Articles on this page are available in 1 other language: Spanish (1) (learn more)

Overview

Distribution

Range

N Peru to Tierra del Fuego and Falkland Is.; winters to Uruguay.

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Ecology

Habitat

Habitat and Ecology

Systems
  • Terrestrial
  • Marine
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Associations

Known prey organisms

Haematopus ater preys on:
Fissurellidae
limpets
Concholepas concholepas

Based on studies in:
Chile, central Chile (Littoral, Rocky shore)

This list may not be complete but is based on published studies.
  • J. C. Castilla, Perspectivas de investigacion en estructura y dinamica de communidades intermareales rocosas de Chile Central. II. Depredadores de alto nivel trofico, Medio Ambiente 5(1-2):190-215, from p. 203 (1981).
Creative Commons Attribution 3.0 (CC BY 3.0)

© SPIRE project

Source: SPIRE

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Barcode data: Haematopus ater

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There are 3 barcode sequences available from BOLD and GenBank.  Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.  See the BOLD taxonomy browser for more complete information about this specimen and other sequences.

AACCGATGATTATTCTCAACCAACCACAAAGACATCGGTACCCTATACCTAATCTTTGGTGCATGAGCCGGTATAGTTGGTACCGCCCTTAGCTTACTTATCCGAGCAGAACTAGGCCAACCTGGAACCCTACTAGGAGAC---GATCAAATTTACAATGTAGTCGTTACAGCCCATGCCTTTGTAATAATCTTCTTCATAGTCATACCAATTATGATCGGCGGATTCGGAAATTGATTAGTCCCGCTCATAATTGGTGCTCCTGACATAGCATTTCCTCGCATAAACAACATAAGCTTTTGGCTACTACCCCCATCATTCCTACTCCTCCTTGCTTCCTCTACAGTAGAAGCAGGAGCAGGCACAGGATGAACCGTATATCCCCCCCTAGCTGGCAACCTTGCCCACGCTGGGGCTTCAGTAGACCTGGCAATCTTCTCCCTCCATCTAGCAGGTGTATCCTCTATCTTAGGCGCAATCAATTTTATCACAACCGCTATCAACATAAAACCACCTGCCCTCTCACAATACCAAACTCCCCTATTTGTATGATCCGTACTCATCACCGCCGTCCTACTACTCCTATCCCTGCCAGTTCTCGCTGCCGGCATCACAATACTCCTAACAGATCGAAACCTAAACACTACATTCTTCGATCCCGCCGGAGGTGGCGATCCAGTCCTATACCAACACCTATTCTGATTCTTCGGTCACCCAGAAGTCTATATTTTAATCCTACCAGGCTTCGGAATCATCTCCCACGTAGTAACATATTACGCAGGTAAAAAAGAACCATTCGGCTACATAGGAATAGTATGAGCCATACTATCAATCGGATTCCTAGGCTTTATCGTCTGAGCCCACCACATATTTACAGTAGGAATAGACGTAGACACCCGAG
-- end --

Download FASTA File
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Statistics of barcoding coverage: Haematopus ater

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 3
Specimens with Barcodes: 7
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Conservation

Conservation Status

IUCN Red List Assessment


Red List Category
LC
Least Concern

Red List Criteria

Version
3.1

Year Assessed
2012

Assessor/s
BirdLife International

Reviewer/s
Butchart, S. & Symes, A.

Contributor/s

Justification
This species has a very large range, and hence does not approach the thresholds for Vulnerable under the range size criterion (Extent of Occurrence <20,000 km2 combined with a declining or fluctuating range size, habitat extent/quality, or population size and a small number of locations or severe fragmentation). The population trend is not known, but the population is not believed to be decreasing sufficiently rapidly to approach the thresholds under the population trend criterion (>30% decline over ten years or three generations). The population size may be moderately small to large, but it is not believed to approach the thresholds for Vulnerable under the population size criterion (<10,000 mature individuals with a continuing decline estimated to be >10% in ten years or three generations, or with a specified population structure). For these reasons the species is evaluated as Least Concern.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Population

Population Trend
Unknown
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Wikipedia

Blackish Oystercatcher

The Blackish Oystercatcher (Haematopus ater) is a species of wading bird in the oystercatcher family Haematopodidae. It is found in Argentina, Chile, the Falkland Islands and Peru, and is a vagrant to Uruguay. The population is estimated at 15,000–80,000.[2]

Description[edit]

The plumage of the Blackish Oystercatcher is slaty-black with wings and back being rather dark brown. The long bill is blood-red and the legs are white. The sexes are similar in appearance. The Blackish Oystercatcher is easily overlooked on a rocky shore. Its dark colour blends in with the colour of the rocks on which it walks as it forages, and it does not draw attention to itself. Its presence, however, can easily be detected by its loud and distinctive warning calls. The song of the Blackish Oystercatcher, when given in duet, consists of an excited chatter of piping whistles. Calls include notes that sound like "pip" and "peeeeyeeee".

Distribution and habitat[edit]

The Blackish Oystercatcher is native to the coasts of Argentina, Chile, the Falkland Islands and Peru, and it is a vagrant to Uruguay.[1] The natural habitats of the Blackish Oystercatcher are rocky shores. It feeds in the intertidal zone on rocky shorelines, in rockpools and on pebble beaches. Rarely, it can be found on sandy beaches hunting for mole crabs.[3]

Status[edit]

The IUCN rates the Blackish Oystercatcher as being of "Least Concern". It is not clear whether the population is increasing or decreasing, but the bird has a very large range and a total population estimated to be somewhere between 15,000 and 80,000 individuals.[1]

Gallery[edit]

See also[edit]

References[edit]

Media related to Haematopus ater at Wikimedia Commons

  1. ^ a b c BirdLife International (2012). "Haematopus ater". IUCN Red List of Threatened Species. Version 2013.2. International Union for Conservation of Nature. Retrieved 26 November 2013. 
  2. ^ http://www.birdlife.org/datazone/species/index.html?action=SpcHTMDetails.asp&sid=3098&m=0
  3. ^ http://mundoazul.org/habitats-species/shore-birds-waterfowl/blackish-oystercatcher-haematopus-ater/
Creative Commons Attribution Share Alike 3.0 (CC BY-SA 3.0)

Source: Wikipedia

Unreviewed

Article rating from 0 people

Average rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!