Investment: altricial ; pre-fertilization (Provisioning, Protecting: Female); pre-hatching/birth (Provisioning: Female, Protecting: Male, Female); pre-weaning/fledging (Provisioning: Male, Female, Protecting: Male, Female); pre-independence (Provisioning: Male, Female, Protecting: Male, Female)

  • Preston, C., R. Beane. 1993. Red-tailed hawk (Buteo jamaicensis). Pp. 1-24 in A Poole, F Gill, eds. The Birds of North America, Vol. 52. Washington DC and Philadelphia, PA: The Academy of Natural Sciences and The American Ornithologists' Union.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Clutch size commonly is 2-3. Incubation lasts about 34 days per egg, mostly by female. Young are tended by both parents, may leave nest at about 4 weeks, fly at about 6.5-7 weeks, depend on parents for food for at least a few weeks after fledging. If clutch lost, renests usually in another nest a few weeks later. Successful reproduction usually does not occur before age 2 years. Pair bond typically lifelong, at least in nonmigratory populations and probably in migrants as well.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Barcode data: Buteo jamaicensis

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There are 2 barcode sequences available from BOLD and GenBank.  Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.  See the BOLD taxonomy browser for more complete information about this specimen and other sequences.

CCTATANCTAATCTTCGGCGCCTGGGCCGGTATAGTCGGCACCGCCCTCAGCCTACTTATTCGTGCAGAACTCGGCCAACCAGGCACACTTCTAGGCGACGACCAGATCTACAACGTAATCGTTACCGCACATGCCTTTGTAATAATTTTCTTCATGGTTATACCAATTATGATCGGAGGCTTCGGAAACTGACTTGTCCCACTCATAATCGGCGCCCCCGATATAGCCTTCCCACGCATAAACAACATAAGCTTCTGACTACTTCCTCCATCCTTCCTCCTCCTCCTAGCCTCCTCAACAGTAGAAGCAGGAGCCGGCACTGGATGAACTGTCTATCCCCCACTAGCTGGCAACATAGCCCATGCCGGAGCTTCAGTAGACCTAGCCATCTTCTCCCTACACCTAGCCGGAGTCTCGTCCATTCTAGGGGCAATCAACTTTATCACAACCGCCATCAACATAAAACCCCCAGCCCTCTCCCAATACCAAACACCCCTATTCGTATGATCTGTCCTCATTACCGCTGTCCTTCTACTACTCTCACTCCCAGTCCTAGCCGCTGGCATCACTATACTACTCACAGACCGAAACCTAAACACAACATTCTTTGACCCTGCTGGCGGAGGTGATCCCATCCTATACCAACATCTCTTTTGATTCTTCGGACACCCAGAAGTTTACATCCTAATCTTA
-- end --

Download FASTA File
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Statistics of barcoding coverage: Buteo jamaicensis

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 3
Specimens with Barcodes: 6
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Conservation

Conservation Status

Red-tailed hawks have extended their geographic range over the last 100 years. This expansion is probably due to expansion of red-tailed hawk habitat. As this new habitat continues to change, red-tailed hawk populations may decrease.

The greatest threats to red-tailed hawk populations are shootings, collisions with automobiles, and human activities near nests. Lead poisoning from eating food items that contain lead shot also kills a number of red-tailed hawks each year.

Red-tailed hawks are protected under the U.S. Migratory Bird Act and CITES Appendix II.

IUCN Red List of Threatened Species: least concern

US Migratory Bird Act: protected

US Federal List: no special status

CITES: appendix ii

State of Michigan List: no special status

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

IUCN Red List Assessment


Red List Category
LC
Least Concern

Red List Criteria

Version
3.1

Year Assessed
2009

Assessor/s
BirdLife International

Reviewer/s
Bird, J., Butchart, S.

Contributor/s

Justification
This species has an extremely large range, and hence does not approach the thresholds for Vulnerable under the range size criterion (Extent of Occurrence <20,000 km2 combined with a declining or fluctuating range size, habitat extent/quality, or population size and a small number of locations or severe fragmentation). The population trend appears to be increasing, and hence the species does not approach the thresholds for Vulnerable under the population trend criterion (>30% decline over ten years or three generations). The population size is extremely large, and hence does not approach the thresholds for Vulnerable under the population size criterion (<10,000 mature individuals with a continuing decline estimated to be >10% in ten years or three generations, or with a specified population structure). For these reasons the species is evaluated as Least Concern.

History
  • 2008
    Least Concern
  • 2004
    Least Concern
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Red-tailed hawks have extended their geographic range over the last 100 years. This expansion is most likely the result of increasing habitat of patchy woodland and open areas. As these areas become filled in with forest or more completely opened up, the amount of habitat for red-tailed hawks is expected to decline.

Currently, the greatest threats to red-tailed hawk populations are shootings, collisions with automobiles, and human interference with nesting activities. Lead poisoning from eating food items that contain lead shot also kills a number of red-tailed hawks each year.

Red-tailed hawks are protected under the U.S. Migratory Bird Act and CITES Appendix II.

US Migratory Bird Act: protected

US Federal List: no special status

CITES: appendix ii

State of Michigan List: no special status

IUCN Red List of Threatened Species: least concern

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

National NatureServe Conservation Status

Canada

Rounded National Status Rank: N5B - Secure

United States

Rounded National Status Rank: N5B,N5N : N5B: Secure - Breeding, N5N: Secure - Nonbreeding

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

NatureServe Conservation Status

Rounded Global Status Rank: G5 - Secure

Reasons: Large range in North and Central America; increasing or stable populations in most areas of the U.S.and Canada; no significant threats on a global scale.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Global Short Term Trend: Increase of 10 to >25%

Comments: Breeding Bird Survey data indicate a significant population increase in North America between 1966 and 1993 (Droege and Sauer 1990, Peterjohn et al. 1994, Price et al. 1995). May be decreasing in the northeastern U.S. (Bednarz et al. 1990). However, Titus and Fuller (1990) found no consistent trend in migration counts in northeastern North America, 1972-1987. Decreases in migration counts may in part reflect a larger proportion of birds wintering in the north (Kirk et al. 1995). See Walter (1990) for an account of the small but viable population of subspecies SOCORROENSIS on Soccoro Island, Mexico. See Kirk (1995 COSEWIC report) for information on status in Canada.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Management

Management Considerations

Unlike many other raptor species in North America, red-tailed hawk
populations have increased over much of their range due to fragmentation
of forests into small woodlots and increases in woodland edge [9].
Because of these habitat changes, red-tailed hawks have replaced
red-shouldered hawks (Buteo lineatus) throughout much of the
red-shouldered hawks' former breeding range [41]. 

To manage a stand for red-tailed hawks, 500 to 1,000 overstory trees per
acre (1,235-2,470/ha) with not more than 40 percent of the trees 8
inches (20 cm) d.b.h. is recommended [35].  Clearcutting is often
detrimental to the nest site but may be beneficial to local populations
of red-tailed hawks by providing foraging habitat [35].  Snags and cull
trees should be retained as perch sites for red-tailed hawks [14,31,50].
Additionally, trees that contain nests should be retained whenever
possible.  Protecting habitat used by the prey base may also benefit
red-tailed hawks [50].  Although red-tailed hawks are tolerant of human
activities, construction of home sites degrades the quality of woodlands
by reducing habitat for some prey species [9].  In southeastern New York
and northern New Jersey, no red-tailed hawk nests were found near
high-density suburban housing developments [44].
  • 9.  Castrale, John S. 1991. Eastern woodland buteos. In: Pendleton, Beth        Giron; Krahe, Diane L., eds. Proceedings of the midwest raptor        management symposium and workshop; [Date of conference unknown]
  • 14.  Dickson, James G.; Conner, Richard N.; Williamson, J. Howard. 1983. Snag        retention increases bird use of a clear-cut. Journal of Wildlife        Management. 47(3): 799-804.  [13855]
  • 31.  Mannan, Robert William. 1977. Use of snags by birds, Douglas-fir region,        Western Oregon. Corvallis, OR: Oregon State University. 114 p. Thesis.        [9896]
  • 35.  Nelson, Brad B.; Titus, Kimberly. 1988. Silviculture practices and        raptor habitat associations in the Northeast. In: Pendleton, Beth Giron;        LeFranc, Maurice N., Jr.; Moss, Mary Beth, eds. Proceedings of the        northeast raptor management symposium and workshop; 1988 May 16-18;        Syracuse, NY. NWF Science and Technology Series No. 13. Washington, DC:        National Wildlife Federation: 171-179.  [22697]
  • 41.  Robinson, Scott K. 1991. Effects of habitat fragmentation on midwestern        raptors. In: Pendleton, Beth Giron; Krahe, Diane L., eds. Proceedings of        the midwest raptor management symposium and workshop; [Date of        conference unknown]
  • 44.  Speiser, Robert; Bosakowski, Thomas. 1988. Nest site preferences of        red-tailed hawks in the highlands of southeastern New York and northern        New Jersey. Journal of Field Ornithology. 59(4): 361-368.  [22701]
  • 50.  Call, Mayo. 1979. Habitat management guides for birds of prey. Techical        Note 338. Denver, CO: U.S. Department of the Interior, Bureau of Land        Management, Denver Service Center. 70 p.  [22451]

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Use of Fire in Population Management

Prescribed fire can be beneficial to red-tailed hawk populations by
enhancing habitat and increasing the prey base [15,27].  Prescribed
burning plans should strive for creation of maximum interspersion of
openings and edge, with high vegetative diversity.  Habitats should be
maintained in a random mosaic.  In most cases, burning plans must be
integrated with proper range management.  Reseeding of perennial grasses
as well as rest from livestock grazing may be necessary to achieve
desired goals.  Burning should be deferred until nesting is completed in
areas where impact to breeding red-tailed hawks may occur [15].  After
logging, Benson [4] suggested broadcast burning rather than piling slash
to reduce high temperature fires which may be destructive to soil
organisms and small mammals.  For more information regarding the use of
prescribed fire in specific habitats for the benefit of raptors, see
Dodd [15].

An extensive body of research has been published on fire effects on animals
in semidesert grassland, oak savanna, and Madrean oak woodlands of southeastern
Arizona, including the response of red-tailed hawk to fire. See the Research Project Summary of this work for more information on
red-tailed hawk and more than 100 additional species of birds, small
mammals, grasshoppers, and herbaceous and woody plant species.
  • 4.  Benson, Patrick C. 1979. Land use and wildlife with emphasis on raptors.        [Ogden, UT]
  • 15.  Dodd, Norris L. 1988. Fire management and southwestern raptors. In:        Gliski, R. L.; Pendleton, Beth Giron; Moss, Mary Beth; [and others]
  • 27.  Landers, J. Larry. 1987. Prescribed burning for managing wildlife in        southeastern pine forests. In: Dickson, James G.; Maughan, O. Eugene,        eds. Managing southern forests for wildlife and fish: a proceedings;        [Date of conference unknown]

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Relevance to Humans and Ecosystems

Benefits

Economic Importance for Humans: Negative

There are no known negative effects of red-tailed hawks on humans.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Economic Importance for Humans: Positive

Red-tailed hawks help farmers by eating mice, moles and other rodents that disturb their crops.

Positive Impacts: controls pest population

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Economic Importance for Humans: Negative

There are no known negative effects of red-tailed hawks on humans.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Economic Importance for Humans: Positive

Red-tailed hawks help farmers by eating mice, moles and other rodents that disturb their crops.

Positive Impacts: controls pest population

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Wikipedia

Red-tailed Hawk

The Red-tailed Hawk (Buteo jamaicensis) is a bird of prey, one of three species colloquially known in the United States as the "chickenhawk," though it rarely preys on standard sized chickens.[2] It breeds throughout most of North America, from western Alaska and northern Canada to as far south as Panama and the West Indies, and is one of the most common buteos in North America. Red-tailed Hawks can acclimate to all the biomes within their range. There are fourteen recognized subspecies, which vary in appearance and range. It is one of the largest members of the genus Buteo in North America, typically weighing from 690 to 1600 grams (1.5 to 3.5 pounds) and measuring 45–65 cm (18 to 26 in) in length, with a wingspan from 110 to 145 cm (43 to 57 in). The Red-tailed Hawk displays sexual dimorphism in size, with females averaging about 25% heavier than males.[3]

The Harlan's Hawk (B. j. harlani), often considered a separate species, is treated below in the Taxonomy section.

The Red-tailed Hawk occupies a wide range of habitats and altitudes, including deserts, grasslands, coniferous and deciduous forests, tropical rainforests, agricultural fields and urban areas. It lives throughout the North American continent, except in areas of unbroken forest or the high arctic. It is legally protected in Canada, Mexico and the United States by the Migratory Bird Treaty Act.

Because they are so common and easily trained as capable hunters, the majority of hawks captured for falconry in the United States are Red-tails. Falconers are permitted to take only passage hawks (which have left the nest, are on their own, but are less than a year old) so as to not affect the breeding population. Adults, which may be breeding or rearing chicks, may not be taken for falconry purposes and it is illegal to do so. Passage red-tailed hawks are also preferred by falconers because these younger birds have not yet developed adult behaviors, which will make training substantially more challenging.

Contents

Description [edit]

A male Red-Tailed Hawk may weigh from 690 to 1,300 g (24 to 46 oz), with a mean weight of 1,030 g (2.3 lb), and measure 45–60 cm (18–24 in). A female can weigh between 900 and 2,000 g (32 and 71 oz), averaging 1,220 g (2.7 lb), and measure 48 to 65 cm (19 to 26 in) long. The wingspan can range from 105 to 141 cm (41 to 56 in) and, in the standard scientific method of measuring wing size, the wing bone is 33–44 cm (13–17 in) long. The tail measures 19–25 cm (7.5–9.8 in) in length.[4][5][6] The exposed culmen was reported to average 2.5–2.7 cm (0.98–1.1 in) and the tarsus averaged 8.6–9 cm (3.4–3.5 in).[7] As is the case with many raptors the Red-tailed Hawk displays sexual dimorphism in size, as females are up to 25% larger than males.[8]

Characteristic red tail

Red-tailed Hawk plumage can be variable, depending on the subspecies and the region. These color variations are morphs, and are not related to molting. The western North American population, B. j. calurus, is the most variable subspecies and has three color morphs: light, dark, and intermediate or rufus. The dark and intermediate morphs constitute 10–20% of the population.[9]

Though the markings and hue vary across the subspecies, the basic appearance of the Red-tailed Hawk is consistent. Overall, this species is blocky and broad in shape, often appearing (and being) heavier than other Buteos of similar length.[4] A whitish underbelly with a dark brown band across the belly, formed by horizontal streaks in feather patterning, is present in most color variations. Especially in younger birds, the underside may be otherwise covered with dark brown spotting. The red tail, which gives this species its name, is uniformly brick-red above and light buff-orange below.[4][10] The bill is short and dark, in the hooked shape characteristic of raptors, and the head can sometimes appear small in size against the thick body frame.[4] They have a relatively short, broad tails and thick, chunky wings.[10] The cere, the legs, and the feet of the Red-tailed Hawk are all yellow.[8]

Immature birds can be readily identified at close range by their yellowish irises. As the bird attains full maturity over the course of 3–4 years, the iris slowly darkens into a reddish-brown hue. In both the light and dark morphs, the tail of the immature Red-tailed Hawk are patterned with numerous darker bars.[10]

Taxonomy [edit]

Red Tailed Hawk hovers in the wind
In flight showing the red tail

The Red-Tailed Hawk is a member of the genus Buteo, a group of medium-sized raptors with robust bodies and broad wings. Members of this genus are known as buzzards in Europe, but hawks in North America.[11]

There are at least 14 recognized subspecies of Buteo jamaicensis, which vary in range and in coloration:

  • B. j. jamaicensis, the nominate subspecies, occurs in the northern West Indies, including Jamaica, Hispaniola, Puerto Rico and the Lesser Antilles but not the Bahamas or Cuba. El Yunque National Forest, Puerto Rico holds the highest known density of Red-tailed Hawks anywhere.[12]
  • B. j. alascensis breeds (probably resident) from southeastern coastal Alaska to the Queen Charlotte Islands and Vancouver Island in British Columbia.[13]
  • B. j. borealis breeds from southeast Canada and Maine south through eastern Texas and east to northern Florida. It winters from southern Ontario east to southern Maine and south to the Gulf coast and Florida.[13]
  • B. j. calurus breeds from central interior Alaska, through western Canada south to Baja California. It winters from southwestern British Columbia southwest to Guatemala and northern Nicaragua.[13] Paler individuals of northern Mexico may lack the dark wing marking.[14]
  • B. j. costaricensis is resident from Nicaragua to Panama. This subspecies is dark brown above with cinnamon flanks, wing linings and sides, and some birds have rufous underparts. The chest is much less heavily streaked than in northern migrants (B. j. calurus) to Central America.
  • B. j. fuertesi breeds from northern Chihuahua to southern Texas. It winters in Arizona, New Mexico, and southern Louisiana.[13] The belly is unstreaked or only lightly streaked, and the tail is pale.
  • B. j. fumosus Islas Marías, Mexico
  • B. j. hadropus Mexican Highlands
  • B. j. harlani, Harlan's Hawk, is markedly different from all other Red-tails. In both color morphs, the plumage is blackish and white, lacking warm tones (save the tail). The tail may be reddish, dusky, whitish, or gray and can be longitudinally streaked, mottled, or barred. Shorter primaries result in wingtips that don't reach the tail in perched birds. It breeds in Alaska and northwestern Canada and winters from Nebraska and Kansas to Texas and northern Louisiana.[13] This population may well be a separate species.
  • B. j. kemsiesi is a dark subspecies resident from Chiapas to Nicaragua. The dark wing marking may not be distinct in paler birds.[14]
  • B. j. kriderii is paler than other Red-tails, especially on the head; the tail may be pinkish or white. In the breeding season, it occurs from southern Alberta, southern Saskatchewan, southern Manitoba, and extreme western Ontario south to south-central Montana, Wyoming, western Nebraska, and western Minnesota. In winter, it occurs from South Dakota and southern Minnesota south to Arizona, New Mexico, Texas and Louisiana.[13]
  • B. j. socorroensis Socorro Island, Mexico
  • B. j. solitudinus Bahamas and Cuba
  • B. j. umbrinus occurs year-round in peninsular Florida north to Tampa Bay and the Kissimmee Prairie.[13] It is similar in appearance to calurus

The four island forms, jamaicensis, solitudinus, socorroensis, and fumosus, do not overlap in range with any other subspecies.

Distribution and habitat [edit]

Immature in California, USA

The Red-tailed Hawk is one of the most widely distributed hawks in the Americas. It breeds from central Alaska, the Yukon, and the Northwest Territories east to southern Quebec and the Maritime Provinces of Canada, and south to Florida, the West Indies, and Central America. The winter range stretches from southern Canada south throughout the remainder of the breeding range.[13]

Its preferred habitat is mixed forest and field, with high bluffs or trees that may be used as perch sites. It occupies a wide range of habitats and altitudes, including deserts, grasslands, coastal regions, mountains, foothills of mountains coniferous and deciduous woodlands, tropical rainforests, agricultural fields and urban areas.[1] It is second only to the Peregrine Falcon in the use of diverse habitats in North America.[15] It lives throughout the North American continent, except in areas of unbroken forest or the high Arctic.[9]

The Red-tailed Hawk is widespread in North America,[15] partially due to historic settlement patterns, which have benefited it. The clearing of forests in the Northeast created hunting areas, while the preservation of woodlots left the species with viable nest sites. The planting of trees in the west allowed the Red-tailed Hawk to expand its range by creating nest sites where there had been none. The construction of highways with utility poles alongside treeless medians provided perfect habitat for perch-hunting. Unlike some other raptors, the Red-tailed Hawk are seemingly unfazed by considerable human activity and can nest and live in close proximity to large numbers of humans.[4] Thus, the species can also be found in cities, where common prey such as rock pigeons and brown rats may support their populations.[16] One urban Red-tailed Hawk, known as "Pale Male", became famous for being the first Red-tail in decades to successfully nest and raise young in the crowded New York City borough of Manhattan.[17]

Behavior [edit]

Flight [edit]

In flight, this hawk soars with wings often in a slight dihedral, flapping as little as possible to conserve energy. Active flight is slow and deliberate, with deep wing beats. In wind, it occasionally hovers on beating wings and remains stationary above the ground.[9] When soaring or flapping its wings, it typically travels from 20 to 40 mph (64 km/h), but when diving may exceed 120 mph (190 km/h).[18]

Vocalization [edit]

Red-tailed hawk02.jpg

The cry of the Red-tailed Hawk is a two to three second hoarse, rasping scream, described as kree-eee-ar,[16] which begins at a high pitch and slurs downward.[18] This cry is often described as sounding similar to a steam whistle.[8] The Red-tailed Hawk frequently vocalizes while hunting or soaring, but vocalizes loudest in annoyance or anger, in response to a predator or a rival hawk's intrusion into its territory.[16] At close range, it makes a croaking "guh-runk".[19] Young hawks may utter a wailing klee-uk food cry when parents leave the nest.[20] The fierce, screaming cry of the Red-tailed Hawk is frequently used as a generic raptor sound effect in television shows and other media, even if the bird featured is not a Red-tailed Hawk.[21]

Diet [edit]

The Red-tailed Hawk is carnivorous, and an opportunistic feeder. Its diet is mainly small mammals, but it also includes birds and reptiles. Prey varies with regional and seasonal availability, but usually centers on rodents, comprising up to 85% of a hawk's diet.[8] Most commonly reported prey types include mice, including both native Peromyscus species and house mice, gophers, voles, chipmunks, ground squirrels and tree squirrels.[22][23] Additional prey (listed by descending likelihood of predation) include lagomorphs, shrews, bats, pigeons, quail, corvids, waterfowl, other raptors, reptiles, fish, crustaceans, insects and earthworms.[4] Where found in Caribbean islands, Red-tailed Hawks prey mostly on reptiles such as snakes and lizards, since these are perhaps the most predominant native land animals of that region.[4] Prey specimens can range to as small a size as beetles and worms. However, they can also prey on marmots, White-tailed Jackrabbits, small domestic dogs, domestic cats, or female Wild Turkey, all of which are easily double the weight of most Red-tails.[4] Although they prefer to feed on fresh prey they've killed themselves, these hawks are not above occasionally consuming carrion. During winter in captivity, an average Red-tail will eat about 135 g (4–5 oz) daily.[20]

The Red-tailed Hawk commonly employ one of two hunting technique. Often, they scan for prey activity from an elevated perch site, swooping down from the perch to seize the prey. They also watch for prey while flying, either capturing a bird in flight or pursuing prey on the ground until they can pin them down in their talons.[4] Red-tailed Hawks, like some other raptors, have been observed to hunt in pairs. This may consist of stalking opposites sides of a tree, in order to surround a tree squirrel and almost inevitably drive the rodent to be captured by one after being flushed by the other hawk.[24] They are opportunistically attracted to conspicuous meals, such as displaying male Red-winged Blackbirds.[8]

Juvenile eating a squirrel

The Great Horned Owl occupies a similar ecological niche nocturnally to the Red-tail, taking similar prey. Competition may occur between the Red-tailed Hawk and the Great Horned Owl during twilight, although the differing nesting season and activity times usually results in a lack of direct competition. Although the Red-tailed's prey is on average larger (due in part to the scarcity of diurnal squirrels in the Owl's diet),[23] the Great Horned Owl is an occasional predator of Red-tailed Hawks of any age, while the hawks are not known to predate adult Horned Owls.[22] Other competitors include other large Buteos such as Swainson's Hawks and Rough-legged Hawks as well as the Northern Goshawk, since prey and foraging methods of these species occasionally overlap.[25][26] Hawks have been observed following American Badgers to capture prey they flush and the two are considered potential competitors.[27] Competition over carcasses may occur with American Crows and several crows working together can displace a hawk.[28] Larger raptors, such as eagles and Ferruginous Hawks, may steal hawk kills.[8]

Reproduction [edit]

Territorial adult chasing away an immature Red Tailed Hawk

The Red-tailed Hawk reaches sexual maturity at two years of age. It is monogamous, mating with the same individual for many years. In general, the Red-tailed Hawk will only take a new mate when its original mate dies.[29] The same nesting territory may be defended by the pair for years. During courtship, the male and female fly in wide circles while uttering shrill cries. The male performs aerial displays, diving steeply, and then climbing again. After repeating this display several times, he sometimes grasps her talons briefly with his own. Courtship flights can last 10 minutes or more. Copulation often follows courtship flight sequences, although copulation frequently occurs in the absence of courtship flights.

In copulation, the female, when perched, tilts forward, allowing the male to land with his feet lodged on her horizontal back. The female twists and moves her tail feathers to one side, while the mounted male twists his cloacal opening around the female's cloaca. Copulation lasts 5 to 10 seconds and during pre-nesting courtship in late winter or early spring can occur numerous times each day.[30]

In the same period, the pair constructs a stick nest in a large tree 4 to 21 m (13 to 69 ft) off the ground or on a cliff ledge 35 m (115 ft) or higher above the ground, or may nest on man-made structures. The nest is generally 71 to 97 cm (28 to 38 inches) in diameter and can be up to 90 cm (3 ft) tall. The nest is constructed of twigs, and lined with bark, pine needles, corn cobs, husks, stalks, aspen catkins, or other plant lining matter.

Great Horned Owls compete with the Red-tailed Hawk for nest sites. Each species has been known to kill the young and destroy the eggs of the other, but in general, both species nest in adjacent or confluent territories without conflict. Great Horned Owls are incapable of constructing nests and typically expropriate existing Red-tail nests. Great Horned Owls begin nesting behaviors much earlier than Red-tails, often as early as December. Red-tails are therefore adapted to constructing new nests when a previous year's nest has been overtaken by owls or otherwise lost. New nests are typically within a kilometer or less of the previous nest. Often, a new nest is only a few hundred meters or less from a previous one. Being a large predator, most predation of these hawks occurs with eggs and nestlings, which are taken by owls, corvids and raccoons.[31]

Parent in nest with chicks

A clutch of 1 to 3 eggs is laid in March or April, depending upon latitude. Clutch size depends almost exclusively on the availability of prey for the adults. Eggs are laid approximately every other day. The eggs are usually about 60 x 47 mm (2.4 x 1.9 in). They are incubated primarily by female, with the male substituting when the female leaves to hunt or merely stretch her wings. The male brings most food to the female while she incubates. After 28 to 35 days, the eggs hatch over 2 to 4 days; the nestlings are altricial at hatching. The female broods them while the male provides most of the food to the female and the young, which are known as eyasses (pronounced "EYE-ess-ez"). The female feeds the eyasses after tearing the food into small pieces. After 42 to 46 days, the eyasses begin to leave the nest. The fledging period follows, with short flights engaged in, after another 3 weeks. About 6 to 7 weeks after fledging, the young begin to capture their own prey. Shortly thereafter, when the young are around 4 months of age, they become independent of their parents. However, the hawks do not generally reach breeding maturity until they are around 3 years of age. In the wild, Red-tailed Hawks have lived for at least 21 years. The oldest captive hawk of this species was at least 29 and a half years of age.[8]

Relationship with humans [edit]

The non-fiction book Red-Tails in Love: A Wildlife Drama in Central Park by Marie Winn made Pale Male, is about the most famous urban Red-tailed Hawk in New York.[32]

In the popular children's book series Animorphs, the character Tobias lives trapped in the body of a red-tailed hawk.

Use in falconry [edit]

The Red-tailed Hawk is a popular bird in falconry, particularly in the United States where the sport of falconry is tightly regulated at the federal and state levels. There are fewer than 5,000 falconers in the United States, therefore any effect on the Red-tailed Hawk population, estimated to be about one million in the United States, is statistically insignificant.[33]

In the course of a hunt, a falconer using a Red-tailed Hawk most commonly releases the hawk and allows it to perch in a tree or other high vantage point. The falconer, who may be aided by a dog, then attempts to flush prey by stirring up ground cover. A well-trained Red-tailed Hawk will follow the falconer and dog, realizing that their activities produce opportunities to catch game. Once a raptor catches game, it does not bring it back to the falconer. Instead, the falconer must locate the bird and its captured prey, "make in", (carefully approach) and trade the bird its kill in exchange for a piece of offered meat.[34]

Feathers and Native American use [edit]

The feathers and other parts of the Red-tailed Hawk are considered sacred to many American indigenous people and, like the feathers of the Bald Eagle and Golden Eagle, are sometimes used in religious ceremonies and found adorning the regalia of many Native Americans in the United States; these parts, most especially their distinctive tail feathers, are a popular item in the Native American community.[35] As with the other two species, the feathers and parts of the Red-tailed Hawk are regulated by the eagle feather law,[36] which governs the possession of feathers and parts of migratory birds.[37]

References [edit]

  1. ^ a b BirdLife International (2012). "Buteo jamaicensis". IUCN Red List of Threatened Species. Version 2012.1. International Union for Conservation of Nature. Retrieved 16 July 2012. 
  2. ^ "Red-tailed Hawk". All About Birds. Cornell University. Retrieved 16 May 2011. 
  3. ^ "Red-tailed Hawk". Encyclopedia of Life. Retrieved 21 March 2012. 
  4. ^ a b c d e f g h i Raptors of the World by Ferguson-Lees, Christie, Franklin, Mead & Burton. Houghton Mifflin (2001), ISBN 0-618-12762-3
  5. ^ Red-tailed Hawk videos, photos and facts. Arkive.org. Retrieved on 2012-08-22.
  6. ^ CRC Handbook of Avian Body Masses by John B. Dunning Jr. (Editor). CRC Press (1992), ISBN 978-0-8493-4258-5.
  7. ^ Sex Determination of Red-Tailed Hawks (Buteo jamaicensis calurus). Scholarworks.boisestate.edu (2006-02-27). Retrieved on 2012-08-22.
  8. ^ a b c d e f g Dewey, T.; Arnold, D. "Buteo jamaicensis". Retrieved 5 June 2007. 
  9. ^ a b c "Red-tailed Hawk". Bureau of Land Management. Retrieved 12 January 2010. 
  10. ^ a b c "Buteo jamaicensis". U.S. Geological Survey. Retrieved 5 June 2007. 
  11. ^ "Buteo jamaicensis (J. F. Gmelin, 1788)". Integrated Taxonomic Information System. Retrieved 16 May 2011. 
  12. ^ The Lords of the Air. Kingsnake.com. Retrieved on 2012-08-22.
  13. ^ a b c d e f g h Tesky, Julie L. "Buteo jamaicensis". United States Department of Agriculture. Retrieved 10 June 2007. 
  14. ^ a b Howell, Steve N. G.; Webb, Sophie (1995). A Guide to the Birds of Mexico and Northern Central America. Oxford University Press. ISBN 0-19-854012-4. 
  15. ^ a b Garrigues, Jeff. "Biogeography of Red-tailed hawk". San Francisco State University Department of Geography. Retrieved 28 June 2007. 
  16. ^ a b c "Red-tailed Hawk". Sky-hunters.org. Retrieved 16 June 2007. [dead link]
  17. ^ Pale Male – Introduction – Red-tailed Hawk in New York City | Nature. PBS (May 2004). Retrieved on 2012-08-22.
  18. ^ a b Day, Leslie. "The City Naturalist – Red Tailed Hawk". 79th Street Boat Basin Flora and Fauna Society. Retrieved 17 June 2007. [dead link]
  19. ^ "Red-Tailed Hawk". Oregon Zoo. Retrieved 16 June 2007. 
  20. ^ a b "Red-tailed Hawk – Buteo jamaicensis". The Hawk Conservancy Trust. Retrieved 5 June 2007. 
  21. ^ "San Diego Zoo's Animal Bytes: Red-Tailed Hawk". San Diego Zoo. Retrieved 3 March 2012. 
  22. ^ a b Springer, Mark Andrew; Kirkley, John Stephen (1978). "Inter and Intraspecific interactions between Red-Tailed Hawks and Great Horned Owls in Central Ohio". The Ohio Journal of Science 78 (6): 323–328. 
  23. ^ a b Marti, Carl D.; Kochert, Michael N. (1995). "Are Red-tailed Hawks and Great Horned Owls diurnal–nocturnal dietary counterparts?" (PDF). Wilson Bulletin 107 (4): 615–628. JSTOR 4163598. 
  24. ^ Red-tailed Hawk, Life History, All About Birds – Cornell Lab of Ornithology. Allaboutbirds.org. Retrieved on 2012-08-22.
  25. ^ Walter Feller. "Red-tailed Hawk". Desert Wildlife. Digital-Desert. Retrieved 16 May 2011. 
  26. ^ Gatto, Angela E.; Grubb, Teryl G.; Chambers, Carol L. (2006). "Red-tailed Hawk dietary overlap with Northern Goshawks on the Kaibab Plateau, Arizona" (PDF). Journal of Raptor Research 39 (4): 439–444. 
  27. ^ Patrick K. Devers, Kiana Koenen & Paul R. Krausman (2004). "Interspecific interactions between badgers and red-tailed hawks in the Sonoran Desert, southwestern Arizona". The Southwestern Naturalist 49 (1): 109–111. doi:10.1894/0038-4909(2004)049<0109:IIBBAR>2.0.CO;2. JSTOR 3672278. 
  28. ^ Langley, William (2001). "Competition between American crows and red-tailed hawks for a carcass: flock advantage". Transactions of the Kansas Academy of Science 104 (1&2): 28–30. doi:10.1660/0022-8443(2001)104[0028:CBACAR]2.0.CO;2. JSTOR 3628087. 
  29. ^ Terres, John K. (1980). The Audubon Society Encyclopedia of North American Birds. New York: Knopf. p. 1109. ISBN 0-394-46651-9. 
  30. ^ "Buteo jamaicensis". Oiseaux.net. Retrieved 7 June 2007. 
  31. ^ "Red-tailed Hawk, Buteo jamaicensis". Study of Northern Virginia Ecology. Fairfax County Public Schools. Retrieved 16 May 2011. 
  32. ^ Geist, Bill (10 July 2003). "In Love With A Hawk". CBS. Retrieved 17 June 2007. 
  33. ^ "Migratory Bird Permits; Changes in the Regulations Governing Falconry; Notice of Intent To Prepare an Environmental Assessment for Falconry and Raptor Propagation Activities; Proposed Rule and Notice". Department of the Interior: Fish and Wildlife Service. Archived from the original on 11 March 2007. Retrieved 14 June 2007. 
  34. ^ McGranaghan, Liam J. (2001). The Red-Tailed Hawk: A Complete Guide to Training and Hunting North America's Most Versatile Game Hawk. Western Sporting Publications. p. 181. ISBN 0-9709571-0-6. 
  35. ^ Collier, Julie. "The Sacred Messengers". Mashantucket Pequot Museum. Retrieved 20 June 2007. 
  36. ^ "TITLE 50—Wildlife and Fisheries". Electronic Code of Federal Regulations (e-CFR). Retrieved 20 June 2007. 
  37. ^ Cook, Stephen. "Feather Law". Mashantucket Pequot Museum. Retrieved 20 June 2007. 
Creative Commons Attribution Share Alike 3.0 (CC BY-SA 3.0)

 

Source: Wikipedia

Unreviewed

Article rating from 0 people

Average rating: 2.5 of 5

Names and Taxonomy

Taxonomy

Comments: Includes B. harlani, formerly regarded as a separate species (AOU 1998). See Mindell (1983) for information on the taxonomic status of harlani.

The phylogenetic status of the nominal subspecies needs to be evaluated with genetic techniques; do the geographic color variations represent distinct evolutionary lineages?

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!