Articles on this page are available in 1 other language: Spanish (11) (learn more)

Overview

Brief Summary

Accipiter cooperii

The Cooper’s Hawk is often confused with its slightly smaller relative, the Sharp-shinned Hawk. Both species are blue-gray above and streaked rusty-red below with long tails, yellow legs, and small, hooked beaks. However, the Cooper’s Hawk has a rounded tail (Sharp-shinned Hawks have a squared-off tail), and is slightly larger at 14-20 inches long. Like most species of raptors, females are larger than males. Although Cooper’s Hawks may be found all year across the majority of the United States, individual populations make short migrations as the seasons change. In winter, Canadian populations move south into the U.S.and southern populations move south to the Gulf coast, southern Florida, and the desert southwest. In its range, the Cooper’s Hawk is one of the most numerous and adaptable raptors. While usually found in forest habitats, this species has expanded into human-altered landscapes and now frequents towns and suburbs as well. The Cooper’s Hawk is a ‘bird hawk’ capable of hunting birds from the air, and frequently enters yards to take small songbirds from feeders. With the aid of binoculars, Cooper’s Hawks may be seen perched in trees while scanning for prey. However, they are often more easily seen in the air while moving between perches or while actively hunting. As this species hunts by sight, it is only active during the day.

Threat Status: Least concern

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Unknown

Supplier: DC Birds

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Distribution

occurs (regularly, as a native taxon) in multiple nations

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Geographic Range

Cooper's hawks are native to North and Central America. They can be found throughout southern Canada, the United States, and Central America. Many Cooper's hawks are migratory and populations often move north to breed. In most of the United States you can find Cooper's hawks year-round. They migrate to Central America for the winter.

Biogeographic Regions: nearctic (Native ); neotropical (Native )

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: BioKIDS Critter Catalog

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Range

Woodlands of s Canada and US; winters to Central America.

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Geographic Range

Cooper's hawks are native to the Nearctic and Neotropical regions. They can be found throughout southern Canada and the United States. They winter as far north as the northern United States and southern Ontario, and as far south as Costa Rica.

Biogeographic Regions: nearctic (Native ); neotropical (Native )

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

National Distribution

Canada

Origin: Native

Regularity: Regularly occurring

Currently: Present

Confidence: Confident

Type of Residency: Year-round

United States

Origin: Native

Regularity: Regularly occurring

Currently: Present

Confidence: Confident

Type of Residency: Year-round

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.0 of 5

Physical Description

Morphology

Physical Description

Cooper's hawks are medium-sized birds with long, lean bodies. Individuals in the western part of the range are usually smaller than those in the east. Male length ranges from 35 to 46 cm and length of females ranges from 42 to 50 cm. The average mass of males ranges from 280 g in western males to 349 g for eastern males. The average mass of females ranges from 439 g for western females to 566 g for eastern females. Cooper's hawks have a wingspan of 75 to 94 cm.

Adult Cooper's hawks have a dark blackish crown and a lighter colored neck. The back is blue-gray and the tail has several dark bands and a white band at the tip. The eyes of these hawks, like most predatory birds, face forward which gives them good depth perception for hunting and catching prey at high speeds. The hooked bill is important for tearing the flesh of their prey. In flight, Cooper's hawks display a long barred tail and rather short and rounded wings. Cooper's hawks beat their wings quickly and are able to fly very well through heavily wooded areas.

Cooper's hawks can sometimes be confused with Accipiter striatus, which are smaller (25 to 35 cm) and have a less distinct dark crown and a tail that is more square in shape.

Range mass: 280 to 566 g.

Range length: 35 to 50 cm.

Range wingspan: 75 to 94 cm.

Other Physical Features: endothermic ; homoiothermic; bilateral symmetry

Sexual Dimorphism: sexes alike; female larger

  • Peterson, R., V. Peterson. 2002. A field guide to the birds of Eastern and Central North America, Fifth Edition. New York: Houghton Mifflin Company.
  • Chipper Woods Bird Observatory, 1998. "Cooper's Hawk" (On-line). Accessed July 10, 2000 at http://www.wbu.com./chipperwoods/photos/coophawk.htm.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: BioKIDS Critter Catalog

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Physical Description

Cooper's hawks are medium-sized birds with long, lean-bodies. Individuals in the western part of the range tend to be smaller than those in the east. Male length ranges from 35 to 46 cm and length of female ranges from 42 to 50 cm. The average mass of males ranges from 280 g in western males to 349 g for eastern males. The average mass of females ranges from 439 g for western females to 566 g for eastern females. Cooper's hawks have a wingspan of 75 to 94 cm.

Adult Cooper's hawks have a dark blackish crown that is noticeably set off from a lighter nape. They have a blue-gray back and a tail that is crossed by several dark bands and has a distinct white band at its tip. In flight, Cooper's hawks exhibits a long barred tail and rather short and rounded wings.

The eyes of this hawk, like most predatory birds, face forward, giving it good depth perception for hunting and catching prey while flying at high speeds. The hooked bill is well adapted to tearing the flesh of prey. A swift flyer, the Cooper's hawk has a rapid wingbeat and is able to negotiate heavily vegetated woodland habitats.

Cooper's hawks can be easily confused with sharp-shinned hawks, which are smaller (25 to 35 cm) and have a less distinct dark crown and a tail that is square at the tip, unlike the rounded tip of the Cooper’s hawk’s tail. Cooper’s hawks also exhibit slower, stiffer wingbeats than sharp-shinned hawks.

Range length: 35 to 50 cm.

Average length: 39 cm.

Range wingspan: 74 to 94 cm.

Sexual Dimorphism: female larger

Average mass: 526.64 g.

  • Peterson, R., V. Peterson. 2002. A field guide to the birds of Eastern and Central North America, Fifth Edition. New York: Houghton Mifflin Company.
  • Chipper Woods Bird Observatory, 1998. "Cooper's Hawk" (On-line). Accessed July 10, 2000 at http://www.wbu.com./chipperwoods/photos/coophawk.htm.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Size

Length: 51 cm

Weight: 529 grams

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Diagnostic Description

Differs from sharp-shinned hawk (ACCIPITER STRIATUS) by longer, more rounded tail that has a wider white terminal band; larger head; and (in adult) stronger contrast between the dark crown and paler nape and back. Differs from goshawk (ACCIPITER GENTILIS) in smaller size (average length 36-51 centimeters vs. 53-66 centimeters), lack of conspicuous pale eyebrow, less conspicuous white undertail coverts, broader white tip on tail, and proportionately longer tail and shorter wings (NGS 1983).

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Ecology

Habitat

Comments: BREEDING: Primarily mature forest, either broadleaf or coniferous, mostly the former; also open woodland and forest edge (AOU 1983, Rosenfield and Bielefeldt 1993). Nests in both pine and hardwood groves, and riparian cottonwoods and sycamores in the West; Douglas-fir in northeastern Oregon. Usually builds new nest on horizontal limb near trunk or in crotch, 6-18 meters above ground; may modify old one or squirrel or crow nest. Campbell et al. (1990) reported one instance of a nest being reused for six consecutive years in British Columbia. Rosenfield and Bielefeldt (1992) found that nesting areas were irregularly reused by the same or different adults in subsequent years.

In Nevada, Cooper's Hawks were frequently sighted in montane forests and pinyon-juniper woodlands, but riparian habitat was recorded as well (Floyd et al. 2007). In California, this species is seldom found in areas without dense tree stands, or patchy woodland habitat. It nests in deciduous trees in crotches 3-23 m (10-80 ft), but usually 6-15 m (20-50 ft), above the ground. It also nests in conifers on horizontal branches, in the main crotch, often just below the lowest live limbs. They usually nest in second-growth conifer stands, or in deciduous riparian areas, usually near streams. They frequent landscapes where wooded areas occur in patches and groves (Beebe 1974) and often use patchy woodlands and edges with snags for perching (CDFG 2011). Cooper's Hawks tend to use older, taller, and less dense woodlots than Sharp-shinned Hawks in California (Rosenfield and Bielefeldt 1993). In southern California, Cooper's Hawk generally favors extensive riparian bottomlands (Garrett and Dunn 1981). In Oregon, nests were in stands of conifers that included older and taller trees, a deeper crown, and a more open understory than a typical single-story Sharp-shinned Hawk nest stand (Reynolds et al. 1982). See also Grindrod and Walton Cooper's Hawk account at http://www.blm.gov/ca/pdfs/cdd_pdfs/coha.pdf.

Generally is an inhabitant of deep woods, utilizing thick cover both for nesting and hunting. Openings, especially where hedgerows or windbreaks offer shelter for prey species, may also be used when foraging. Johnsgard (1990) states that Cooper's are less fussy about the forest type than sharp-shins, and are more often "associated with deciduous and mixed forests and open woodland habitats such as woodlots, riparian woodlands, semiarid woodlands of the southwest, and other areas where the woodlands tend to occur in patches and groves or as spaced trees."

In the Northwest and Northeast, conifers are used for nesting (Bent 1937, Reynolds et al. 1982), but elsewhere the preference is for hardwoods (Brown and Amadon 1968). In the Northwest a preference may exist also for the cooler microclimates offered by north and east facing slopes (Reynolds et al. 1982). In that area, the Cooper's hawk is typically found in middle-aged stands, 50 - 60 years in age, whereas the sharp-shin prefers younger stands and the goshawk older ones (Reynolds et al. 1982). That difference might express competitive displacement, because in the East, where the goshawk rarely nests, the Cooper's hawk prefers mature stands (Brown and Amadon 1968).

In some areas the species seems to require large tracts of forests and to avoid human contact, in others they may use small forest tracts, (e.g., British Columbia and Nevada), woodlots (e.g., Ohio) or urban/suburban areas where they seem tolerant of human activities (e.g., British Columbia, Utah, Wisconsin, Indiana) (Hennessy 1978, Herron et al. 1985, Campbell et al 1990, Peterjohn and Rice 1991, Rosenfield et al. 1991).

In New Jersey-New York, nested mostly in mixed deciduous-coniferous forest with eastern hemlock the dominant coniferous species at many sites. Tended to nest in areas with relatively large basal area and more canopy cover. Nests located in live overstory trees (43% conifers), typically within the canopy, and always in dense forest but commonly near wetland openings or source of water, on level ground or lower slopes, typically several hundred meters from paved roads (but sometimes within 100 meters or less). Avoided southern exposures (Reynolds et al. 1982, Bosakowski et al. 1992).

A recent study in Missouri documented numerous Cooper's Hawks nesting in young pine plantations in essentially the same habitat as sharp-shins. Also found that trees with deformed crowns were preferred (Wiggers and Kritz 1991). Rosenfield et al. (1991) report that pine plantations are important habitat for breeding Cooper's hawks throughout the Midwest, and particularly in Wisconsin. See Kennedy (1988) for details on nesting habitat in New Mexico.

NON-BREEDING: Migrates mostly along ridges and coastlines (NGS 1983). Winter habitat is much the same as in the nesting season, although open woodlands and fields may be utilized to a greater extent.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Habitat and Ecology

Systems
  • Terrestrial
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Cooper's hawks live in deciduous and mixed forests. They also live in open woodland habitats such as woodlots, riparian woodlands, semi-arid woodlands of the southwest United States, and other areas where woodlands are found in patches.

Habitat Regions: temperate ; terrestrial

Terrestrial Biomes: savanna or grassland ; chaparral ; forest

Other Habitat Features: suburban ; riparian

  • Johnsgard, P. 1990. Hawks,Eagles, and Falcons of North America. Washington DC: Smithsonian Books.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: BioKIDS Critter Catalog

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Coopers hawks are closely associated with deciduous and mixed forests and open woodland habitats such as woodlots, riparian woodlands, semiarid woodlands of the southwest, and other areas where the woodlands occur in patches.

Habitat Regions: temperate ; terrestrial

Terrestrial Biomes: savanna or grassland ; chaparral ; forest

Other Habitat Features: suburban ; riparian

  • Johnsgard, P. 1990. Hawks,Eagles, and Falcons of North America. Washington DC: Smithsonian Books.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Migration

Non-Migrant: Yes. At least some populations of this species do not make significant seasonal migrations. Juvenile dispersal is not considered a migration.

Locally Migrant: Yes. At least some populations of this species make local extended movements (generally less than 200 km) at particular times of the year (e.g., to breeding or wintering grounds, to hibernation sites).

Locally Migrant: Yes. At least some populations of this species make annual migrations of over 200 km.

Northernmost populations migratory (move north mostly March-April, southward late August-early November) but regularly present throughout most of breeding range in winter. Migrates singly or in twos or threes (National Geographic Society 1983). See Palmer (1988) for more information.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Trophic Strategy

Comments: Eats medium-sized birds (e.g., starling, thrush, quail), sometimes small birds and some up to size of adult ruffed grouse, small ground-foraging mammals, occasionally reptiles (especially in southwestern U.S.) and amphibians. Their primary food is other birds; up to 90% of its diet is composed of avian prey, with mid-sized birds such as flickers and starlings being taken preferentially (Kennedy 1980). They are frequently important predators of bobwhites and were at least formerly, before the days of factory farming, raiders of domestic fowl. These food choices have led to a great deal of persecution by humans. Additional foods include small mammals, reptiles, amphibians, and insects (Bent 1937). In the southwest and west mammals and lizards can make up as much as half the food intake (Johnsgard 1990). Young birds comprise a large proportion of the food provided to nestlings. Typically hunts from inconspicuous perch, or uses a longer searching flight. Sometimes attracted to birds at feeders. Birds may not necessarily prevail in the diet (Bielefeldt et al. 1992).

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Food Habits

Cooper's hawks eat mostly birds and small mammals. However, they also eat reptiles and amphibians when they are available. When hunting, Cooper's hawks usually perch in a hidden location and watch for prey. When they see prey, quickly swoop down and seize it. Colinus virginianus, Sturnus vulgaris, Agelaius phoeniceus, Tamias striatus, and squirrels are common prey for Cooper's hawks. Their short, rounded wings make them very maneuverable fliers in dense, forested habitats. These hawks also chase prey on the ground by half running and half flying. The prey taken by an individual Cooper’s hawk depends on its size; larger hawks eat larger prey than smaller hawks.

Cooper's hawks obtain water by scooping water up with their beaks and tipping their heads back to drink. They often nest near rivers or streams and have even been seen in backyard bird baths. They likely obtain water from these sources.

Animal Foods: birds; mammals; amphibians; reptiles

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: BioKIDS Critter Catalog

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Food Habits

Cooper's hawks are predators primarily of birds and small mammals. They also occasionally feed upon reptiles and amphibians. When hunting, Cooper's hawks usually perch in a hidden location and watch for prey. They wait until their prey is unaware of their presence, then quickly swoop down and seize it. Bobwhites, starlings, blackbirds, chipmunks, and squirrels are common prey for Cooper's hawks. Their short, rounded wings make them very maneuverable flyers in dense, forested habitats. These hawks also pursue prey on the ground, half running and half flying. The prey taken by an individual Cooper’s hawk is largely influenced by the size of the bird; larger hawks eat larger prey than smaller hawks.

There is no information available regarding how Cooper's hawks obtain water.

Animal Foods: birds; mammals; amphibians; reptiles

Primary Diet: carnivore (Eats terrestrial vertebrates)

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Associations

Ecosystem Roles

Cooper's hawks impact the populations of the animals they prey on. As high level predators they play an important role in keeping many populations healthy. By keeping prey populations down, birds of prey help them to avoid problems such as disease or food shortage which may occur from overpopulation. They are also hosts for several species of lice and intestinal parasites.

Commensal/Parasitic Species:

  • Internal parasites (Larval dipterans)
  • Mallophagial feather lice
  • Intestinal parasites (Tapeworms)
  • Internal parasites (Helminths)

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: BioKIDS Critter Catalog

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Predation

Adults, nestlings and eggs are vulnerable to predation by Bubo virginianus, Buteo jamaicensis and Accipiter gentilis. Eggs and nestlings are also vulnerable to predation by Procyon lotor and Corvus brachyrhynchos.

Known Predators:

  • Red-tailed hawks (Buteo_jamaicensis)
  • Northern goshawks (Accipiter_gentilis)
  • Raccoons (Procyon_lotor)
  • American crows (Corvus_brachyrhynchos)
  • Great horned owls (Bubo_virginianus)

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: BioKIDS Critter Catalog

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Ecosystem Roles

Cooper's hawks impact the populations of the animals they prey on. They are also hosts for several species of parasites, including larval dipterans, mallophagial lice, tapeworms and helminths.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Predation

Adults, nestlings and eggs are vulnerable to predation by great horned owls, red-tailed hawks and northern goshawks. Eggs and nestlings are also vulnerable to predation by raccoons and American crows.

Known Predators:

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Known prey organisms

  • R. D. Bird, Biotic communities of the Aspen Parkland of central Canada, Ecology, 11:356-442, from p. 410 (1930).
  • R. D. Bird, Biotic communities of the Aspen Parkland of central Canada, Ecology, 11:356-442, from p. 406 (1930).
  • Myers, P., R. Espinosa, C. S. Parr, T. Jones, G. S. Hammond, and T. A. Dewey. 2006. The Animal Diversity Web (online). Accessed February 16, 2011 at http://animaldiversity.org. http://www.animaldiversity.org
Creative Commons Attribution 3.0 (CC BY 3.0)

© SPIRE project

Source: SPIRE

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

General Ecology

Few data on population densities exist. Craighead and Craighead (1956) found 1554 hectares per pair in 1947-1948 in Michigan. In Maryland a density estimate of 200 hectares per pair was calculated by Stewart and Robbins (1958). Rosenfield et al. (1991) compiled nesting densities from various studies. These densities ranged from a low of 5000 hectares per pair in North Dakota in 1987, to a high of 331 hectares per pair in a pine plantation in southeastern Wisconsin in 1986.

Strongly territorial. Males vigorously defend an area 30 meters in diameter around the nest site although they may forage up to 3.2 kilometers away (Brown and Amadon 1968). Johnsgard (1990) reported home range sizes that ranged from 105 to 784 hectares (the latter was seasonal home range; daily home range was 231 hectares). Nests are typically spaced 2.4 - 5.6 kilometers apart (Brown and Amadon 1968, Reynolds and Wight 1978, Kennedy 1980, Campbell et al 1990) and not usually less than one kilometer apart (Palmer 1988). The smaller sharp-shinned hawk also appears to keep similar distances from Cooper's hawk nests (Brown and Amadon 1968, Reynolds and Wight 1978), indicating interspecific aggression probably related to competition for food. Winter range is larger. Michigan birds ranged over areas of 2.4 - 3.2 kilometers in diameter.

Dispersal range is limited. In Wisconsin, six males dispersed 4 - 35 kilometers (mean 12 kilometers) from natal site to nesting site; one female dispersed 14 kilometers (Rosenfield and Bielefeldt 1992). Hunt by a combination of still-hunting and searching flights along woodland edges and natural routes (Johnsgard 1990).

Birds following inland migration routes apparently migrate over longer distances than those following coastal routes, and tend to have longer wings and tails, creating lower "flight-surface loading." This is thought to be an adaptation to the longer flight distances, more open country, and stronger thermal updrafts encountered along the inland routes (Smith et al. 1990).

Mortality appears to be quite high during the birds' first winter, approaching 78% as opposed to only 34% per year for the adults 2 to 8 years old (Henny and Wight 1972). The maximum recorded lifespan is 8 years (Henny and Wight 1972). Life history traits place it intermediate for population turnover rate between the larger goshawk and smaller sharp-shinned hawk. This may partially explain the slower recovery of Cooper's from a population crash in the 1950s-1960s compared to sharp-shinned hawks (Bednarz et al. 1990).

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Life History and Behavior

Behavior

Communication and Perception

Cooper's hawks communicate using vocalizations and displays. They probably use vocalizations more than visual displays, because their dense forest habitat makes it difficult to see visual displays from far away. It is estimated that there are 42 different calls made by females, 22 by males, and 14 by juveniles. Males have higher pitched voices than females. Cooper's hawks rely on their amazing eyesight to locate prey.

Communication Channels: visual ; acoustic

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: BioKIDS Critter Catalog

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Communication and Perception

Cooper's Hawks communicate using vocalizations and displays. They probably use vocalizations more than visual displays, because their dense forested or woodland habitat prevents visual displays from being seen very far away. One study recorded 42 different calls made by females, 22 by males, and 14 by juveniles. Males have higher pitched voices than females.

Communication Channels: visual ; acoustic

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Life Expectancy

Lifespan/Longevity

Cooper's hawks are known to live as long as 12 years in the wild. Like many animals, Cooper's hawks are most vulnerable when they are young. Many Cooper's hawks do not survive long after they reach 1 year old.

Range lifespan

Status: wild:
12 (high) years.

Average lifespan

Status: wild:
1.3 years.

Average lifespan

Status: wild:
244 months.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: BioKIDS Critter Catalog

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Lifespan/Longevity

Cooper's Hawks are known to live as long as 12 years in the wild. However, one study showed that the average age at death was as low as 16.3 months for wild Cooper's hawks.

Range lifespan

Status: wild:
12 (high) years.

Average lifespan

Status: wild:
1.3 years.

Average lifespan

Status: wild:
244 months.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Lifespan, longevity, and ageing

Maximum longevity: 12 years (wild)
Creative Commons Attribution 3.0 (CC BY 3.0)

© Joao Pedro de Magalhaes

Source: AnAge

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Reproduction

The breeding season usually begins in early April and extends through May and June (Bent 1937, Brown and Amadon 1968). The annual molt begins in late June but can occur as late as October (Bent 1937). Southward migration commences in the northern states in late August, with September being the peak month; it is essentially over by November. Northward migration occurs from late February to early April (Brown and Amadon 1968).

The male does most of the nest building and occasionally some of the incubation; most of the incubation is done by the female, which seldom leaves the nest before the young have fledged (Brown and Amadon 1968). During the pre-fledging period the male provides both the female and the young with food, while both parents feed the young for up to four weeks after they leave the nest (Brown and Amadon 1968).

Only one brood is raised each year. The normal clutch is four-five eggs, with clutches of three and six being rarely observed (Bent 1937). A national average has been calculated at 3.5 eggs (Bednarz et al. 1990). Replacement clutches are laid if the first set is lost, and laying can be delayed under conditions of low food availability (Bent 1937, Snyder and Wiley 1976).

Hatching success data are limited, but in areas unaffected by DDT contamination the average hatching rate ranges from about 70% to 83% (Craighead and Craighead 1956, Johnsgard 1990), with some further reduction in the brood occurring after hatching. Normal fledging success rates range from 2.1 to 3.5 for pairs with successful nests (Craighead and Craighead 1956, Schriver 1969, Henny and Wight 1972, Reynolds and Wight 1978, Herron et al. 1985); roughly 80% of nests produce at least one fledgling (Henny and Wight 1972). In areas affected by DDT poisoning these figures were reported to be dramatically reduced.

The young fledge one month after hatching, the males leaving the nest three-four days earlier than the larger females. They remain dependent on their parents until they are eight weeks of age and have learned to forage on their own (Brown and Amadon 1968). Only about 19% of the birds breed in their first year. Most nest by the second year and continue breeding throughout the rest of their lives.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Cooper’s hawks are monogamous, and many pairs mate for life. Pairs breed once per year and raise one brood per breeding season. The male chooses the nest site, but the female does most of the nest-building. Courtship includes flight displays with wings held in a deep arc shape. Cooper’s hawks are territorial, and defend a territory around the nest.

Courtship displays include flight displays. For example, the male will fly around the female showing his under tail feathers to her. He raises his wings high above his back and flies in a wide arc with slow, rhythmic flapping. These display flights usually occur on bright, sunny days in mid-morning, and begin with both birds soaring high on warm rising air. The male and female may both participate in courtship flights. The male begins by diving toward the female, followed by a very slow-speed chase. Both birds move with a slow and exaggerated wingbeats alternated with glides.

Mating System: monogamous

Cooper's hawks begin their breeding season early in the spring. As early as March, they build nests made of sticks and twigs and lined with bark, conifer needles and down. The female lays 3 to 6 (usually 4 to 5) bluish to greenish-white eggs that are usually spotted. The eggs hatch after 32 to 36 days. The female does most of the incubating, and the male provides food for her. After the eggs hatch, both parents care for the young, who leave the nest after 27 to 34 days when they learn to fly. The parents continue to provide food to the chicks until they learn to feed themselves at about 8 weeks old. Most Cooper's hawks do not breed until they are at least two years old.

Breeding interval: Cooper's hawks breed once yearly.

Breeding season: Cooper's hawks begin breeding as early as March.

Range eggs per season: 3 to 6.

Average eggs per season: 4 to 5.

Range time to hatching: 32 to 36 days.

Range fledging age: 27 to 34 days.

Average time to independence: 2 months.

Range age at sexual or reproductive maturity (female): 1 (low) years.

Average age at sexual or reproductive maturity (female): 2 years.

Range age at sexual or reproductive maturity (male): 2 (low) years.

Average age at sexual or reproductive maturity (male): 2 years.

Key Reproductive Features: seasonal breeding ; gonochoric/gonochoristic/dioecious (sexes separate)

Average eggs per season: 4.

Both male and female Cooper’s hawks care for their chicks. The female performs most of the egg incubation and spends nearly all of her time warming and protecting the nest. The male will protect the nest by defending the area from predators. While the female broods the nest, she has little time to catch her own food so the male will bring her prey that he has caught. After the eggs hatch, both parents will brood, feed, and protect the young chicks. The male however, continues to do most of the hunting. The chicks learn to fly after a few weeks and will leave the nest but remain with their parents. The parents will continue to feed and protect the fledgling chicks until they learn how to feed themselves and survive on their own.

Parental Investment: altricial ; male parental care ; female parental care ; pre-fertilization (Provisioning, Protecting: Female); pre-hatching/birth (Protecting: Male, Female); pre-weaning/fledging (Provisioning: Male, Female, Protecting: Male, Female); pre-independence (Provisioning: Male, Female, Protecting: Male, Female)

  • Johnsgard, P. 1990. Hawks,Eagles, and Falcons of North America. Washington DC: Smithsonian Books.
  • Stoper, T., R. Usinger. 1968. Sierra Nevada Natural History. Los Angelos: University of California Press.
  • Whitfield, P. 1984. Macmillan Illustrated Animal Encyclopedia. New York: Macmillan Publishing Co..
  • Peterson, R., V. Peterson. 2002. A field guide to the birds of Eastern and Central North America, Fifth Edition. New York: Houghton Mifflin Company.
  • Ehrlich, P., D. Dobkin, D. Wheye. 1988. The Birder's Handbook: A Field Guide to the Natural History of North American Birds. New York: Simon and Schuster.
  • Chipper Woods Bird Observatory, 1998. "Cooper's Hawk" (On-line). Accessed July 10, 2000 at http://www.wbu.com./chipperwoods/photos/coophawk.htm.
  • Rosenfield, R., J. Bielefeldt. 1993. Cooper's Hawk (Accipiter cooperii). A Poole, F Gill, eds. The Birds of North America, Vol. 75. Philadelphia, PA and Washington DC: The Academy of Natural Sciences and The American Ornithologist's Union.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: BioKIDS Critter Catalog

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Cooper’s hawks are monogamous, and many pairs mate for life. Pairs breed once per year and raise one brood per breeding season. The male chooses the nest site, but the female does the majority of the nest-building. Courtship activities include stylized flights with the wings held in a deep arc. Cooper’s hawks are territorial, and defend a territory around the nest.

Courtship activities include flight displays. For example, the male of a pair will fly around the female exposing his expanded under tail coverts to her. The male raises his wings high above the back and flies in a wide arc with slow, rhythmic flapping. Typically these display flights occur on bright, sunny days in midmorning, and begin with both birds soaring high on thermals. The male and female may both participate in courtship flights. The male begins by diving toward the female, followed by a very slow-speed chase. Both birds move with a slow and exaggerated wingbeats alternated with glides in which the wings are held at a dihedral angle and the white under tail coverts are conspicuously spread.

Mating System: monogamous

Cooper's hawks begin breeding as early as March. Most individuals do not breed until they are at least two years old. Pairs build nests made of sticks and twigs and lined with bark, conifer needles and down. Males select most of the nest materials and do most of the nest building, although females contribute pieces of material occasionally. The female lays 3 to 6 (usually 4 to 5) bluish to greenish-white eggs that are usually spotted and soon become stained in the nest. The eggs hatch after 32 to 36 days, during which time they are incubated primarily by the female. During this time, the male provides most of the food for the female. After the eggs hatch, both parents tend the young who leave the nest after 27 to 34 days. Parents continue to provide food until the young become independent at about 8 weeks.

Breeding interval: Cooper's hawks breed once yearly

Breeding season: Cooper's hawks begin breeding as early as March.

Range eggs per season: 3 to 6.

Range time to hatching: 32 to 36 days.

Range fledging age: 27 to 34 days.

Average time to independence: 2 months.

Range age at sexual or reproductive maturity (female): 1 (low) years.

Average age at sexual or reproductive maturity (female): 2 years.

Range age at sexual or reproductive maturity (male): 2 (low) years.

Average age at sexual or reproductive maturity (male): 2 years.

Key Reproductive Features: seasonal breeding ; gonochoric/gonochoristic/dioecious (sexes separate)

Average eggs per season: 4.

Both male and female Cooper’s hawks care for their chicks. During incubation, the female spends most of the time protecting the eggs and nest, and the male provides nearly all of her food. After hatching, both parents tend the young. The male continues to do most of the hunting during the hatchling stage. Both parents continue to provide food to the chicks until they become independent at about 8 weeks.

Parental Investment: altricial ; pre-fertilization (Provisioning); pre-hatching/birth (Provisioning: Male, Protecting: Male, Female); pre-weaning/fledging (Provisioning: Male, Female, Protecting: Male, Female); pre-independence (Provisioning: Male, Female, Protecting: Male, Female)

  • Johnsgard, P. 1990. Hawks,Eagles, and Falcons of North America. Washington DC: Smithsonian Books.
  • Stoper, T., R. Usinger. 1968. Sierra Nevada Natural History. Los Angelos: University of California Press.
  • Whitfield, P. 1984. Macmillan Illustrated Animal Encyclopedia. New York: Macmillan Publishing Co..
  • Peterson, R., V. Peterson. 2002. A field guide to the birds of Eastern and Central North America, Fifth Edition. New York: Houghton Mifflin Company.
  • Ehrlich, P., D. Dobkin, D. Wheye. 1988. The Birder's Handbook: A Field Guide to the Natural History of North American Birds. New York: Simon and Schuster.
  • Chipper Woods Bird Observatory, 1998. "Cooper's Hawk" (On-line). Accessed July 10, 2000 at http://www.wbu.com./chipperwoods/photos/coophawk.htm.
  • Rosenfield, R., J. Bielefeldt. 1993. Cooper's Hawk (Accipiter cooperii). A Poole, F Gill, eds. The Birds of North America, Vol. 75. Philadelphia, PA and Washington DC: The Academy of Natural Sciences and The American Ornithologist's Union.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Barcode data: Accipiter cooperii

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There are 5 barcode sequences available from BOLD and GenBank.  Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.  See the BOLD taxonomy browser for more complete information about this specimen and other sequences.

NNNNTTTACCTAATCTTCGGCGCTTGAGCTGGCATAGTAGGTACTGCCCTTAGCCTCCTCATCCGCGCAGAACTCGGCCAACCAGGCACACTACTAGGCGACGACCAAATCTACAATGTAATCGTCACCGCACATGCCTTCGTAATAATCTTCTTTATAGTTATACCAATCATAATCGGAGGCTTCGGAAATTGACTCGTTCCACTCATAATTGGCGCCCCCGACATAGCCTTCCCACGCATAAACAACATAAGTTTCTGATTACTACCCCCATCCTTCCTCCTCCTACTAGCCTCCTCAACAGTAGAAGCAGGAGCTGGTACAGGATGAACTGTTTACCCTCCATTAGCTGGTAATATAGCCCACGCCGGAGCCTCAGTAGACCTAGCTATCTTCTCTTTACATCTAGCCGGAATCTCATCCATCCTAGGAGCAATCAACTTCATCACAACCGCCATCAACATAAAACCCCCAGTCCTCTCCCAATACCAAACACCCCTATTCGTATGATCTGTCCTCATCACCGCCGTCCTACTACTGCTCTCACTTCCAGTCCTAGCTGCTGGCATTACTATACTACTAACAGATCGAAACCTCAACACAACATTTTTCGACCCTGCCGGTGGAGGTGATCCTATCCTATACCAACATCTTTTCTGATTCTTTGGCCACCCAGAAGTCTACATCCTAATATCT
-- end --

Download FASTA File
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Statistics of barcoding coverage: Accipiter cooperii

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 6
Specimens with Barcodes: 7
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Conservation

Conservation Status

National NatureServe Conservation Status

Canada

Rounded National Status Rank: N5B,N4N : N5B: Secure - Breeding, N4N: Apparently Secure - Nonbreeding

United States

Rounded National Status Rank: N5B,N5N : N5B: Secure - Breeding, N5N: Secure - Nonbreeding

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

NatureServe Conservation Status

Rounded Global Status Rank: G5 - Secure

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

IUCN Red List Assessment


Red List Category
LC
Least Concern

Red List Criteria

Version
3.1

Year Assessed
2012

Assessor/s
BirdLife International

Reviewer/s
Butchart, S. & Symes, A.

Contributor/s

Justification
This species has an extremely large range, and hence does not approach the thresholds for Vulnerable under the range size criterion (Extent of Occurrence <20,000 km2 combined with a declining or fluctuating range size, habitat extent/quality, or population size and a small number of locations or severe fragmentation). The population trend appears to be increasing, and hence the species does not approach the thresholds for Vulnerable under the population trend criterion (>30% decline over ten years or three generations). The population size is very large, and hence does not approach the thresholds for Vulnerable under the population size criterion (<10,000 mature individuals with a continuing decline estimated to be >10% in ten years or three generations, or with a specified population structure). For these reasons the species is evaluated as Least Concern.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Cooper’s hawk populations declined as birds were poisoned by pesticides such as DDT. DDT was banned in 1972, and populations of Cooper's hawks are now recovering. One threat facing Cooper’s hawks today is loss of habitat. Logging and other human activities may destroy the forest habitats that they prefer.

As migratory birds, Cooper's hawks are protected under the U.S. Migratory Bird Act. The Convention on International Trade of Endangered Species (CITES) regulates the capture and international trade of Cooper's hawks. Cooper's hawks are sometimes captured in the wild to be used in the sport of falconry.

IUCN Red List of Threatened Species: least concern

US Migratory Bird Act: protected

US Federal List: no special status

CITES: appendix ii

State of Michigan List: no special status

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: BioKIDS Critter Catalog

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Cooper’s hawk populations declined as a result of the use of pesticides such as DDT, but have begun to recover since DDT was banned in 1972. One threat facing Cooper’s hawks today is degradation and loss of habitat. Management activities such as logging may make former habitat unsuitable for breeding.

Cooper's hawks are protected under the U.S. Migratory Bird Act and CITES Appendix II. They are listed under CITES Appendix III in Costa Rica. In Michigan, they are listed as a species of special concern.

US Migratory Bird Act: protected

US Federal List: no special status

CITES: appendix ii

State of Michigan List: special concern

IUCN Red List of Threatened Species: least concern

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Population

Population Trend
Increasing
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Management

Restoration Potential: Given the continued low population levels since the banning of DDT in the United States, the major solution to recovery may require an international end to the use of DDT and related organochlorine pesticides, particularly in Central and South America. If that can be accomplished, this species should be able to return to its former numbers, at least in areas that are still forested. However, it may be that other presently unknown factors are also involved in keeping numbers low.

Preserve Selection and Design Considerations: Although habitat requirements of this species are apparently highly variable and not well-defined, the following conservative guidelines are offered. Blocks of woodlands of a minimum of several hundred hectares (based on measured home range size of 100+ to 700+ hectares) are needed by this species for successful reproduction and foraging; forest tracts of six to eight hectares should be left unthinned around the nests to provide sufficient cover at the nest site (Reynolds et al. 1982, Rosenfield et al. 1991). In addition to protecting known nesting territories, attention also needs to be given to providing additional space into which the population can expand. The degree to which a site can be protected from human intrusion and raccoon predation should also be considered.

Management Requirements: Generally thought to need large tracts of relatively mature forests, particularly during the nesting season. This suggests management options that minimize forest fragmentation. The value or impact of forest edge habitat to this species, however, needs to be defined before management prescriptions can be made. Cooper's hawks reportedly forage in both wooded and open areas (Kingsley and Nicholls 1991). Where riverine forest corridors are used, management to maintain these corridors free of roadways, mining and other long-term disruption is needed (Herron et al. 1985). Additional protection from human disturbance would presumably raise the fledging success rate, since this species usually avoids populated areas when nesting (Snyder 1978). In areas with high raccoon populations, reduction of raccoon access to nests may be needed. Raccoon guards placed on nest trees and precautions taken during nesting studies can greatly decrease raccoon predation (Shriver 1969, Fyfe and Olendorff 1976).

In general, tree cutting in the vicinity of nests should be avoided and known nest sites should be protected from human disturbance during nesting season. A buffer zone of eight-ten hectares with no tree harvest has been recommended (Crocker-Bedford 1990). When managing for the benefit of Cooper's hawks, the practice of thinning stands for commercial or non-commercial purposes should be avoided in order to maintain the preferred density of cover (Reynolds et al. 1982). In the southwestern U.S., Reynolds et al. (1982) recommended the following actions to produce and maintain desired forest conditions: thinning trees in the understory, creating small openings in the forest, and prescribed burning; also deemed important were the provision of abundant snags and large downed logs, woody debris, interspersion of different tree sizes across the landscape, and ample older-aged forest. See Crocker-Bedford and Chaney (1988) for recommendations on management of nesting habitat in northern Arizona, Thomas et al. (1993) for a brief summary of protection and management needs in the Pacific Northwest, and Lefranc and Glinski (1988) for research needs and management recommendations for the southwestern U.S.

Management Research Needs: Mosher et al. (1990) criticizes general bird survey methods, short term trend analysis, and local research projects as inadequate for assessing population status and trends for woodland raptors. He suggests that standardized survey methods and range-wide efforts to define the normal range of reproductive performance, population density, and the factors that affect these parameters are needed. He lists the following research needs: effect of forest maturation on raptor species abundance and composition; impacts of forest management and agricultural practices on raptors; tree age and species composition trends in eastern forests and how and where these trends will likely impact woodland raptors; mechanisms controlling year-to-year fluctuations in reproductive parameters; relationship of reproductive parameters to prey density; and relationship of annual reproductive rate to fall migration counts, if possible. California and Northeastern states should be high priorities for research because of suspected declines or poor population recovery.

Studies determining fledging success are needed along with bioassays for organochlorine residues in eggs and adults. Monitoring levels of organochlorines in adults can be accomplished by assaying blood plasma, which has been shown to correlate quite well with levels in eggs, and hence with egg-shell thinning (Henny and Meeker 1981). Examination of dead hawks for organophosphate pesticide poisoning is needed in light of a few recent reports of Cooper's hawk poisonings (Rosenfield et al. 1991).

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Relevance to Humans and Ecosystems

Benefits

Economic Importance for Humans: Negative

Cooper's hawks occasionally prey on domestic chickens in poultry farms. However, this occurs rather infrequently and is offset by Cooper's hawks consumption of pest species that can cause significant damage to farmers' crops.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: BioKIDS Critter Catalog

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Economic Importance for Humans: Positive

Cooper's hawks are high level predators that help to regulate populations of their prey. Population regulation helps to avoid problems from over population such as disease outbreaks or food shortages. These predators often prey on small mammals like Mus musculus that may be a pest for farmers or homeowners.

Cooper's hawks are sometimes used in the sport of falconry. In falconry, humans will train a hawk to hunt wild game on command. The hawk will bring it's prey back to the human, who will reward the hawk with a different food item and take the fresh prey to cook and eat.

Positive Impacts: controls pest population

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: BioKIDS Critter Catalog

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Economic Importance for Humans: Negative

Cooper's hawks occasionally prey on domestic chickens in poultry farms.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Economic Importance for Humans: Positive

Cooper's Hawks prey on wild birds and rodents, which helps keep these populations in check.

Positive Impacts: controls pest population

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Risks

Stewardship Overview: Populations declined drastically in the eastern half of the continent between the 1940s and the early 1970s. After the ban of DDT in the U.S., populations began to rebound in some areas, but apparently still remain much below pre-DDT era levels throughout much of the region. The population recovered susbstantially in some areas (e.g., Ohio, Wisconsin). The lack of rebound in many areas has led to speculation that DDT is still picked up by migratory birds that winter in Central and South America and compose the major part of the diet. Little data to substantiate this claim exist. Few analyses of reproductive success or of DDT residues in eggs have been conducted, but results do not point to an obvious contaminant problem.

While many suggest that the main solution to recovery appears to be an international ban on the use of DDT and related pesticides, controlling habitat destruction is cited in other references. Research into the reproductive success rates, pesticide residues, prey population levels, habitat characteristics, and competitor populations are needed before a real understanding of how to protect this species is possible. In the meantime, standardized effective survey methods, such as censuses employing taped conspecific calls should be used systematically throughout the species' range to establish population levels and fluctuations. Whenever possible, known nesting sites should be protected from human disturbance and the public should be educated concerning the value predatory species have in maintaining a balance in natural ecosystems.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Wikipedia

Cooper's hawk

Not to be confused with Cooper's Hawk Winery & Restaurants.

Cooper's hawk (Accipiter cooperii) is a medium-sized hawk native to the North American continent and found from Southern Canada to Northern Mexico. As in many birds of prey, the male is smaller than the female. The birds found east of the Mississippi River tend to be larger on average than the birds found to the west.

Taxonomy[edit]

Cooper's hawk was first described by French naturalist Charles Lucien Bonaparte in 1828. It is a member of the goshawk genus Accipiter. This bird was named after the naturalist William Cooper, one of the founders of the New York Lyceum of Natural History (later the New York Academy of Sciences) in New York. Other common names; big blue darter, chicken hawk, hen hawk, Mexican hawk, quail hawk, striker and swift hawk.[2]

Description[edit]

Comparison of a male Cooper's hawk (left) with a female sharp-shinned hawk (right)

The average size of an adult male ranges from 220 to 440 g (7.8 to 15.5 oz) with a length between 35 and 46 cm (14 and 18 in). The adult male is significantly smaller than the average female, which weigh 330 to 700 g (12 to 25 oz) and measure 42 to 50 cm (17 to 20 in) long. Its wingspan ranges from 62 to 94 cm (24 to 37 in).[3][4] Individuals living in the eastern regions, where the sexes average 349 g (12.3 oz) and 566 g (20.0 oz), tend to be larger and heavier than those in the western regions, where the respective sexes average 280 g (9.9 oz) and 440 g (16 oz).[5] Cooper's hawks have short rounded wings, the wing chord measuring 21.4–27.8 cm (8.4–10.9 in) long, and a relatively long tail, 17–20.5 cm (6.7–8.1 in) long, with dark bands, round-ended at the tip.[4] As in most accipiters, the tarsus is relatively long, measuring 5.6–7.6 cm (2.2–3.0 in) long, and the bill is relatively small, with the culmen from the cere measuring only 1.5–2.1 cm (0.59–0.83 in).[4][6][7] Adults have red eyes and have a black cap, with blue-gray upper parts and white underparts with fine, thin, reddish bars. Their tail is blue gray on top and pale underneath, barred with black bands.[3] Immatures have yellow eyes and have a brown cap, with brown upper parts and pale underparts with thin black streaks mostly ending at the belly. Their tail is brown on top and pale underneath, barred with dark bands. The eyes of this hawk, as in most predatory birds, face forward, enabling good depth perception for hunting and catching prey while flying at top speeds. They have hooked bills that are well adapted for tearing flesh of prey.[5] Immatures are somewhat larger than a sharp-shinned hawk and smaller than a northern goshawk, though small males nearly overlap with large female sharp-shinned hawks, and large female Cooper's hawks nearly overlap with small male goshawks. Although the coloration is generally somewhat similar between sharp-shinned hawks and Cooper's hawks, Cooper's appear broader-chested and larger headed, with generally more robust features. The crow-like size of Cooper's hawks is sometimes distinctive from the Sharp-shinned but this can be less reliable in large female Sharp-shinneds. Goshawks are usually more distinctive in their larger size and differing plumage markings, with the juvenile Goshawk having broader, darker streaking below with more irregular patterns than the immature Cooper's. The Cooper's hawk appears long-necked in flight and has been described by birdwatchers as looking like a "flying cross". The Cooper's hawk is seen mostly flying with quick, consecutive wing beats and a short glide, though they may also soar.[8][9]

Distribution and habitat[edit]

Their breeding range extends from southern Canada to northern Mexico. They are generally distributed more to the south than the other North American accipiters, the sharp-shinned hawk and the Northern Goshawk. Birds from most of the Canadian and northern U.S. range migrate in winter, and some Cooper's hawks winter as far south as Panama.[10] The Cooper's hawk occur in various types of mixed deciduous forests and open woodlands, including small woodlots, riparian woodlands in dry country, open and pinyon woodlands, and forested mountainous regions and also now nests in many cities.[10] They were once thought to be adverse to cities and towns, but are now fairly common urban and suburban birds. The cities provide plenty of rock pigeon and mourning dove for the Cooper's hawk to prey on.[3] Although more adapatable in habitat than the sharp-shinned hawk, studies have indicated that the species still more often than not prefers sizeable tracts of woodland for breeding and migrating to fragmented, developed areas.[11]

Behavior[edit]

Feeding[edit]

Eating a finch in a backyard with feeders

These birds capture prey from cover or while flying quickly through dense vegetation, relying almost totally on surprise. One study showed that this is a quite dangerous hunting style. More than 300 Cooper's hawk skeletons were investigated and 23% revealed healed fractures in the bones of the chest.[3] Cooper's hawks prey almost exclusively on small to mid-sized birds. Typical prey species include American robins, other thrushes, jays, woodpeckers, European starlings, quail, icterids, cuckoos, pigeons and doves. Birds preyed on can range in size from wood-warblers to ring-necked pheasants. They may also prey upon the raptor American kestrel and other smaller raptors, including their cousin the sharp-shinned hawk.[12] They have been known to rob nests and may supplement their diet with small mammals such as chipmunks, hares, mice, squirrels, and bats.[3] Even more rarely, they may predate on lizards, frogs, or snakes. It normally catches its prey with its feet and kills it by repeatedly squeezing it and holding it away from its body until it dies. They have also been seen drowning their prey, holding it underwater until it stops moving.[3] The hawks often pluck the feathers off their prey on a post or other perch. They also hunt songbirds at backyard feeders, perching nearby then swooping down and scattering the birds to single one out in flight. They may pursue prey on the ground by half running and half flying.[5]

Courtship[edit]

The Cooper's hawks are monogamous, but most do not mate for life. Pairs will breed once a year and raise one brood per breeding season. Courtship displays include stylized flights with the wings positioned in a deep arc. During their flight displays the male will begin by diving toward the female. A slow speed-chase follows involving the male flying around the female exposing his expanded under tail coverts to her. The male raises his wings high above the back and flies in a wide arc with slow, rhythmic flapping. Courting usually occurs on bright, sunny days, in midmorning.[5] After pairing has occurred, the males make a bowing display before beginning to build the nest.[3]

Breeding[edit]

Immature Cooper's hawk in winter

Their breeding habitats are forested areas. The breeding pair builds a stick nest in large trees. Over a two-week period the pair builds the nest. The nests are piles of sticks around 69 cm (27 in) in diameter and 15.2–43 cm (6.0–16.9 in) high with a cup-shaped depression in the middle that is 20.2 cm (8.0 in) across and 10.1 cm (4.0 in). Their nests are built in pines, oaks, Douglas firs, beeches, spruces, and other tree species usually on flat ground rather than on a hillside. The nests typically are about 7.6–15.1 m (25–50 ft) high off the ground, halfway up the tree, and out on a horizontal branch.[3] The clutch size is usually 3 to 5 eggs. The cobalt-blue eggs average about 48 mm × 38 mm (1.9 in × 1.5 in) and weigh about 43 g (1.5 oz). The female incubates the eggs between 30 to 36 days.[5] The hatchlings are about 28 g (0.99 oz) and 9 cm (3.5 in) long and are completely covered in white down.[3] They are brooded for about two weeks by the female, while her mate forages for food. The fledging stage is reached at 25 to 34 days of age, though the offspring will return to the nest to be fed until they become independent around 8 weeks. Eggs and nestlings are preyed on, rarely, by raccoons, crows as well as other competing Cooper's hawks. Adults rarely fall prey to larger raptors, namely red-tailed hawks, great horned owls, peregrine falcons, golden eagles, and northern goshawks.[5]

Communication[edit]

A Cooper's hawk calling from an urban park in Minnesota

Problems playing this file? See media help.

Cooper's hawks communicate using vocalizations and displays. Vocal is probably preferred over display, because the denseness of their habitat could prevent displays from being seen from a distance. Males are usually submissive to females and will listen for reassuring call notes the females make when they are willing to be approached.[13] The males have a higher pitched voice than females.[5]

Lifespan[edit]

Cooper's hawks have been known to live as long as 12 years in the wild. However, the oldest known living hawk was 20 years and 4 months old.[5]

Status and conservation[edit]

At one time, Cooper's Hawks were heavily hunted in persecution for preying on poultry and were called "chicken hawks". It is now known that predation by these hawks on domestic animals borders on negligible, and they are rarely hunted these days. Cooper's hawks' breeding success was also reduced by the use of the pesticide DDT, but the ban of DDT ended that threat.[13] Since then, the adaptable Cooper's hawk has thrived. However, one threat facing Cooper's hawks today is the degradation and loss of habitat. Management activities like logging may make their former habitat unsuitable for breeding.[5] The Cooper's hawk, as a natural predator of almost any North American bird smaller than itself, can inadvertently deplete populations of rarer, conservation-dependent species. The American kestrel, whose populations have experienced considerable decrease, is one species in which the extensive predation by the recovered Cooper's hawk population is a major concern.[14]

References[edit]

  1. ^ BirdLife International (2012). "Accipiter cooperii". IUCN Red List of Threatened Species. Version 2013.2. International Union for Conservation of Nature. Retrieved 26 November 2013. 
  2. ^ Accipiter cooperii (Big Blue Darter). Zipcodezoo.com. Retrieved on 2011-12-18.
  3. ^ a b c d e f g h i Cooper's Hawk. Lab. of Ornithology. Cornell University
  4. ^ a b c Ferguson-Lees, J.; Christie, D. (2001). Raptors of the World. London: Christopher Helm. pp. 717–19. ISBN 0-7136-8026-1. 
  5. ^ a b c d e f g h i Dewey, T. and V. Perepelyuk. (2000). Accipiter cooperii, Animal Diversity Web. Accessed April 22, 2010.
  6. ^ Avian Osteology. Royalbcmuseum.bc.ca. Retrieved on 2012-08-21.
  7. ^ Emmet Reid Blake (1 July 1977). Manual of Neotropical Birds. University of Chicago Press. pp. 301–. ISBN 978-0-226-05641-8. Retrieved 21 August 2012. 
  8. ^ Robbins, C.S., Bruun, B., Zim, H.S. (2008-07-03). "Cooper's hawk Accipiter cooperii". Patuxent Wildlife Research Center. USGS. Retrieved 2008-11-18. 
  9. ^ Cooper's Hawk, Identification, All About Birds – Cornell Lab of Ornithology. Allaboutbirds.org. Retrieved on 2012-08-21.
  10. ^ a b Global Raptor Information Network. (2010). Species account: Cooper's Hawk Accipiter cooperii.
  11. ^ Goodrich, L.J. (2010). Stopover ecology of autumn-migrating raptors in the central Appalachians. PhD dissertation, Pennsylvania State University, State College, PA
  12. ^ C.Michael Hogan, ed. 2010. American Kestrel. Encyclopedia of Earth, U.S. National Council for Science and the Environment, Ed-in-chief C.Cleveland
  13. ^ a b "Cooper's Hawk". Cornell University. April 19, 2010.
  14. ^ American Kestrel (Falco sparverius). hawkmountain.org

Further reading[edit]

Creative Commons Attribution Share Alike 3.0 (CC BY-SA 3.0)

Source: Wikipedia

Unreviewed

Article rating from 0 people

Default rating: 2.5 of 5

Names and Taxonomy

Taxonomy

Comments: Constitutes a superspecies with A. GUNDLACHI and A. BICOLOR (AOU 1998). See Whaley and White (1994) for information on geographic variation.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!