Articles on this page are available in 1 other language: Spanish (11) (learn more)

Overview

Brief Summary

Accipiter striatus

The Sharp-shinned Hawk is often confused with its slightly larger relative, the Cooper’s Hawk. Both species are blue-gray above and streaked rusty-red below with long tails, yellow legs, and small, hooked beaks. However, the Sharp-shinned Hawk has a squared-off tail (Cooper’s Hawks have rounded tails), and is slightly smaller at 10-14 inches long. The Sharp-shinned Hawk displays the greatest difference in size between males and females (called sexual dimorphism) of any raptor in North America, with females weighing almost twice as much as males. The Sharp-shinned Hawk is also a more local breeder than the Cooper’s Hawk. While that species breeds across the United States and southern Canada, the Sharp-shinned Hawk’s main breeding range is restricted to the Canadian sub-arctic and higher elevation areas of the Appalachians and Rockies. This species migrates south in winter, when it may be found more widely across the U.S. In its range, the Sharp-shinned Hawk is among the most adaptable raptors. While usually found in forest habitats, this species has expanded into human-altered landscapes and now frequents towns and suburbs as well. The Sharp-shinned Hawk, like all ‘bird hawks,’ is capable of hunting birds (on the ground, in trees, or in flight) from the air. This species frequently enters yards to take small songbirds from feeders. With the aid of binoculars, Sharp-shinned Hawks may be seen perched in trees while scanning for prey. However, they are often more easily seen in the air while moving between perches or while actively hunting. As this species hunts by sight, it is only active during the day.

Threat Status: Least Concern

  • Accipiter striatus. Xeno-canto. Xeno-canto Foundation, n.d. Web. 20 July 2012. .
  • Bildstein, Keith L. and Ken Meyer. 2000. Sharp-shinned Hawk (Accipiter striatus), The Birds of North America Online (A. Poole, Ed.). Ithaca: Cornell Lab of Ornithology; Retrieved from the Birds of North America Online: http://bna.birds.cornell.edu/bna/species/482
  • Peterson, Roger Tory. Birds of Eastern and Central North America. Boston: Houghton Mifflin, 1980. Print.
  • Sharp-shinned Hawk (Accipiter striatus). The Internet Bird Collection. Lynx Edicions, n.d. Web. 20 July 2012. .
  • eBird Range Map - Sharp-shinned Hawk. eBird. Cornell Lab of Ornithology, N.d. Web. 20 July 2012. .
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Smithsonian Institution

Supplier: DC Birds

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Distribution

Range Description

This species has a large, discontinuous range in the Americas. It occurs from Alaska (USA) and Canada south to Panama, and populations are also found in the West Indies, in hills and mountains from Venezuala and Colombia through Ecuador and Peru to western Bolivia, and from southern Brazil through Uruguay and Paraguay to south-east Bolivia and northern Argentina.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Sharp-shinned hawks can be found throughout much of North America, including Mexico. In South America, they are found from Venezuela to northern Argentina. Most of the North American populations migrate to the southern parts of their range in winter.

Biogeographic Regions: nearctic (Native ); neotropical (Native )

  • Bildstein, K., K. Meyer. 2000. Sharp-shinned hawk (Accipiter striatus). A Poole, F Gill, eds. In The Birds of North America, No. 482. Philadelphia, PA: The Birds of North America, Inc.
  • Sullivan, J. 1994. "Accipiter striatus" (On-line). Fire Effects Information System. Accessed February 25, 2004 at http://www.fs.fed.us/database/feis/wildlife/bird/acst/.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

occurs (regularly, as a native taxon) in multiple nations

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

National Distribution

Canada

Origin: Native

Regularity: Regularly occurring

Currently: Present

Confidence: Confident

Type of Residency: Year-round

United States

Origin: Native

Regularity: Regularly occurring

Currently: Present

Confidence: Confident

Type of Residency: Year-round

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Global Range: (>2,500,000 square km (greater than 1,000,000 square miles)) BREEDS: western and central Alaska to northern Saskatchewan, southern Labrador, and Newfoundland, south to South America. NORTHERN WINTER: north to southern Alaska and southern Canada (casually). U.S. and Canadian populations winter south to Panama and West Indies. RESIDENT populations occur in Middle and South America (northwestern Venezuela, south in Andes to northern Argentina; Paraguay to southeastern Brazil, Uruguay) and Puerto Rico (AOU 1983, Sibley and Monroe 1990).

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Geographic Range

Sharp-shinned hawks can be found throughout much of North America, including Mexico. In South America, they are found from Venezuela to northern Argentina. Most of the North American populations migrate to the southern parts of their range in winter.

Biogeographic Regions: nearctic (Native ); neotropical (Native )

  • Bildstein, K., K. Meyer. 2000. Sharp-shinned hawk (Accipiter striatus). A Poole, F Gill, eds. In The Birds of North America, No. 482. Philadelphia, PA: The Birds of North America, Inc.
  • Sullivan, J. 1994. "Accipiter striatus" (On-line). Fire Effects Information System. Accessed February 25, 2004 at http://www.fs.fed.us/database/feis/wildlife/bird/acst/.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: BioKIDS Critter Catalog

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

The sharp-shinned hawk breeds from western and central Alaska and
northern Yukon Territory east to the Atlantic coast, and south to
southern California, southern Texas, the northern parts of the Gulf
States, and South Carolina [10,39,50].

Sharp-shinned hawks winter from Vancouver Island, southern British Columbia,
western Montana, Nebraska, southern Minnesota, Illinois, southern Michigan,
southern Ontario, New York, southern Vermont, southern New Hampshire,
southern Maryland, New Brunswick, and Nova Scotia south to Panama and the
Bahamas [10,39,50].

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Regional Distribution in the Western United States

More info on this topic.

This species can be found in the following regions of the western United States (according to the Bureau of Land Management classification of Physiographic Regions of the western United States):

1 Northern Pacific Border
2 Cascade Mountains
3 Southern Pacific Border
4 Sierra Mountains
5 Columbia Plateau
6 Upper Basin and Range
7 Lower Basin and Range
8 Northern Rocky Mountains
9 Middle Rocky Mountains
10 Wyoming Basin
11 Southern Rocky Mountains
12 Colorado Plateau
13 Rocky Mountain Piedmont
14 Great Plains
15 Black Hills Uplift
16 Upper Missouri Basin and Broken Lands

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Occurrence in North America

AL AK AZ AR CA CO CT DE FL GA ID IL IN IA KS KY LA ME MD MA MI MN MS MO MT NE NV NH NJ NM NY NC ND OH OK OR PA RI SC SD TN TX UT VT VA WA WV WI WY PR AB BC MB NB NF NT NS ON PE PQ SK YT MEXICO

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Physical Description

Morphology

Sharp-shinned hawks are the smallest accipiters (bird hawks) in North America. Males are 24 to 27 cm long and weigh 87 to 114 g. Females are larger, measuring 29 to 34 cm in length and weighing 150 to 218 g. Males have a wingspan of 53 to 56 cm and females 58 to 65 cm.

Sharp-shinned hawks have bluish-gray to slate colored upperparts, with darker coloration on the crown. Their underparts are white with brown bars and their short, rounded wings are dark above and light below. Females have fewer bars on the breast, and their upper parts are more brownish. Sharp-shinned hawks have a short, dark colored, hooked beak and yellow legs and feet. Their tail is square-tipped when not spread and has three to five dark stripes with a small white stripe on the tip. Molting does not change the adult’s appearance. Juveniles have more streaking and/or barring and paler coloration than adults. Sharp-shinned hawks look similar to Cooper’s hawks (Accipiter cooperii) but are smaller.

Range mass: 87 to 218 g.

Range length: 24 to 34 cm.

Range wingspan: 53 to 65 cm.

Sexual Dimorphism: female larger; sexes colored or patterned differently

Other Physical Features: endothermic ; bilateral symmetry

  • Gough, G., J. Sauer, M. Iliff. 1998. "Sharp-shinned hawk (Accipiter striatus)" (On-line). Patuxent Bird Identification Infocenter. Accessed February 25, 2004 at http://www.mbr-pwrc.usgs.gov/id/framlst/i3320id.html.
  • Wheeler, B., W. Clark. 1995. A Photographic Guide to North American Raptors. London: Academic Press.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Physical Description

Sharp-shinned hawks are the smallest Accipiter in North America. Males are 24 to 27 cm long and weigh 87 to 114 g. Females are larger, measuring 29 to 34 cm in length and weighing 150 to 218 g. Males have a wingspan of 53 to 56 cm and females 58 to 65 cm.

Sharp-shinned hawks have bluish-gray to slate colored upperparts, with darker coloration on the crown. Their underparts are white with brown bars and their short, rounded wings are dark above and light below. Females have fewer bars on the breast, and their upper parts are more brownish. Sharp-shinned hawks have a short, dark colored, hooked beak and yellow legs and feet. Their tail is square-tipped when not spread and has three to five dark stripes with a small white stripe on the tip. Molting does not change the adult’s appearance. Juveniles have more streaking and/or barring and paler coloration than adults. Sharp-shinned hawks look similar to Cooper’s hawks (Accipiter cooperii) but are smaller.

Range mass: 87 to 218 g.

Range length: 24 to 34 cm.

Range wingspan: 53 to 65 cm.

Sexual Dimorphism: female larger; sexes colored or patterned differently

  • Gough, G., J. Sauer, M. Iliff. 1998. "Sharp-shinned hawk (Accipiter striatus)" (On-line). Patuxent Bird Identification Infocenter. Accessed February 25, 2004 at http://www.mbr-pwrc.usgs.gov/id/framlst/i3320id.html.
  • Wheeler, B., W. Clark. 1995. A Photographic Guide to North American Raptors. London: Academic Press.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: BioKIDS Critter Catalog

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Size

Length: 36 cm

Weight: 174 grams

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Ecology

Habitat

Habitat and Ecology

Habitat and Ecology
The species inhabits a wide variety of habitats, depending on the region, including boreal coniferous forests, temperate deciduous woodland, tropical and subtropical cloud forest, gallery forest and semi-open savanna woodland, from sea level to 2,700 m. Outside the breeding season, North American birds can be found in almost any terrain, including urban areas with trees.

Systems
  • Terrestrial
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Sharp-shinned hawks are forest birds. They are found in pine, fir and aspen forests (among others). They can be found hunting in forest interior and edges from sea level to near alpine areas. Sharp-shinned hawks can also be found near rural, suburban and agricultural areas, where they often hunt at bird feeders.

Habitat Regions: temperate ; tropical ; terrestrial

Terrestrial Biomes: forest

Other Habitat Features: suburban ; agricultural

  • Campbell, R., N. Dawe, I. McTaggart-Cowan, J. Cooper, G. Kaiser, M. McNall. 1990. The Birds of British Columbia, Volume II: Non-passerines, Diurnal Birds of Prey through Woodpeckers. Victoria: The Royal British Columbia Museum.
  • Snyder, N., H. Snyder. 1991. Birds of Prey: Natural History and Conservation of North American Raptors. Stillwater, MN: Voyageur Press.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Comments: Forest and open woodland, coniferous, mixed, or deciduous, primarily in coniferous in more northern and mountainous portion of range (AOU 1983). Primary habitat is boreal forest, with the greatest nesting densities occurring in eastern Canada. Young, dense, mixed or coniferous woodlands are preferred for nesting (Platt 1976, Reynolds et al. 1982, Meyer 1987). Where conifers are scarce, as in the prairie regions, cottonwoods, poplars, and other members of the Betulaceae may be used (Bent 1937). Migrates through various habitats, mainly along ridges, lakeshores, and coastlines (NGS 1983). Nests usually in tree crotch or on branch next to trunk, most often 3-18 m up, hidden by thick foliage, usually in conifer in north. May build new nest, reuse old one, or modify old bird or squirrel nest. Nests generally seem to be in a stand of dense conifers near a forest opening, though this may reflect observer bias (Meyer 1987). Pairs apparently remain faithful to nesting areas for several years, although a new nest is usually constructed each season. However, this may not be universally true (Herron et al., 1985, stated that pairs are not faithful to a nest site).

In Nevada, nesting occurs at elevations of 6500-9000 feet, intermediate between Cooper's below, and goshawks above (Herron et al. 1985).

One study quantified habitat parameters for nest sites in pine plantations in Missouri (Wiggers and Kritz 1991). The nest sites were characterized as medium age (25-49 yr), with high tree density (1370 trees/ha), basal area (37 sq m per ha), and percentage canopy coverage (82%). Nest trees were usually of normal growth form and nests were in the canopy. In this study, Cooper's hawks also nested in the same type of habitat, with essentially the same characteristics, but chose deformed nest trees most often and placed nests below canopy. Sharp-shin nesting sites were in stands averaging 11.8 ha compared to an average of 4.1 ha for Cooper's hawks in pine stands or 53 ha for Cooper's in hardwood habitat (Wiggers and Kritz 1991).

The foraging habitat during the breeding season is essentially the same as that chosen for nesting, and the birds appear to avoid open, deciduous forests, at least in Canada (Meyer 1987). During the winter, however, the males tend to hunt most frequently along hedgerows, field edges and other ecotonal habitats, while females usually stick to extensive stands of forest or riparian areas (Meyer 1987).

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Sharp-shinned hawks are forest birds. They are found in pine, fir and aspen forests (among others). They can be found hunting in forest interior and edges from sea level to near alpine areas. Sharp-shinned hawks can also be found near rural, suburban and agricultural areas, where they often hunt at bird feeders.

Habitat Regions: temperate ; tropical ; terrestrial

Terrestrial Biomes: forest

Other Habitat Features: suburban ; agricultural

  • Campbell, R., N. Dawe, I. McTaggart-Cowan, J. Cooper, G. Kaiser, M. McNall. 1990. The Birds of British Columbia, Volume II: Non-passerines, Diurnal Birds of Prey through Woodpeckers. Victoria: The Royal British Columbia Museum.
  • Snyder, N., H. Snyder. 1991. Birds of Prey: Natural History and Conservation of North American Raptors. Stillwater, MN: Voyageur Press.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: BioKIDS Critter Catalog

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Cover Requirements

More info for the term: cover

Nesting Cover: Nests are almost always built in trees with very dense
foliage [10,39].

Foraging Cover: Sharp-shinned hawks prefer perches with substantial
arboreal cover from which to spot and capture prey; however, these
perches are often located near open areas in which prey is more easily
spotted and pursued [27].

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Preferred Habitat

More info for the terms: cover, density, shrubs, tree

Sharp-shinned hawks breed in coniferous forests adjacent to other types
of stands; prey is usually more plentiful in mixed or patchy forests
than in large continuous stands of conifers [39].

Nesting: Sharp-shinned hawk nests are built within the canopy rather
than below it. Nest trees typically have dense foliage and are usually
conifers. In Utah, some sharp-shinned hawk nests were built in diseased
deciduous trees that had abnormally dense foliage [40]. In Missouri,
nests were typically built in shortleaf pine or in Virginia pine (Pinus
virginiana) trees [54]. In canyons, nest trees are usually 165 to 330
feet (50-100 m) upslope from a stream [27,42]. In northwestern Oregon,
most nest trees were on gentle to moderate slopes (15-37%) with
northerly exposures; nest trees in eastern Oregon were on slopes ranging
from 8 to 47 percent [43]. Nests are occasionally built in rock
crevices or hollow trees [50]. In Oregon, sharp-shinned hawks nest from
near sea level to near timberline [42]; Nests were found from 396 feet
(120 m) to 6,633 feet (2,010 m) elevation [43].

Nesting habitat for sharp-shinned hawks usually consists of dense stands
of trees with a well developed canopy (canopy cover of 60% or more) and
a dense understory [27]. In Oregon, sharp-shinned hawks breed in young
(30- to 70-year-old), mature (80- to 190-year-old), and old-growth (over
190 years) forest [20]. In the Sierra Nevada, mixed conifer forests are
suitable habitat for sharp-shinned hawks. Seral stages and cover
classes of suitable nesting habitat are as follows: pole-medium tree
stage with 40 to 69 percent canopy cover, pole-medium tree stage with 70
percent or more canopy cover, and large tree stage with 70 percent or
more canopy cover [53]. In western forests, sharp-shinned hawks breed
in dense, young (25- to 50-year-old), even-aged second-growth stands with
single-layered canopies [27], and in 40- to 60-year-old even-aged
conifer stands [5,42]. In the Inland Northwest, sharp-shinned hawks
breed in pole-sapling, young, and mature mixed conifer forests, but not
in shrub-seedling stands or in old-growth forests [46]. In Idaho,
between May and August, sharp-shinned hawks were usually observed in
open riparian habitat or in parklike stands of coniferous forest.
However, it was noted that these hawks are difficult to observe in the
dense forests in which nests are built [52].

In Oregon, mean stand density of nest sites was 472 trees per acre
(1,180 trees/ha). Typical forest structure for Oregon nest sites is an
overstocked stand with a shallow canopy and many dead limbs below the
live crowns [42]. In Oregon, nest sites (described as the area used by
a nesting pair and fledglings including roosts and perches used to pluck
prey) averaged about 9.9 acres (4 ha). The average nesting range in
Idaho was 0.33 square mile (0.85 sq km) [52] and in Wyoming was 0.44
square mile (1.1 sq km) [7]. In Oregon, minimum nesting territory size
was estimated as 0.4 square mile (1 sq km) [20]. Many nest sites had
limits coinciding with discrete boundaries between vegetative structures
or topographic features [42].

In Oregon, nest density was estimated as one nest per 6,792 acres (2,750
ha), with mean nearest conspecific neighbor distance of 2.5 miles (4.1
km) [44]. In Idaho, nest density was estimated as 4.2 pairs of
sharp-shinned hawks per 10 square miles (1.6 pairs per 10 sq km) [52].

Foraging: Foraging habitat for sharp-shinned hawks includes nesting
habitat, but the hawks also forage in more open environments [27]. In
the Inland Northwest, sharp-shinned hawks feed in shrub-seedling stands
and in pole-sapling, young, mature, and old-growth mixed conifer forests
[46]. Sharp-shinned hawk habitat includes canyons, valleys, and
riparian areas [27].

Migration: Concentrations of migrating sharp-shinned hawks have been
observed along the ridgetops of the Allegheny Mountains in the Ridge
and Valley Sections [48]. During migration sharp-shinned hawks will
occupy almost any type of habitat that contains trees or shrubs [10].

Wintering: The sharp-shinned hawk is less specific in its habitat
preferences in winter than in summer, and occurs in almost any forested
or shrubby habitat including riparian areas, woodlands, farmlands, urban
areas, and other areas more open than nesting habitat [10].

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Associated Plant Communities

More info for the term: mesic

The sharp-shinned hawk occurs primarily in coniferous forests, but is
also found in boreal mixed conifer-birch-aspen forests [50]. It is less
common in other woodland types, except in mountainous areas [10]. Open
areas are used for foraging but not for nesting. Diem and Zeveloff [11]
listed sharp-shinned hawks as members of ponderosa pine (Pinus
ponderosa) bird communities in the western United States.

Breeding: In Colorado, sharp-shinned hawks breed in quaking aspen
(Populus tremuloides) and conifer (Picea spp., Abies spp., Pinus spp.,
and Pseudotsuga menziesii) forests. Nests are usually only built in
conifer stands; within quaking aspen forests, nests are built in patches
of conifers within aspen stands [24]. In Missouri, most sharp-shinned
hawk nesting occurs in plantation pine (mostly shortleaf pine [Pinus
echinata]) with some nests in mixed pine-hardwoods [54]. Optimal
breeding habitat in the southeastern states is mixed pine-hardwoods.
Marginal breeding habitat includes eastern white pine (Pinus
strobus)-eastern hemlock (Tsuga canadensis), cove hardwoods (hardwood
forests on mesic sites), and maple (Acer spp.)-beech (Fagus spp.)-birch
(Betula spp.) [27]. Mansell [35] recorded a sharp-shinned hawk nest in
a field that had numerous clumps of small pines and spruces.

Foraging: In Colorado, sharp-shinned hawks were observed hunting in
mature aspen (Populus spp.), conifer, and mixed aspen-conifer forests
[24]. In southern Arizona, sharp-shinned hawks were frequently seen
perched or flying in dense stands of mature mesquite (Prosopis spp.),
hackberry (Celtis occidentalis), wolfberry (Lycium spp.), and
falsemesquite (Calliandra spp.) along sandy washes and around stock
tanks, which constitutes habitat preferred by Gambel's quail (Callipepla
gambelii) but not by scaled quail (C. squamata) [17].

Wintering: In California riparian woodland, sharp-shinned hawks were
present from August to May but were not present during the breeding
season [32]. In southern California, sharp-shinned hawks were commonly
seen in chaparral (Adenostoma, Ceanothus, and Arctostaphylos spp.)
except during the summer months [55]. Optimum winter habitat for
sharp-shinned hawks in the southeastern states is live oak (Quercus
virginiana)-maritime forest. Suitable habitat in the southeastern
states for wintering sharp-shinned hawks includes tropical hardwood
forest, southern scrub oak (Quercus spp.), southern mixed-mesic
hardwoods, bay swamp-pocosin, pond pine (P. serotina)-pocosin, loblolly
pine (P. taeda)- shortleaf pine, and elm-ash-cottonwood (Ulmus
spp.-Fraxinus spp.-Populus spp.). Marginal winter habitat includes sand
pine (P. clausa)-southern scrub oak, longleaf pine (P. palustris)-
southern scrub oak, sandhills longleaf pine, longleaf pine-slash pine
(P. elliottii), and oak-gum-cypress (Quercus spp.-Liquidambar
styraciflua and Nyssa spp.-Taxodium spp.) [19].

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Habitat: Ecosystem

More info on this topic.

This species is known to occur in the following ecosystem types (as named by the U.S. Forest Service in their Forest and Range Ecosystem [FRES] Type classification):

FRES10 White-red-jack pine
FRES11 Spruce-fir
FRES12 Longleaf-slash pine
FRES13 Loblolly-shortleaf pine
FRES14 Oak-pine
FRES15 Oak-hickory
FRES16 Oak-gum-cypress
FRES17 Elm-ash-cottonwood
FRES18 Maple-beech-birch
FRES19 Aspen-birch
FRES20 Douglas-fir
FRES21 Ponderosa pine
FRES22 Western white pine
FRES23 Fir-spruce
FRES24 Hemlock-Sitka spruce
FRES25 Larch
FRES26 Lodgepole pine
FRES27 Redwood
FRES28 Western hardwoods
FRES32 Texas savanna
FRES34 Chaparral-mountain shrub
FRES35 Pinyon-juniper

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Habitat: Cover Types

More info on this topic.

This species is known to occur in association with the following cover types (as classified by the Society of American Foresters):

Sharp-shinned hawks occur in almost every forest type.

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Habitat: Plant Associations

More info on this topic.

This species is known to occur in association with the following plant community types (as classified by Küchler 1964):

Sharp-shinned hawks occur in almost every forest type.

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Migration

Whether or not a Sharp-shinned Hawk will migrate depends on the climate and prey availability of its breeding habitat.  Resident Sharp-shinned Hawk populations live year-round in temperate parts of the United States, coastal regions of Canada, Mexico, Cuba, and Puerto Rico. Sharp-shinned Hawk populations in the northern part of their North American range migrate south and spend the winter (non-breeding season) in the southern United States, Mexico and Central America. They may travel as far south as Panama, with a smaller number spending the winter in the Greater Antilles (Bull & Farrand, 1977). They begin to drift southward during the second half of August, with the heaviest migration occurring in September (Bent, 1937). In Maryland, the spring migration occurs from February 25 to March 5, with peak migration activity occurring from April 5 to May 5 (Stewart & Robbins, 1958).  In Oregon, Sharp-shinned Hawks arrive in their nesting grounds in late April (Reynolds, 1983).

Sharp-shinned Hawks show different migration timing throughout North America. While there is considerable overlap in migration times, females usually migrate earlier than males while juvenile Sharp-shinned Hawks tend to migrate earlier than all adults (Mueller & Berger, 1967). It has been speculated that because immature Sharp-shinned Hawks are relatively inexperienced hunters, they are first to migrate in the fall because they are the first to be affected by the departure of prey birds. This pattern is reversed in the spring when the Sharp-shinned Hawks return to their breeding grounds. Because immature birds have become more experienced hunters over the winter, the earlier departure of mature birds would suggest that the initiation of spring migration is related to hormone levels instead of prey availability (Devereux et al, 1985). Mueller and Berger (1967) also found evidence suggesting that Sharp-shinned Hawks choose to migrate when conditions are conducive for the formation of upward climbing air currents.

  • Bent, A. C. (1937). Smithsonian Institution United States National Museum Bulletin 167: Part 1: 95-111. United States Government Printing Office. Retrieved from http://birdsbybent.com/ch61-70/shshhawk.html
  • Bull, J., & Farrand, J. Jr. (1977). The Audubon Society Field Guide to North American Birds: Eastern Region. New York: Alfred A. Knopf.
  • Devereux, J., Carpenter, T. & Durham, K. (1985). Spring migration pattern of Sharp-shinned Hawks passing Whitefish Point, Michigan. Journal of Field Ornithology, 56(4), 346-355.
  • Mueller, H. C. & Berger, D. D. (1967). Fall migration of sharp-shinned hawks. The Wilson Bulletin, 79(4), 397-415.
  • Reynolds, R. T. (1983). Management of western coniferous forest habitat for nesting accipiter hawks (General Technical Report RM-102). Fort Collins, CO: U.S. Department of Agriculture, Forest Service, Rocky Mountain Forest and Range Experiment Station. Retrieved from http://www.treesearch.fs.fed.us/pubs/32478
  • Stewart, R. E. & Robbins, C. S. (1958). Birds of Maryland and the District of Columbia. North American Fauna, 62, 1-401. doi:http://dx.doi.org/10.3996/nafa.62.0001
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© Zintkala Eiring, Ashley Dawson; Editors; Anneke DeLuycker, Jim McNeil, Marcy Heacker

Supplier: Anneke DeLuycker

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Non-Migrant: Yes. At least some populations of this species do not make significant seasonal migrations. Juvenile dispersal is not considered a migration.

Locally Migrant: Yes. At least some populations of this species make local extended movements (generally less than 200 km) at particular times of the year (e.g., to breeding or wintering grounds, to hibernation sites).

Locally Migrant: Yes. At least some populations of this species make annual migrations of over 200 km.

Northern populations are migratory, usually arrive in nesting areas by April-May; southward migration occurs August-October in Canada and northern U.S. Arrives in Costa Rica by mid-October, remains until March (Stiles and Skutch 1989). High proportion of birds banded in Minnesota were recovered in Mexico and Central America in late fall-winter. See Palmer (1988) for more detail. Often aggregates during migration.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Trophic Strategy

Since Sharp-shinned Hawks are small, forest-dwelling raptors, their diet consists primarily of small birds. A case study performed in Colorado (Joy et al. 1994) determined the diets of nesting pairs in habitats like coniferous, aspen, and mixed coniferous-aspen forests. This study found 53 species of prey that were caught by 11 nesting pairs, the majority (91.1%) of which were birds.   (Joy et al, 1994). Bird species of prey included: Yellow-rumped warblers (Dendroica coronata), American Robins (Turdus migratorius), White-crowned Sparrows (Zonotrichia leucophrys), and Dark-eyed Juncos (Junco hyemalis) composed the majority of avian prey. In addition, voles (Clethrionomys, Microtus, and Phenacomys spp.) made up the majority (60%) of mammal prey (Joy et al, 1994).

The size difference between the sexes in Sharp-shinned Hawks influences the size of prey they can catch. Nestlings feed first on small prey caught mainly by their father, switching as they grow to larger prey brought to them by their mother. Before delivering prey to their mates or young, male Sharp-shinned Hawks typically remove and eat the head of their prey (Mueller & Berger, 1970). 

While Sharp-shinned Hawks mainly prey on birds, Downing and Baldwin (1961) documented the predation of a Red Bat (Lasiurus borealis). The recording of this predation occurred at Point Pelee off the shores of Lake Erie in 1960 (Downing & Baldwin, 1961). During an extensive feeding from dawn until 10 a.m., ten birds and one Red Bat were killed and deposited in mist-nests by captured hawks. The skin study of the prey showed that the hawks pierced the back of the bat’s body, severing a rib and causing extensive hemorrhages in the chest cavity (Downing & Baldwin, 1961). The other injury was a single claw perforation on one wing. Thus, it can be determined that predatory behavior of Sharp-shinned Hawks is to strike and then hold small birds while in flight. The attack on the Red Bat showed the same signs of predation. Despite this occurrence of a bat as prey, there are not enough case studies or long-term monitoring plans to support the conclusion that bats are a common prey species of Sharp-shinned Hawks. 

  • Downing, S. C., & Baldwin, D. H. (1961). Sharp-shinned hawk preys on red bat. Journal of Mammalogy, 41(4), 540.
  • Joy, S. M, Reynolds, R. T., Knight, R. L., & Hoffman, R. W. (1994). Feeding ecology of sharp-shinned hawks nesting in deciduous and coniferous forests in Colorado. Cooper Ornithological Society, 96(2), 455-467.
  • Mueller, H. C. & Berger, D. D. (1970). Prey preferences in the sharp-shinned hawk: The role of sex, experience and motivation. The Auk, 87, 452-457.
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© Zintkala Eiring, Ashley Dawson; Editors: Anneke DeLuycker, Jim McNeil, Marcy Heacker

Supplier: Anneke DeLuycker

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Small birds comprise ninety percent of a sharp-shinned hawk’s diet, which also includes small mammals and large insects. Sharp-shinned hawks mainly eat Passeriformes (perching birds), but also eat Falconiformes (diurnal birds of prey), Galliformes (chicken-like birds), Charadriiformes (shorebirds and relatives), Columbiformes (doves and pigeons), Apodiformes (swifts and hummingbirds) and Piciformes (woodpeckers and relatives). They often catch birds at feeders and take young birds from nests.

Sharp-shinned hawks are opportunistic hunters. They often hunt from a perch and dart out from hiding to catch prey. Their long, sharp talons help them to grab onto prey and their short bursts of high-speed flight help them to catch their prey. Sharp-shinned hawks pluck their prey before eating them. They get sufficient water from prey and do not need to drink.

Animal Foods: birds; mammals; insects

Primary Diet: carnivore (Eats terrestrial vertebrates)

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Comments: Eats mainly small to medium-sized birds; occasionally small mammals, insects, lizards, etc. Hunts from inconspicuous perch or by stealthy flights along paths and around bushes and trees (Evans 1982). In Colorado, nestling and fledgling birds were common prey items when hawks were feeding young (Joy et al., 1994, Condor 96:455-467).

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Food Habits

Sharp-shinned hawks mainly eat small birds. They also eat small mammals and large insects. They often catch birds at bird feeders and take young birds from nests. When they catch birds, sharp-shinned hawks pluck the feathers before eating the bird.

Sharp-shinned hawks often hunt from a perch and dart out from hiding to catch prey. Their long, sharp talons help them to grab onto prey and their short bursts of high-speed flight help them to catch their prey. They get all their water from prey and do not need to drink.

Animal Foods: birds; mammals; insects

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: BioKIDS Critter Catalog

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Food Habits

Sharp-shinned hawks prey largely on small birds; typically, prey birds
are sparrow-sized but occasionally larger birds are taken [10].
Sharp-shinned hawks forage in open forest, on the forest floor, in
meadow grasses, and in bushy pastures [10,39]. A characteristic hunting
style is to spot prey from a well-hidden perch and then fly quickly out
to capture it. The sharp-shinned hawk "is numero uno at sneak attack"
[39]. Other styles include speculative flight: The sharp-shinned hawk
flies (flaps and glides) close to the ground, darting under branches or
across small openings and over brushfields or meadows. The hawk can
turn rapidly to grasp small birds in flight, drop to catch them on the
ground, or grab prey that is perched. Prey is often pursued into dense
foliage. Top flight speed is 28 miles per hour (47 km/h) [10,14,39,59].

In Colorado, birds constituted 91.1 percent of the prey of 11 nesting
pairs of sharp-shinned hawks. The most frequently taken bird species
included yellow-rumped warbler (Dendroica coronata), American robin
(Turdus migratorius), white-crowned sparrow (Zonotrichia leucophrys),
and dark-eyed junco (Junco hyemalis). Yellow-rumped warblers, dark-eyed
juncos, and American robins were among the most abundant birds in the
area. Small birds were eaten in proportion to their relative frequency
in dominant and secondary habitat types, but the proportion eaten was
different from relative abundance in limited habitats. Mammals averaged
8.9 percent of prey taken; 60 percent of the mammals eaten were voles
(Clethrionomys, Microtus, and Phenacomys spp.) [24].

In North America, the most common bird species taken by sharp-shinned
hawks include American robin, starling (Sturnus vulgaris), catbird
(Dumetella carolinensis), house sparrow (Passer domesticus), towhees
(Pipilo spp.), sparrows (Aimophila spp., Spizella spp., and others), and
brown creeper (Certhia americana) [39,50]. Prey as small as Anna's
hummingbird (Calypte anna) and as large as northern bobwhite (Colinus
virginianus) and young domestic fowl have been reported. Nestlings and
young birds are common prey items, including the young of gallinaceous
birds [3] and other predatory birds such as flammulated owls (Asio
flammeus) [34]. Occasionally, the sharp-shinned hawk preys on mice,
shrews, moles, young lagomorphs, bats, red squirrel (Tamiasciurus
hudsonicus), frogs, butterflies, grasshoppers, and moths [3,9,39]. In
southern Arizona, sharp-shinned hawks were frequently seen perched or
flying in habitat preferred by Gambel's quail and were assumed to
represent a major cause of Gambel's quail mortality [17].

Sharp-shinned hawks have been known to attack pileated woodpeckers
(Dryocopus pileatus), but it is unclear whether attacks are territorial
or prandial in intent [39].

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Associations

Sharp-shinned hawks are important members of their ecosystem. Because of their food habits they likely have a regulatory influence on local small bird populations. They are also an important food source for their predators.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Their secretive behavior and camouflaged nests help sharp-shinned hawks avoid predators. Known predators of sharp-shinned hawks include: bald eagles (Haliacetus leucocephalus), peregrine falcons (Falco peregrinus) and northern goshawks (Accipiter gentiles).

Known Predators:

  • bald eagles (Haliacetus leucocephalus)
  • peregrine falcons (Falco peregrinus)
  • northern goshawks (Accipiter gentilis)

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Ecosystem Roles

Sharp-shinned hawks are important members of their ecosystem. They have an influence on small bird populations and are also an important food source for their predators.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: BioKIDS Critter Catalog

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Predation

Their secretive behavior and camouflaged nests help sharp-shinned hawks avoid predators. Known predators of sharp-shinned hawks include: bald eagles (Haliacetus leucocephalus), peregrine falcons (Falco peregrinus) and northern goshawks (Accipiter gentiles).

Known Predators:

  • bald eagles (Haliacetus_leucocephalus)
  • peregrine falcons (Falco_peregrinus)
  • northern goshawks (Accipiter_gentilis)

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: BioKIDS Critter Catalog

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Predators

Nestling sharp-shinned hawks are preyed upon by other raptors including
Cooper's hawk (Accipiter cooperi) and northern goshawk (A. gentilis)
[3].

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Known prey organisms

Accipiter striatus preys on:
Empidonax minimus
Vireo gilvus
Icterus galbula
Pheucticus ludovicianus
Catharus fuscescens
Poecile atricapillus
Troglodytes aedon
Pipilo
Dumetella carolinensis
Toxostoma rufum
Dendroica petechia
Vireo olivaceus
Carduelis tristis
Turdus migratorius
Geothlypis trichas
Melospiza melodia
Agelaius phoeniceus
Quiscalus quiscula
Sitta pygmaea
Dendroica coronata
Sialia
Junco hyemalis
Spizella passerina
Todus mexicanus
Mimocichla plumbea
Myiarchus antillarum
Vireo latimeri
Nesospingus speculiferus
Icterus dominicensis
Mimetes portoricensis
Vireo altiloquus
Seiurus aurocapillus
Seiurus motacilla
Chlorostilbon maugeus
Anthracothorax viridis
Mniotilta varia
Parula americana
Dendroica tigrina
Dendroica discolor
Dendroica angelae
Setophaga ruticilla
Coereba flaveola
Loxigilla portoricensis
Spindalis zena
Euphonia musica
Eumeces fasciatus
Colaptes auratus
Bombycilla cedrorum
Auriparus flaviceps
Sitta canadensis
Dendroica palmarum
Corvus caurinus
Tamias merriami

Based on studies in:
Canada: Manitoba (Forest)
USA: Arizona (Forest, Montane)
Puerto Rico, El Verde (Rainforest)

This list may not be complete but is based on published studies.
  • D. I. Rasmussen, Biotic communities of Kaibab Plateau, Arizona, Ecol. Monogr. 11(3):228-275, from p. 261 (1941).
  • Myers, P., R. Espinosa, C. S. Parr, T. Jones, G. S. Hammond, and T. A. Dewey. 2006. The Animal Diversity Web (online). Accessed February 16, 2011 at http://animaldiversity.org. http://www.animaldiversity.org
  • R. D. Bird, Biotic communities of the Aspen Parkland of central Canada, Ecology, 11:356-442, from p. 406 (1930).
  • R. D. Bird, Biotic communities of the Aspen Parkland of central Canada, Ecology, 11:356-442, from p. 410 (1930).
  • Waide RB, Reagan WB (eds) (1996) The food web of a tropical rainforest. University of Chicago Press, Chicago
Creative Commons Attribution 3.0 (CC BY 3.0)

© SPIRE project

Source: SPIRE

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Population Biology

Number of Occurrences

Note: For many non-migratory species, occurrences are roughly equivalent to populations.

Estimated Number of Occurrences: > 300

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Global Abundance

10,000 - 1,000,000 individuals

Comments: Very difficult to estimate population numbers; no range-wide census available. Regional estimates range from 30,100 for U.S. wintering population (Johnsgard 1990) to 500,000-1,000,000 breeding pairs in Canada (Kirk et al. 1995).

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

General Ecology

In Puerto Rico, breeding density in suitable habitat 1 individual per sq km (Delannoy and Cruz 1988); average distance between nests was 4.3 km in Oregon (see Palmer 1988).

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Habitat-related Fire Effects

The effects of fire on sharp-shinned hawk habitat are related to habitat
structure and to prey abundance and availability. The sharp-shinned
hawk is most benefited by a mixture of habitats. Fire in dense conifers
tends to thin understories and open canopies, making them less suitable
for sharp-shinned hawk nesting habitat; severe fire can destroy nest
trees, roost sites, and perching sites [33,58]. However, open canopies
are more suitable for hunting. Thus, the sharp-shinned hawk is
vulnerable to either extreme: loss of nesting habitat with fire, or the
lack of open foraging areas without fire [58]. Lehman and Allendorf
[33] stated that lack of fire, with concomitant increases in the density
of vegetation, can result in an increase in sharp-shinned hawk numbers.
However, sharp-shinned hawks occur in the following fire-dependent
(sensu Wright and Bailey [56]) ecosystems: ponderosa pine, Douglas-fir,
redwood (Sequoia sempervirens), sequoia (Sequoiadendron giganticus), and
chaparral [33].

Lawrence [31] reported that predatory birds increased in burned
chaparral for the first 2 postfire years, but declined the third year.
Sharp-shinned hawks were more abundant in the burned area in the first
postfire years, probably due to the increased vulnerability of prey.
Declines in later postfire years were attributed to increased vegetative
cover.

In the Southwest, sharp-shinned hawk prey populations and diversity
decreased during long fire-free intervals; the loss was attributed to a
reduction in grassy understory and in structural diversity caused by
lack of fire [12].

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Timing of Major Life History Events

Spring Migration: In Maryland, spring migration occurs from February 25
to March 5, with peak activity from April 5 to May 5 [48]. In Oregon,
sharp-shinned hawks arrived on nesting grounds in late April, the latest
of the three accipiter species nesting in the area [42].

Nest Building: In Maryland, nesting activities commence in early May.
Nesting is initiated until mid-July [48]. The sharp-shinned hawk nest
consists of sticks and twigs and is lined with strips of bark. It is up
to 2 feet (0.6 m) across, usually situated in a crotch or branch of a
tree next to the trunk, and ranges from 10 to 60 feet (3-18 m) above the
ground. New nests are usually built each year, but sharp-shinned hawks
occasionally adapt a squirrel (Tasaciurus and Sciurus spp.) or crow
(Corvus spp.) nest [14,50].

Clutch: Eggs are laid from May to July. During egg production, eggs
are laid on alternate days [40]. In New York, egg dates range from
April 16 to June 21 [9]. In Wyoming, the earliest egg laying date was
June 16 [7]. In Oregon, mean clutch completion date was May 26 and did
not vary much with elevation [42]. Clutch size is usually four or five
eggs, but ranges from three to eight eggs [14,50]. Eggs are incubated
by both parents [50]; incubation periods range from 34 to 35 days [9],
and all eggs usually hatch within a 36-hour period [40]. There is
usually only one brood per nesting season [9].

Development of Young: In Wyoming the average number of days in the nest
was 21, with a maximum number of 28 days [7]. Reynolds [42] reported an
average nestling period in Oregon of 23 days. Other authors reported
that females fledge at approximately 27 days and males fledge at
approximately 24 days after hatching [9,14]. In an Oregon study, 70 to
100 percent of hatched young survived to fly [44]. The fledglings
remain near the nest area and are fed by both parents for at least 21
and up to 50 days [39,42,50]. Food delivery by the parents decreases
markedly at 42 to 47 days [39]. Juvenile sharp-shinned hawks go through
first molt and acquire adult plumage at just over 1 year of age [23].

Fall Migration: Most sharp-shinned hawks in northern portions of the
breeding range migrate; birds that remain in the far north over the
winter are mostly juveniles, and do not usually survive the winter.
Most southwestern nesting sharp-shinned hawks also leave nesting
territories on a seasonal basis, but these birds probably do not travel
extensively [39]. Sharp-shinned hawks form large flocks during
migration [15] and often follow migrating flocks of songbirds. Migration
activity is initiated from late August to October [35]. In Maryland,
fall migration occurs from September 1 to November 25 [48].

Breeding Age and Longevity: Some sharp-shinned hawks first breed as
yearlings, but most do not breed until later [39]. Sharp-shinned hawk
ages of up to 12 years have been recorded; however, few sharp-shinned
hawks live longer than 5 years [39,50].

Mortality: Major identifiable causes of sharp-shinned hawk mortality
include "road kill" and predators [25]. Evans and Rosenfield [8]
reported sharp-shinned hawk mortality from collision with windows. In
the first half of this century, a large number of sharp-shinned hawks
were shot during migration (large flocks were easy targets); hawks are
now under legal protection so this threat is greatly reduced [45].
These hawks are still shot in the belief that they represent a threat to
domestic fowl or to songbirds [8,39]. Juvenile mortality is highest in
fall and winter. However, almost half of mortality in older birds
occurs in spring, apparently caused by the rigors of spring travel, and
occurs mostly among females [39].

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Life History and Behavior

Behavior

One study in Puerto Rico suggests that courtship behavior of the Sharp-shinned Hawk (Accipiter striatus) is displayed shortly after sunrise and may continue into the morning (Delannoy and Cruz, 1988). Typically, courtship flights are initiated when the male circles above the nesting site, which causes the female to follow him. Then, the individuals soar together in rapid flights with intermittent calling. The male flaps frequently and circles higher than the female. The hawks reach heights of 20 to 200 meters until they finalize with a deep dive into the forest. The swooping of courtship can range from 3 to 20 minutes and is followed by feeding, mating, or nest building (Delannoy and Cruz, 1988). In regard to parenting behavior, both sexes prepare the nest about 3 to 4 weeks before laying eggs. Materials are gathered from the ground or nearby trees and the nests themselves are constructedin trees. Once the nest is made, females stop hunting and stay near the nest while males provide food. Parental roles such as incubation time in females and food searching in males are similar in both tropical and temperate habitats (Delannoy and Cruz, 1988).

Territory behavior is important for Sharp-shinned Hawks due to mating and selection concerns. Territorial disputes usually occur after sunrise and may last until morning. During territorial display fights, resident males initiate territorial behavior from a perch or from the air. Once intruder males enter the air space, resident males fly towards intruders and chase after them. All individuals call repeatedly; in some occasions, males may grapple talons and spin laterally a few meters from the canopy before breaking free. Occasionally individuals may land on the ground, talons interlocked before separating. Territorial conflicts may last for a couple months before the intruder is completely evicted. In a study regarding tropical Sharp-shinned Hawks, all recorded territorial conflicts (n = 20) ended with residents defending their territory until all intruders were expelled (Delannoy and Cruz, 1988).

In regard to female and male fledgling behavior, growth rate differences were significant in Puerto Rico’s Sharp-shinned Hawk. In fact, males are described as “behaviorally advanced and feather sooner than females” (Delannoyand Cruz, 1988). In addition, males left the nest earlier and developed flight skills sooner than females.

  • Delannoy, C. A. & Cruz, A. 1988. Breeding biology of the Puerto Rican sharp-shinned hawk (Accipiter striatus venator). American Ornithologists’ Union 105(4), 649-662.
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© Zintkala Eiring, Ashley Dawson; Editors: Anneke DeLuycker, Jim McNeil, Marcy Heacker

Supplier: Anneke DeLuycker

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Sharp-shinned hawks are usually quite silent. They vocalize more frequently during the breeding season. Their alarm calls sound like “kek-kek-kek” or “kik-kik-kik.” Males make a “kip…kip” or “kew kew kew” call when approaching the nest, and females reply with a “keeeep.” Females and nestlings also make “eee” calls.

Communication Channels: visual ; acoustic

Perception Channels: visual ; tactile ; acoustic ; chemical

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Communication and Perception

Sharp-shinned hawks are usually quite silent. They call more often during the breeding season. Their alarm calls sound like “kek-kek-kek” or “kik-kik-kik.” Males make a “kip…kip” or “kew kew kew” call when they come to the nest, and females reply with a “keeeep.” Females and nestlings also make “eee” calls.

Communication Channels: visual ; acoustic

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: BioKIDS Critter Catalog

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Life Expectancy

The longest recorded lifespan for a sharp-shinned hawk is 13 years. However, most do not live longer than 3 years. Causes of mortality include predators, hunting and collisions with cars and buildings.

Range lifespan

Status: wild:
19.9 (high) years.

Average lifespan

Status: wild:
3 years.

Average lifespan

Status: wild:
239 months.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Lifespan/Longevity

The oldest known sharp-shinned hawk lived to be 13 years old. However, most do not live longer than 3 years. Sharp-shinned hawks are killed by predators, hunters, and collisions with cars and buildings.

Range lifespan

Status: wild:
19.9 (high) years.

Average lifespan

Status: wild:
3 years.

Average lifespan

Status: wild:
239 months.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: BioKIDS Critter Catalog

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Lifespan, longevity, and ageing

Maximum longevity: 19.9 years (wild) Observations: Though breeding at just over one year of age is possible, most animals breed at later ages. Few of these animals live over 5 years in the wild (http://www.fs.fed.us/database/feis/).
Creative Commons Attribution 3.0 (CC BY 3.0)

© Joao Pedro de Magalhaes

Source: AnAge

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Reproduction

The timing of breeding and nesting of Sharp-shinned Hawks is dependent on conditions of their temperate or tropicalenvironment.. For example, the breeding cycle in the Maricao forest of Puerto Rico is two months longer than Utah and Oregon. This lapse is longer in Puerto Rico because Sharp-shinned Hawks occupy breeding grounds earlier than temperate zone hawks. In fact, tropical hawks are year-long residents and reoccupy their nesting site in December and January.

In regard to eggs of tropical hawks, the average egg mass is 18.5 grams, which is 10.8% of the female’s body weight. In other words, an entire clutch of three eggs is 32% of the female’s body mass. It is assumed that tropical Sharp-shinned Hawks may have smaller egg abundance than temperate zones because they lay eggs during the dry season, from March to July, which spans 38 days (Delannoy & Cruz, 1988). Since food sources are low in dry conditions, females limit the number of eggs they produce based on their food intake, body weight, and environmental conditions. Although the dry season provides a low abundance of food, the wet season may not be preferred because foraging during heavy rainfall requires high metabolic energy and may result in mortality.

In temperate zones in Utah and Oregon, females take advantage of the wet season to lay eggs, perhaps because of higher food abundance, which results in higher egg counts. Specifically, the average egg mass is 19 grams, which is 11% of the female’s body weight (Delannoy & Cruz, 1988). In contrast to an average of three eggs per clutch for tropical hawks, temperate female hawks normally have 5 eggs per clutch, which totals 53% of the female’s body mass. Despite these differences, incubation, nestling and fledgling states(including survival rates)are the same in both tropical and temperate habitats. In fact, Puerto Rico’s population of Sharp-shinned Hawks is not in decline despite low reproductive success when compared to temperate hawks. This may be because re-occupancy rates of nests are higher in tropical zones (Delannoy & Cruz, 1988). 

  • Delannoy, C.A. & Cruz, A. (1988). Breeding biology of the Puerto Rican Sharp-shinned Hawk (Accipiter striatus venator). American Ornithologists’ Union, 105(4), 649-662.
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© Zintkala Eiring, Ashley Dawson; Editors: Anneke DeLuycker, Jim McNeil, Marcy Heacker

Supplier: Anneke DeLuycker

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Due to the secretive nature of sharp-shinned hawks, little is known about their mating behavior. They are known to have courtship flights and are presumed to be monogamous.

Mating System: monogamous

The breeding season of sharp-shinned hawks corresponds with the time of maximum prey availability; usually between late March and June. Sharp-shinned hawks begin building their nests soon after they arrive at the breeding ground. Nests are built in trees, usually below the canopy (2.4 to 19 m above ground). The nests are made of twigs and are often lined with bark chips. Both the male and female gather nesting material, but the female does most of the building. Nest sites are re-used from year to year and old nests are refurbished or new nests are built on top of old ones. The birds are territorial during the breeding season and defend their nest site against intruders.

Sharp-shinned hawks normally have only one brood per year and lay 4 to 5 eggs per clutch on average (range 3 to 8). Females usually lay eggs on alternate days. Eggs are white or bluish with dark spots, approximately 37 by 30 mm and weigh about 9 g (approximately 11 percent of the female’s body mass). Incubation lasts 21 to 35 days, and the eggs hatch within one to two days of each other. Females do most of the incubating, but males will bring food to females while they are on the nest. After hatching, the altricial chicks are brooded by the female for 16 to 23 days. The nestlings fledge after 21 to 32 days. Males usually fledge sooner than females. Young continue to receive parental care for about 3.5 weeks after fledging. Most sharp-shinned hawks begin to breed when they are two years old.

Breeding interval: Sharp-shinned hawks usually have only one brood per year

Breeding season: Late March to June

Range eggs per season: 3 to 8.

Average eggs per season: 4.5.

Range time to hatching: 21 to 35 days.

Range fledging age: 21 to 32 days.

Average time to independence: 3.5 weeks.

Average age at sexual or reproductive maturity (female): 2 years.

Average age at sexual or reproductive maturity (male): 2 years.

Key Reproductive Features: iteroparous ; seasonal breeding ; gonochoric/gonochoristic/dioecious (sexes separate); sexual ; fertilization ; oviparous

Average eggs per season: 4.

Average age at sexual or reproductive maturity (male)

Sex: male:
365 days.

Average age at sexual or reproductive maturity (female)

Sex: female:
365 days.

Female sharp-shinned hawks do most of the incubating, but males bring food to females while they are on the nest. After hatching, the altricial chicks are brooded by the female for 16 to 23 days. While the chicks are in the nest, the male brings food to the female who plucks it and feeds the chicks. Females also defend the nest against predators. The nestlings fledge after 21 to 32 days. Young continue to receive parental care for about 3.5 weeks after fledging.

Parental Investment: no parental involvement; altricial ; pre-hatching/birth (Protecting: Female); pre-weaning/fledging (Provisioning: Male, Female, Protecting: Female); pre-independence (Provisioning: Male, Female)

  • Bildstein, K., K. Meyer. 2000. Sharp-shinned hawk (Accipiter striatus). A Poole, F Gill, eds. In The Birds of North America, No. 482. Philadelphia, PA: The Birds of North America, Inc.
  • Campbell, R., N. Dawe, I. McTaggart-Cowan, J. Cooper, G. Kaiser, M. McNall. 1990. The Birds of British Columbia, Volume II: Non-passerines, Diurnal Birds of Prey through Woodpeckers. Victoria: The Royal British Columbia Museum.
  • Snyder, N., H. Snyder. 1991. Birds of Prey: Natural History and Conservation of North American Raptors. Stillwater, MN: Voyageur Press.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Clutch size commonly is 4-5 (but average 2.6 in Puerto Rico). Incubation lasts 30-32 days (34-35 days also reported), mainly by female (male brings food). Young fledge at 3-4.5 weeks, independent at about 7 weeks. First breeds: usually 2 years (sometimes as yearling).

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Little is known about the mating behavior of sharp-shinned hawks. They are known to perform mating displays and are thought to have only one mate at a time.

Mating System: monogamous

Sharp-shinned hawks breed during the season when there is a lot of food available. This is usually between late March and June. Sharp-shinned hawks begin building their nests soon after they arrive at the breeding ground. Nests are built in trees, usually 2.4 to 19 m above ground. The nests are made of twigs and are often lined with bark chips. The male and female both gather nesting material but the female does most of the building. Nest sites are re-used from year to year and new nests are built on top of old ones. The birds are territorial during breeding season and defend their nest site against intruders.

Sharp-shinned hawks normally breed only once a year and lay 4 to 5 eggs. Females usually lay one egg every-other day. Eggs are white or bluish with dark spots. They are about 37 by 30 mm and weigh about 9 g. Incubation lasts 21 to 35 days. Females do most of the incubating, but males will bring food to females while they are on the nest.

All of the eggs hatch within one or two days of each other. After hatching, the female broods the chicks for 16 to 23 days. This means that she uses her body to cover the chicks the same way that she covered the eggs to keep them warm and protected. The nestlings fledge (leave the nest) after 21 to 32 days. Male nestlings usually fledge sooner than females. The parents continue to feed the chicks for about 3.5 weeks after they fledge. Most sharp-shinned hawks breed for the first time when they are two years old.

Breeding interval: Sharp-shinned hawks usually have only one brood per year

Breeding season: Late March to June

Range eggs per season: 3 to 8.

Average eggs per season: 4.5.

Range time to hatching: 21 to 35 days.

Range fledging age: 21 to 32 days.

Average time to independence: 3.5 weeks.

Average age at sexual or reproductive maturity (female): 2 years.

Average age at sexual or reproductive maturity (male): 2 years.

Key Reproductive Features: seasonal breeding ; gonochoric/gonochoristic/dioecious (sexes separate); fertilization

Average eggs per season: 4.

Average age at sexual or reproductive maturity (male)

Sex: male:
365 days.

Average age at sexual or reproductive maturity (female)

Sex: female:
365 days.

Female sharp-shinned hawks do most of the incubating, but males bring food to females while they are on the nest. After hatching, the chicks are brooded (the female sits over the chicks to keep them warm and protect them in the same way she sits over the eggs) for 16 to 23 days. While the chicks are in the nest the male brings food to the female who tears it apart and feeds it to the chicks. Females also defend the nest against predators. The nestlings fledge (leave the nest) after 21 to 32 days. They continue to be cared for by the parents for about 3.5 weeks after fledging.

Parental Investment: no parental involvement; altricial ; pre-hatching/birth (Protecting: Female); pre-weaning/fledging (Provisioning: Male, Female, Protecting: Female); pre-independence (Provisioning: Male, Female)

  • Bildstein, K., K. Meyer. 2000. Sharp-shinned hawk (Accipiter striatus). A Poole, F Gill, eds. In The Birds of North America, No. 482. Philadelphia, PA: The Birds of North America, Inc.
  • Campbell, R., N. Dawe, I. McTaggart-Cowan, J. Cooper, G. Kaiser, M. McNall. 1990. The Birds of British Columbia, Volume II: Non-passerines, Diurnal Birds of Prey through Woodpeckers. Victoria: The Royal British Columbia Museum.
  • Snyder, N., H. Snyder. 1991. Birds of Prey: Natural History and Conservation of North American Raptors. Stillwater, MN: Voyageur Press.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: BioKIDS Critter Catalog

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Barcode data: Accipiter striatus

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There are 14 barcode sequences available from BOLD and GenBank.

Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.

See the BOLD taxonomy browser for more complete information about this specimen and other sequences.

NNNTTATACTTAATCTTTGGCGCTTGAGCCGGCATAGTTGGCACTGCCCTTAGCCTACTCATTCGCGCAGAACTTGGCCAACCAGGCACACTCCTAGGCGATGACCAAATCTATAATGTTATCGTCACCGCACATGCCTTCGTAATAATTTTCTTCATAGTTATACCAATCATAATTGGAGGCTTCGGAAACTGACTCGTCCCGCTCATAATTGGCGCTCCTGATATAGCTTTCCCACGTATAAATAACATAAGCTTCTGACTACTCCCCCCATCATTCCTCCTCTTACTAGCCTCTTCAACAGTAGAAGCAGGAGCAGGAACCGGATGAACTGTCTACCCTCCATTAGCTGGTAATATAGCCCATGCCGGAGCCTCAGTAGACCTAGCTATCTTCTCACTACACCTAGCAGGAATTTCATCCATCCTAGGGGCAATTAACTTTATCACAACCGCTATTAACATAAAACCCCCTGCCCTCTCCCAATACCAAACACCCCTATTCGTATGATCCGTCCTCATCACTGCTGTCCTCCTACTACTCTCACTACCAGTCCTAGCTGCTGGCATTACTATACTACTAACAGATCGAAACCTCAATACAACATTCTTCGATCCTGCTGGTGGAGGCGACCCTATCCTATATCAACACCTCTTCTGATTCTTCGGACACCCAGAAGTCTACATTCTCATTCTA
-- end --

Download FASTA File

Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Statistics of barcoding coverage: Accipiter striatus

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 20
Specimens with Barcodes: 26
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Conservation

Conservation Status

IUCN Red List Assessment


Red List Category
LC
Least Concern

Red List Criteria

Version
3.1

Year Assessed
2012

Assessor/s
BirdLife International

Reviewer/s
Butchart, S. & Symes, A.

Contributor/s

Justification
This species has an extremely large range, and hence does not approach the thresholds for Vulnerable under the range size criterion (Extent of Occurrence <20,000 km2 combined with a declining or fluctuating range size, habitat extent/quality, or population size and a small number of locations or severe fragmentation). The population trend appears to be increasing, and hence the species does not approach the thresholds for Vulnerable under the population trend criterion (>30% decline over ten years or three generations). The population size is extremely large, and hence does not approach the thresholds for Vulnerable under the population size criterion (<10,000 mature individuals with a continuing decline estimated to be >10% in ten years or three generations, or with a specified population structure). For these reasons the species is evaluated as Least Concern.

History
  • Least Concern (LC)
  • Least Concern (LC)
  • Least Concern (LC)
  • Not Recognized (NR)
  • Not Recognized (NR)
  • Not Recognized (NR)
  • Not Recognized (NR)