Articles on this page are available in 1 other language: Spanish (11) (learn more)

Overview

Brief Summary

Accipiter striatus

The Sharp-shinned Hawk is often confused with its slightly larger relative, the Cooper’s Hawk. Both species are blue-gray above and streaked rusty-red below with long tails, yellow legs, and small, hooked beaks. However, the Sharp-shinned Hawk has a squared-off tail (Cooper’s Hawks have rounded tails), and is slightly smaller at 10-14 inches long. The Sharp-shinned Hawk exhibits the greatest difference in size between males and females (known as sexual dimorphism) of any raptor in North America, with females weighing almost twice as much as males. The Sharp-shinned Hawk also breeds less widely than the Cooper’s Hawk. While that species breeds across the United States and southern Canada, the Sharp-shinned Hawk’s main breeding range is restricted to the Canadian sub-arctic and higher elevation areas of the Appalachians and Rockies. This species migrates south in winter, when it may be found more widely across the U.S.In its range, the Sharp-shinned Hawk is among the most adaptable raptors. While usually found in forest habitats, this species has expanded into human-altered landscapes and now frequents towns and suburbs as well. The Sharp-shinned Hawk, like all ‘bird hawks,’ is capable of hunting birds from the air. In fact, this species is known for entering yards to take small songbirds from feeders. With the aid of binoculars, Sharp-shinned Hawks may be seen perched in trees while scanning for prey. However, they are often more easily seen in the air while moving between perches or while actively hunting. As this species hunts by sight, it is only active during the day.

Threat Status: Least concern

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Unknown

Supplier: DC Birds

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Distribution

Sharp-shinned hawks can be found throughout much of North America, including Mexico. In South America, they are found from Venezuela to northern Argentina. Most of the North American populations migrate to the southern parts of their range in winter.

Biogeographic Regions: nearctic (Native ); neotropical (Native )

  • Bildstein, K., K. Meyer. 2000. Sharp-shinned hawk (Accipiter striatus). A Poole, F Gill, eds. In The Birds of North America, No. 482. Philadelphia, PA: The Birds of North America, Inc.
  • Sullivan, J. 1994. "Accipiter striatus" (On-line). Fire Effects Information System. Accessed February 25, 2004 at http://www.fs.fed.us/database/feis/wildlife/bird/acst/.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Range Description

This species has a large, discontinuous range in the Americas. It occurs from Alaska (USA) and Canada south to Panama, and populations are also found in the West Indies, in hills and mountains from Venezuala and Colombia through Ecuador and Peru to western Bolivia, and from southern Brazil through Uruguay and Paraguay to south-east Bolivia and northern Argentina.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

occurs (regularly, as a native taxon) in multiple nations

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

National Distribution

Canada

Origin: Native

Regularity: Regularly occurring

Currently: Present

Confidence: Confident

Type of Residency: Year-round

United States

Origin: Native

Regularity: Regularly occurring

Currently: Present

Confidence: Confident

Type of Residency: Year-round

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Global Range: (>2,500,000 square km (greater than 1,000,000 square miles)) BREEDS: western and central Alaska to northern Saskatchewan, southern Labrador, and Newfoundland, south to South America. NORTHERN WINTER: north to southern Alaska and southern Canada (casually). U.S. and Canadian populations winter south to Panama and West Indies. RESIDENT populations occur in Middle and South America (northwestern Venezuela, south in Andes to northern Argentina; Paraguay to southeastern Brazil, Uruguay) and Puerto Rico (AOU 1983, Sibley and Monroe 1990).

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Geographic Range

Sharp-shinned hawks can be found throughout much of North America, including Mexico. In South America, they are found from Venezuela to northern Argentina. Most of the North American populations migrate to the southern parts of their range in winter.

Biogeographic Regions: nearctic (Native ); neotropical (Native )

  • Bildstein, K., K. Meyer. 2000. Sharp-shinned hawk (Accipiter striatus). A Poole, F Gill, eds. In The Birds of North America, No. 482. Philadelphia, PA: The Birds of North America, Inc.
  • Sullivan, J. 1994. "Accipiter striatus" (On-line). Fire Effects Information System. Accessed February 25, 2004 at http://www.fs.fed.us/database/feis/wildlife/bird/acst/.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: BioKIDS Critter Catalog

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

The sharp-shinned hawk breeds from western and central Alaska and
northern Yukon Territory east to the Atlantic coast, and south to
southern California, southern Texas, the northern parts of the Gulf
States, and South Carolina [10,39,50].

Sharp-shinned hawks winter from Vancouver Island, southern British Columbia,
western Montana, Nebraska, southern Minnesota, Illinois, southern Michigan,
southern Ontario, New York, southern Vermont, southern New Hampshire,
southern Maryland, New Brunswick, and Nova Scotia south to Panama and the
Bahamas [10,39,50].
  • 10. DeGraaf, Richard M.; Scott, Virgil E.; Hamre, R. H.; [and others]
  • 39. Palmer, Ralph S., ed. 1988. Handbook of North American birds. New Haven, CT: Yale University Press. 5 volumes. [23780]
  • 50. Terres, John K. 1980. The Audubon Society encyclopedia of North American birds. New York: Alfred A. Knopf. 1109 p. [16195]

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Regional Distribution in the Western United States

More info on this topic.

This species can be found in the following regions of the western United States (according to the Bureau of Land Management classification of Physiographic Regions of the western United States):

1 Northern Pacific Border
2 Cascade Mountains
3 Southern Pacific Border
4 Sierra Mountains
5 Columbia Plateau
6 Upper Basin and Range
7 Lower Basin and Range
8 Northern Rocky Mountains
9 Middle Rocky Mountains
10 Wyoming Basin
11 Southern Rocky Mountains
12 Colorado Plateau
13 Rocky Mountain Piedmont
14 Great Plains
15 Black Hills Uplift
16 Upper Missouri Basin and Broken Lands

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Occurrence in North America

AL AK AZ AR CA CO CT DE FL GA ID IL IN IA KS KY LA ME MD MA MI MN MS MO MT NE NV NH NJ NM NY NC ND OH OK OR PA RI SC SD TN TX UT VT VA WA WV WI WY PR AB BC MB NB NF NT NS ON PE PQ SK YT MEXICO

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Physical Description

Morphology

Sharp-shinned hawks are the smallest accipiters (bird hawks) in North America. Males are 24 to 27 cm long and weigh 87 to 114 g. Females are larger, measuring 29 to 34 cm in length and weighing 150 to 218 g. Males have a wingspan of 53 to 56 cm and females 58 to 65 cm.

Sharp-shinned hawks have bluish-gray to slate colored upperparts, with darker coloration on the crown. Their underparts are white with brown bars and their short, rounded wings are dark above and light below. Females have fewer bars on the breast, and their upper parts are more brownish. Sharp-shinned hawks have a short, dark colored, hooked beak and yellow legs and feet. Their tail is square-tipped when not spread and has three to five dark stripes with a small white stripe on the tip. Molting does not change the adult’s appearance. Juveniles have more streaking and/or barring and paler coloration than adults. Sharp-shinned hawks look similar to Cooper’s hawks (Accipiter cooperii) but are smaller.

Range mass: 87 to 218 g.

Range length: 24 to 34 cm.

Range wingspan: 53 to 65 cm.

Sexual Dimorphism: female larger; sexes colored or patterned differently

Other Physical Features: endothermic ; bilateral symmetry

  • Gough, G., J. Sauer, M. Iliff. 1998. "Sharp-shinned hawk (Accipiter striatus)" (On-line). Patuxent Bird Identification Infocenter. Accessed February 25, 2004 at http://www.mbr-pwrc.usgs.gov/id/framlst/i3320id.html.
  • Wheeler, B., W. Clark. 1995. A Photographic Guide to North American Raptors. London: Academic Press.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Physical Description

Sharp-shinned hawks are the smallest Accipiter in North America. Males are 24 to 27 cm long and weigh 87 to 114 g. Females are larger, measuring 29 to 34 cm in length and weighing 150 to 218 g. Males have a wingspan of 53 to 56 cm and females 58 to 65 cm.

Sharp-shinned hawks have bluish-gray to slate colored upperparts, with darker coloration on the crown. Their underparts are white with brown bars and their short, rounded wings are dark above and light below. Females have fewer bars on the breast, and their upper parts are more brownish. Sharp-shinned hawks have a short, dark colored, hooked beak and yellow legs and feet. Their tail is square-tipped when not spread and has three to five dark stripes with a small white stripe on the tip. Molting does not change the adult’s appearance. Juveniles have more streaking and/or barring and paler coloration than adults. Sharp-shinned hawks look similar to Cooper’s hawks (Accipiter cooperii) but are smaller.

Range mass: 87 to 218 g.

Range length: 24 to 34 cm.

Range wingspan: 53 to 65 cm.

Sexual Dimorphism: female larger; sexes colored or patterned differently

  • Gough, G., J. Sauer, M. Iliff. 1998. "Sharp-shinned hawk (Accipiter striatus)" (On-line). Patuxent Bird Identification Infocenter. Accessed February 25, 2004 at http://www.mbr-pwrc.usgs.gov/id/framlst/i3320id.html.
  • Wheeler, B., W. Clark. 1995. A Photographic Guide to North American Raptors. London: Academic Press.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: BioKIDS Critter Catalog

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Size

Length: 36 cm

Weight: 174 grams

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Ecology

Habitat

Sharp-shinned hawks are forest birds. They are found in pine, fir and aspen forests (among others). They can be found hunting in forest interior and edges from sea level to near alpine areas. Sharp-shinned hawks can also be found near rural, suburban and agricultural areas, where they often hunt at bird feeders.

Habitat Regions: temperate ; tropical ; terrestrial

Terrestrial Biomes: forest

Other Habitat Features: suburban ; agricultural

  • Campbell, R., N. Dawe, I. McTaggart-Cowan, J. Cooper, G. Kaiser, M. McNall. 1990. The Birds of British Columbia, Volume II: Non-passerines, Diurnal Birds of Prey through Woodpeckers. Victoria: The Royal British Columbia Museum.
  • Snyder, N., H. Snyder. 1991. Birds of Prey: Natural History and Conservation of North American Raptors. Stillwater, MN: Voyageur Press.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Habitat and Ecology

Habitat and Ecology
The species inhabits a wide variety of habitats, depending on the region, including boreal coniferous forests, temperate deciduous woodland, tropical and subtropical cloud forest, gallery forest and semi-open savanna woodland, from sea level to 2,700 m. Outside the breeding season, North American birds can be found in almost any terrain, including urban areas with trees.

Systems
  • Terrestrial
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Comments: Forest and open woodland, coniferous, mixed, or deciduous, primarily in coniferous in more northern and mountainous portion of range (AOU 1983). Primary habitat is boreal forest, with the greatest nesting densities occurring in eastern Canada. Young, dense, mixed or coniferous woodlands are preferred for nesting (Platt 1976, Reynolds et al. 1982, Meyer 1987). Where conifers are scarce, as in the prairie regions, cottonwoods, poplars, and other members of the Betulaceae may be used (Bent 1937). Migrates through various habitats, mainly along ridges, lakeshores, and coastlines (NGS 1983). Nests usually in tree crotch or on branch next to trunk, most often 3-18 m up, hidden by thick foliage, usually in conifer in north. May build new nest, reuse old one, or modify old bird or squirrel nest. Nests generally seem to be in a stand of dense conifers near a forest opening, though this may reflect observer bias (Meyer 1987). Pairs apparently remain faithful to nesting areas for several years, although a new nest is usually constructed each season. However, this may not be universally true (Herron et al., 1985, stated that pairs are not faithful to a nest site).

In Nevada, nesting occurs at elevations of 6500-9000 feet, intermediate between Cooper's below, and goshawks above (Herron et al. 1985).

One study quantified habitat parameters for nest sites in pine plantations in Missouri (Wiggers and Kritz 1991). The nest sites were characterized as medium age (25-49 yr), with high tree density (1370 trees/ha), basal area (37 sq m per ha), and percentage canopy coverage (82%). Nest trees were usually of normal growth form and nests were in the canopy. In this study, Cooper's hawks also nested in the same type of habitat, with essentially the same characteristics, but chose deformed nest trees most often and placed nests below canopy. Sharp-shin nesting sites were in stands averaging 11.8 ha compared to an average of 4.1 ha for Cooper's hawks in pine stands or 53 ha for Cooper's in hardwood habitat (Wiggers and Kritz 1991).

The foraging habitat during the breeding season is essentially the same as that chosen for nesting, and the birds appear to avoid open, deciduous forests, at least in Canada (Meyer 1987). During the winter, however, the males tend to hunt most frequently along hedgerows, field edges and other ecotonal habitats, while females usually stick to extensive stands of forest or riparian areas (Meyer 1987).

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Sharp-shinned hawks are forest birds. They are found in pine, fir and aspen forests (among others). They can be found hunting in forest interior and edges from sea level to near alpine areas. Sharp-shinned hawks can also be found near rural, suburban and agricultural areas, where they often hunt at bird feeders.

Habitat Regions: temperate ; tropical ; terrestrial

Terrestrial Biomes: forest

Other Habitat Features: suburban ; agricultural

  • Campbell, R., N. Dawe, I. McTaggart-Cowan, J. Cooper, G. Kaiser, M. McNall. 1990. The Birds of British Columbia, Volume II: Non-passerines, Diurnal Birds of Prey through Woodpeckers. Victoria: The Royal British Columbia Museum.
  • Snyder, N., H. Snyder. 1991. Birds of Prey: Natural History and Conservation of North American Raptors. Stillwater, MN: Voyageur Press.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: BioKIDS Critter Catalog

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Cover Requirements

More info for the term: cover

Nesting Cover: Nests are almost always built in trees with very dense
foliage [10,39].

Foraging Cover: Sharp-shinned hawks prefer perches with substantial
arboreal cover from which to spot and capture prey; however, these
perches are often located near open areas in which prey is more easily
spotted and pursued [27].
  • 10. DeGraaf, Richard M.; Scott, Virgil E.; Hamre, R. H.; [and others]
  • 27. Kochert, Michael N. 1986. Raptors. In: Cooperrider, Allan Y.; Boyd, Raymond J.; Stuart, Hanson R., eds. Inventory and monitoring of wildlife habitat. Denver, CO: U.S. Department of the Interior, Bureau of Land Management, Denver Service Center: 313-349. [13527]
  • 39. Palmer, Ralph S., ed. 1988. Handbook of North American birds. New Haven, CT: Yale University Press. 5 volumes. [23780]

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Preferred Habitat

More info for the terms: cover, density, shrubs, tree

Sharp-shinned hawks breed in coniferous forests adjacent to other types
of stands; prey is usually more plentiful in mixed or patchy forests
than in large continuous stands of conifers [39].

Nesting: Sharp-shinned hawk nests are built within the canopy rather
than below it. Nest trees typically have dense foliage and are usually
conifers. In Utah, some sharp-shinned hawk nests were built in diseased
deciduous trees that had abnormally dense foliage [40]. In Missouri,
nests were typically built in shortleaf pine or in Virginia pine (Pinus
virginiana) trees [54]. In canyons, nest trees are usually 165 to 330
feet (50-100 m) upslope from a stream [27,42]. In northwestern Oregon,
most nest trees were on gentle to moderate slopes (15-37%) with
northerly exposures; nest trees in eastern Oregon were on slopes ranging
from 8 to 47 percent [43]. Nests are occasionally built in rock
crevices or hollow trees [50]. In Oregon, sharp-shinned hawks nest from
near sea level to near timberline [42]; Nests were found from 396 feet
(120 m) to 6,633 feet (2,010 m) elevation [43].

Nesting habitat for sharp-shinned hawks usually consists of dense stands
of trees with a well developed canopy (canopy cover of 60% or more) and
a dense understory [27]. In Oregon, sharp-shinned hawks breed in young
(30- to 70-year-old), mature (80- to 190-year-old), and old-growth (over
190 years) forest [20]. In the Sierra Nevada, mixed conifer forests are
suitable habitat for sharp-shinned hawks. Seral stages and cover
classes of suitable nesting habitat are as follows: pole-medium tree
stage with 40 to 69 percent canopy cover, pole-medium tree stage with 70
percent or more canopy cover, and large tree stage with 70 percent or
more canopy cover [53]. In western forests, sharp-shinned hawks breed
in dense, young (25- to 50-year-old), even-aged second-growth stands with
single-layered canopies [27], and in 40- to 60-year-old even-aged
conifer stands [5,42]. In the Inland Northwest, sharp-shinned hawks
breed in pole-sapling, young, and mature mixed conifer forests, but not
in shrub-seedling stands or in old-growth forests [46]. In Idaho,
between May and August, sharp-shinned hawks were usually observed in
open riparian habitat or in parklike stands of coniferous forest.
However, it was noted that these hawks are difficult to observe in the
dense forests in which nests are built [52].

In Oregon, mean stand density of nest sites was 472 trees per acre
(1,180 trees/ha). Typical forest structure for Oregon nest sites is an
overstocked stand with a shallow canopy and many dead limbs below the
live crowns [42]. In Oregon, nest sites (described as the area used by
a nesting pair and fledglings including roosts and perches used to pluck
prey) averaged about 9.9 acres (4 ha). The average nesting range in
Idaho was 0.33 square mile (0.85 sq km) [52] and in Wyoming was 0.44
square mile (1.1 sq km) [7]. In Oregon, minimum nesting territory size
was estimated as 0.4 square mile (1 sq km) [20]. Many nest sites had
limits coinciding with discrete boundaries between vegetative structures
or topographic features [42].

In Oregon, nest density was estimated as one nest per 6,792 acres (2,750
ha), with mean nearest conspecific neighbor distance of 2.5 miles (4.1
km) [44]. In Idaho, nest density was estimated as 4.2 pairs of
sharp-shinned hawks per 10 square miles (1.6 pairs per 10 sq km) [52].

Foraging: Foraging habitat for sharp-shinned hawks includes nesting
habitat, but the hawks also forage in more open environments [27]. In
the Inland Northwest, sharp-shinned hawks feed in shrub-seedling stands
and in pole-sapling, young, mature, and old-growth mixed conifer forests
[46]. Sharp-shinned hawk habitat includes canyons, valleys, and
riparian areas [27].

Migration: Concentrations of migrating sharp-shinned hawks have been
observed along the ridgetops of the Allegheny Mountains in the Ridge
and Valley Sections [48]. During migration sharp-shinned hawks will
occupy almost any type of habitat that contains trees or shrubs [10].

Wintering: The sharp-shinned hawk is less specific in its habitat
preferences in winter than in summer, and occurs in almost any forested
or shrubby habitat including riparian areas, woodlands, farmlands, urban
areas, and other areas more open than nesting habitat [10].
  • 10. DeGraaf, Richard M.; Scott, Virgil E.; Hamre, R. H.; [and others]
  • 20. Hansen, Andrew J.; Garman, Steven L.; Marks, Barbara; Urban, Dean L. 1993. An approach for managing vertebrate diversity across multiple-use landscapes?. Ecological Applications. 3(3): 481-496. [22872]
  • 27. Kochert, Michael N. 1986. Raptors. In: Cooperrider, Allan Y.; Boyd, Raymond J.; Stuart, Hanson R., eds. Inventory and monitoring of wildlife habitat. Denver, CO: U.S. Department of the Interior, Bureau of Land Management, Denver Service Center: 313-349. [13527]
  • 39. Palmer, Ralph S., ed. 1988. Handbook of North American birds. New Haven, CT: Yale University Press. 5 volumes. [23780]
  • 40. Platt, Joseph B. 1976. Sharp-shinned hawk nesting and nest site selection in Utah. Condor. 78(1): 102-103. [23781]
  • 42. Reynolds, Richard T. 1983. Management of western coniferous forest habitat for nesting accipiter hawks. Gen. Tech. Rep. RM-102. Fort Collins, CO: U.S. Department of Agriculture, Forest Service, Rocky Mountain Forest and Range Experiment Station. 7 p. [21388]
  • 43. Reynolds, Richard T.; Meslow, E. Charles; Wight, Howard M. 1982. Nesting habitat of coexisting Accipiter in Oregon. Journal of Wildlife Management. 46(1): 124-138. [24590]
  • 44. Reynolds, Richard T.; Wight, Howard M. 1978. Distribution, density, and productivity of accipiter hawks breeding in Oregon. Wilson Bulletin. 90(2): 182-196. [24966]
  • 46. Sanderson, H. Reed; Bull, Evelyn L.; Edgerton, Paul J. 1980. Bird communities in mixed conifer forests of the interior northwest. In: DeGraaf, Richard M., technical coordinator. Management of western forests and grasslands for nongame birds: Workshop proceedings; 1980 February 11-14; Salt Lake City, UT. Gen. Tech. Rep. INT-86. Ogden, UT: U.S. Department of Agriculture, Forest Service, Intermountain Forest and Range Experiment Station: 224-237. [17907]
  • 48. Stewart, Robert E.; Robbins, Chandler S. 1958. Birds of Maryland and the District of Columbia. North American Fauna: No. 62. Washington, DC: U.S. Department of the Interior, Fish and Wildlife Service. 401 p. [24044]
  • 5. Call, Mayo. 1979. Habitat management guides for birds of prey. Techical Note 338. Denver, CO: U.S. Department of the Interior, Bureau of Land Management, Denver Service Center. 70 p. [22451]
  • 50. Terres, John K. 1980. The Audubon Society encyclopedia of North American birds. New York: Alfred A. Knopf. 1109 p. [16195]
  • 52. Thurow, Thomas L.; Peterson, Steven R. 1978. A preliminary survey of raptorial birds in the Idaho primitive area. Station Note No. 31. Moscow, ID: University of Idaho, Wilderness Research Center. 6 p. [21285]
  • 53. Verner, Jared. 1980. Bird communities of mixed-conifer forests of the Sierra Nevada. In: DeGraaf, Richard M., technical coordinator. Management of western forests and grasslands for nongame birds: Workshop proceedings; 1980 February 11-14; Salt Lake City, UT. Gen. Tech. Rep. INT-86. Ogden, UT: U.S. Department of Agriculture, Forest Service, Intermountain Forest and Range Experiment Station: 198-223. [17906]
  • 54. Wiggers, Ernie P.; Kritz, Kevin J. 1991. Comparison of nesting habitat of coexisting sharp-shinned and Cooper's hawks in Missouri. Wilson Bulletin. 103(4): 568-577. [23779]
  • 7. Craighead, John J.; Craighead, Frank C., Jr. 1969. Hawks, owls and wildlife. Dover Edition. New York: Dover Publications, Inc. 443 p. [24517]

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Associated Plant Communities

More info for the term: mesic

The sharp-shinned hawk occurs primarily in coniferous forests, but is
also found in boreal mixed conifer-birch-aspen forests [50]. It is less
common in other woodland types, except in mountainous areas [10]. Open
areas are used for foraging but not for nesting. Diem and Zeveloff [11]
listed sharp-shinned hawks as members of ponderosa pine (Pinus
ponderosa) bird communities in the western United States.

Breeding: In Colorado, sharp-shinned hawks breed in quaking aspen
(Populus tremuloides) and conifer (Picea spp., Abies spp., Pinus spp.,
and Pseudotsuga menziesii) forests. Nests are usually only built in
conifer stands; within quaking aspen forests, nests are built in patches
of conifers within aspen stands [24]. In Missouri, most sharp-shinned
hawk nesting occurs in plantation pine (mostly shortleaf pine [Pinus
echinata]) with some nests in mixed pine-hardwoods [54]. Optimal
breeding habitat in the southeastern states is mixed pine-hardwoods.
Marginal breeding habitat includes eastern white pine (Pinus
strobus)-eastern hemlock (Tsuga canadensis), cove hardwoods (hardwood
forests on mesic sites), and maple (Acer spp.)-beech (Fagus spp.)-birch
(Betula spp.) [27]. Mansell [35] recorded a sharp-shinned hawk nest in
a field that had numerous clumps of small pines and spruces.

Foraging: In Colorado, sharp-shinned hawks were observed hunting in
mature aspen (Populus spp.), conifer, and mixed aspen-conifer forests
[24]. In southern Arizona, sharp-shinned hawks were frequently seen
perched or flying in dense stands of mature mesquite (Prosopis spp.),
hackberry (Celtis occidentalis), wolfberry (Lycium spp.), and
falsemesquite (Calliandra spp.) along sandy washes and around stock
tanks, which constitutes habitat preferred by Gambel's quail (Callipepla
gambelii) but not by scaled quail (C. squamata) [17].

Wintering: In California riparian woodland, sharp-shinned hawks were
present from August to May but were not present during the breeding
season [32]. In southern California, sharp-shinned hawks were commonly
seen in chaparral (Adenostoma, Ceanothus, and Arctostaphylos spp.)
except during the summer months [55]. Optimum winter habitat for
sharp-shinned hawks in the southeastern states is live oak (Quercus
virginiana)-maritime forest. Suitable habitat in the southeastern
states for wintering sharp-shinned hawks includes tropical hardwood
forest, southern scrub oak (Quercus spp.), southern mixed-mesic
hardwoods, bay swamp-pocosin, pond pine (P. serotina)-pocosin, loblolly
pine (P. taeda)- shortleaf pine, and elm-ash-cottonwood (Ulmus
spp.-Fraxinus spp.-Populus spp.). Marginal winter habitat includes sand
pine (P. clausa)-southern scrub oak, longleaf pine (P. palustris)-
southern scrub oak, sandhills longleaf pine, longleaf pine-slash pine
(P. elliottii), and oak-gum-cypress (Quercus spp.-Liquidambar
styraciflua and Nyssa spp.-Taxodium spp.) [19].
  • 10. DeGraaf, Richard M.; Scott, Virgil E.; Hamre, R. H.; [and others]
  • 11. Diem, Kenneth L.; Zeveloff, Samuel I. 1980. Ponderosa pine bird communities. In: DeGraaf, Richard M., technical coordinator. Management of western forests and grasslands for nongame birds: Workshop proceedings; 1980 February 11-14; Salt Lake City, UT. Gen. Tech. Rep. INT-86. Ogden, UT: U.S. Department of Agriculture, Forest Service, Intermountain Forest and Range Experiment Station: 170-197. [17904]
  • 17. Goodwin, John G., Jr.; Hungerford, C. Roger. 1977. Habitat use by native Gambel's and scaled quail and released masked bobwhite quail in southern Arizona. Res. Pap. RM-197. Fort Collins, CO: U.S. Department of Agriculture, Forest Service, Rocky Mountain Forest and Range Experiment Station. 8 p. [14970]
  • 19. Hamel, Paul B.; LeGrand, Harry E., Jr.; Lennartz, Michael R.; Gauthreaux, Sidney A., Jr. 1982. Bird-habitat relationships on southeastern forest lands. Gen. Tech. Rep. SE-22. Asheville, NC: U.S. Department of Agriculture, Forest Service, Southeastern Forest Experiment Station. 417 p. [15423]
  • 24. Joy, Suzanne M.; Reynolds, Richard T.; Knight, Richard L.; Hoffman, Richard W. 1994. Feeding ecology of sharp-shinned hawks nesting in deciduous and coniferous forests in Colorado. Condor. 96: 455-467. [23439]
  • 27. Kochert, Michael N. 1986. Raptors. In: Cooperrider, Allan Y.; Boyd, Raymond J.; Stuart, Hanson R., eds. Inventory and monitoring of wildlife habitat. Denver, CO: U.S. Department of the Interior, Bureau of Land Management, Denver Service Center: 313-349. [13527]
  • 32. Laymon, Stephen A. 1984. Riparian bird community structure and dynamics: Dog Island, Red Bluff, California. In: Warner, Richard E.; Hendrix, Kathleen M., eds. California riparian systems: Ecology, conservation, and productive management: Proceedings of a conference; 1981 September 17-19; Davis, CA. Berkeley, CA: University of California Press: 587-597. [5860]
  • 35. Mansell, William. 1980. North American birds of prey. New York: William Morrow and Co., Inc. 176 p. [24538]
  • 50. Terres, John K. 1980. The Audubon Society encyclopedia of North American birds. New York: Alfred A. Knopf. 1109 p. [16195]
  • 54. Wiggers, Ernie P.; Kritz, Kevin J. 1991. Comparison of nesting habitat of coexisting sharp-shinned and Cooper's hawks in Missouri. Wilson Bulletin. 103(4): 568-577. [23779]
  • 55. Wirtz, William O., II. 1991. Avifauna in southern California chaparral: seasonal distribution, habitat association, reproductive phenology. Res. Pap. PSW-RP-209. Berkeley, CA: U.S. Department of Agriculture, Forest Service, Pacific Southwest Research Station. 19 p. [23431]

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Habitat: Ecosystem

More info on this topic.

This species is known to occur in the following ecosystem types (as named by the U.S. Forest Service in their Forest and Range Ecosystem [FRES] Type classification):

FRES10 White-red-jack pine
FRES11 Spruce-fir
FRES12 Longleaf-slash pine
FRES13 Loblolly-shortleaf pine
FRES14 Oak-pine
FRES15 Oak-hickory
FRES16 Oak-gum-cypress
FRES17 Elm-ash-cottonwood
FRES18 Maple-beech-birch
FRES19 Aspen-birch
FRES20 Douglas-fir
FRES21 Ponderosa pine
FRES22 Western white pine
FRES23 Fir-spruce
FRES24 Hemlock-Sitka spruce
FRES25 Larch
FRES26 Lodgepole pine
FRES27 Redwood
FRES28 Western hardwoods
FRES32 Texas savanna
FRES34 Chaparral-mountain shrub
FRES35 Pinyon-juniper

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Habitat: Cover Types

More info on this topic.

This species is known to occur in association with the following cover types (as classified by the Society of American Foresters):

Sharp-shinned hawks occur in almost every forest type.

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Habitat: Plant Associations

More info on this topic.

This species is known to occur in association with the following plant community types (as classified by Küchler 1964):

Sharp-shinned hawks occur in almost every forest type.

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Migration

Non-Migrant: Yes. At least some populations of this species do not make significant seasonal migrations. Juvenile dispersal is not considered a migration.

Locally Migrant: Yes. At least some populations of this species make local extended movements (generally less than 200 km) at particular times of the year (e.g., to breeding or wintering grounds, to hibernation sites).

Locally Migrant: Yes. At least some populations of this species make annual migrations of over 200 km.

Northern populations are migratory, usually arrive in nesting areas by April-May; southward migration occurs August-October in Canada and northern U.S. Arrives in Costa Rica by mid-October, remains until March (Stiles and Skutch 1989). High proportion of birds banded in Minnesota were recovered in Mexico and Central America in late fall-winter. See Palmer (1988) for more detail. Often aggregates during migration.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Trophic Strategy

Small birds comprise ninety percent of a sharp-shinned hawk’s diet, which also includes small mammals and large insects. Sharp-shinned hawks mainly eat Passeriformes (perching birds), but also eat Falconiformes (diurnal birds of prey), Galliformes (chicken-like birds), Charadriiformes (shorebirds and relatives), Columbiformes (doves and pigeons), Apodiformes (swifts and hummingbirds) and Piciformes (woodpeckers and relatives). They often catch birds at feeders and take young birds from nests.

Sharp-shinned hawks are opportunistic hunters. They often hunt from a perch and dart out from hiding to catch prey. Their long, sharp talons help them to grab onto prey and their short bursts of high-speed flight help them to catch their prey. Sharp-shinned hawks pluck their prey before eating them. They get sufficient water from prey and do not need to drink.

Animal Foods: birds; mammals; insects

Primary Diet: carnivore (Eats terrestrial vertebrates)

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Comments: Eats mainly small to medium-sized birds; occasionally small mammals, insects, lizards, etc. Hunts from inconspicuous perch or by stealthy flights along paths and around bushes and trees (Evans 1982). In Colorado, nestling and fledgling birds were common prey items when hawks were feeding young (Joy et al., 1994, Condor 96:455-467).

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Food Habits

Sharp-shinned hawks mainly eat small birds. They also eat small mammals and large insects. They often catch birds at bird feeders and take young birds from nests. When they catch birds, sharp-shinned hawks pluck the feathers before eating the bird.

Sharp-shinned hawks often hunt from a perch and dart out from hiding to catch prey. Their long, sharp talons help them to grab onto prey and their short bursts of high-speed flight help them to catch their prey. They get all their water from prey and do not need to drink.

Animal Foods: birds; mammals; insects

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: BioKIDS Critter Catalog

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Food Habits

Sharp-shinned hawks prey largely on small birds; typically, prey birds
are sparrow-sized but occasionally larger birds are taken [10].
Sharp-shinned hawks forage in open forest, on the forest floor, in
meadow grasses, and in bushy pastures [10,39]. A characteristic hunting
style is to spot prey from a well-hidden perch and then fly quickly out
to capture it. The sharp-shinned hawk "is numero uno at sneak attack"
[39]. Other styles include speculative flight: The sharp-shinned hawk
flies (flaps and glides) close to the ground, darting under branches or
across small openings and over brushfields or meadows. The hawk can
turn rapidly to grasp small birds in flight, drop to catch them on the
ground, or grab prey that is perched. Prey is often pursued into dense
foliage. Top flight speed is 28 miles per hour (47 km/h) [10,14,39,59].

In Colorado, birds constituted 91.1 percent of the prey of 11 nesting
pairs of sharp-shinned hawks. The most frequently taken bird species
included yellow-rumped warbler (Dendroica coronata), American robin
(Turdus migratorius), white-crowned sparrow (Zonotrichia leucophrys),
and dark-eyed junco (Junco hyemalis). Yellow-rumped warblers, dark-eyed
juncos, and American robins were among the most abundant birds in the
area. Small birds were eaten in proportion to their relative frequency
in dominant and secondary habitat types, but the proportion eaten was
different from relative abundance in limited habitats. Mammals averaged
8.9 percent of prey taken; 60 percent of the mammals eaten were voles
(Clethrionomys, Microtus, and Phenacomys spp.) [24].

In North America, the most common bird species taken by sharp-shinned
hawks include American robin, starling (Sturnus vulgaris), catbird
(Dumetella carolinensis), house sparrow (Passer domesticus), towhees
(Pipilo spp.), sparrows (Aimophila spp., Spizella spp., and others), and
brown creeper (Certhia americana) [39,50]. Prey as small as Anna's
hummingbird (Calypte anna) and as large as northern bobwhite (Colinus
virginianus) and young domestic fowl have been reported. Nestlings and
young birds are common prey items, including the young of gallinaceous
birds [3] and other predatory birds such as flammulated owls (Asio
flammeus) [34]. Occasionally, the sharp-shinned hawk preys on mice,
shrews, moles, young lagomorphs, bats, red squirrel (Tamiasciurus
hudsonicus), frogs, butterflies, grasshoppers, and moths [3,9,39]. In
southern Arizona, sharp-shinned hawks were frequently seen perched or
flying in habitat preferred by Gambel's quail and were assumed to
represent a major cause of Gambel's quail mortality [17].

Sharp-shinned hawks have been known to attack pileated woodpeckers
(Dryocopus pileatus), but it is unclear whether attacks are territorial
or prandial in intent [39].
  • 10. DeGraaf, Richard M.; Scott, Virgil E.; Hamre, R. H.; [and others]
  • 14. Ehrlich, Paul R.; Dobkin, David S.; Wheye, Darryl. 1988. The birder's handbook: a field guide to the natural history of North American birds. New York: Simon & Schuster, Inc. 785 p. [21559]
  • 17. Goodwin, John G., Jr.; Hungerford, C. Roger. 1977. Habitat use by native Gambel's and scaled quail and released masked bobwhite quail in southern Arizona. Res. Pap. RM-197. Fort Collins, CO: U.S. Department of Agriculture, Forest Service, Rocky Mountain Forest and Range Experiment Station. 8 p. [14970]
  • 24. Joy, Suzanne M.; Reynolds, Richard T.; Knight, Richard L.; Hoffman, Richard W. 1994. Feeding ecology of sharp-shinned hawks nesting in deciduous and coniferous forests in Colorado. Condor. 96: 455-467. [23439]
  • 3. Bent, Arthur Cleveland. 1937. Life histories of North American birds of prey. Part 1 of 2. New York: Dover Publications, Inc. 409 p. [24963]
  • 34. Linkhart, Brian D.; Reynolds, Richard T. 1986. Brood division and postnesting behavior of flammulated owls. Wilson Bulletin. 99(2): 240-243. [6838]
  • 39. Palmer, Ralph S., ed. 1988. Handbook of North American birds. New Haven, CT: Yale University Press. 5 volumes. [23780]
  • 50. Terres, John K. 1980. The Audubon Society encyclopedia of North American birds. New York: Alfred A. Knopf. 1109 p. [16195]
  • 59. Eyre, F. H., ed. 1980. Forest cover types of the United States and Canada. Washington, DC: Society of American Foresters. 148 p. [905]
  • 9. DeGraaf, Richard M.; Yamasaki, Mariko. 1986. New England wildlife: habitat, natural history, and distribution. Gen. Tech. Rep. NE-108. Broomall, PA: U.S. Department of Agriculture, Forest Service, Northeastern Forest Experiment Station. 491 p. [21385]

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Associations

Sharp-shinned hawks are important members of their ecosystem. Because of their food habits they likely have a regulatory influence on local small bird populations. They are also an important food source for their predators.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Their secretive behavior and camouflaged nests help sharp-shinned hawks avoid predators. Known predators of sharp-shinned hawks include: bald eagles (Haliacetus leucocephalus), peregrine falcons (Falco peregrinus) and northern goshawks (Accipiter gentiles).

Known Predators:

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Ecosystem Roles

Sharp-shinned hawks are important members of their ecosystem. They have an influence on small bird populations and are also an important food source for their predators.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: BioKIDS Critter Catalog

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Predation

Their secretive behavior and camouflaged nests help sharp-shinned hawks avoid predators. Known predators of sharp-shinned hawks include: bald eagles (Haliacetus leucocephalus), peregrine falcons (Falco peregrinus) and northern goshawks (Accipiter gentiles).

Known Predators:

  • bald eagles (Haliacetus_leucocephalus)
  • peregrine falcons (Falco_peregrinus)
  • northern goshawks (Accipiter_gentilis)

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: BioKIDS Critter Catalog

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Predators

Nestling sharp-shinned hawks are preyed upon by other raptors including
Cooper's hawk (Accipiter cooperi) and northern goshawk (A. gentilis)
[3].
  • 3. Bent, Arthur Cleveland. 1937. Life histories of North American birds of prey. Part 1 of 2. New York: Dover Publications, Inc. 409 p. [24963]

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Known prey organisms

  • D. I. Rasmussen, Biotic communities of Kaibab Plateau, Arizona, Ecol. Monogr. 11(3):228-275, from p. 261 (1941).
  • Myers, P., R. Espinosa, C. S. Parr, T. Jones, G. S. Hammond, and T. A. Dewey. 2006. The Animal Diversity Web (online). Accessed February 16, 2011 at http://animaldiversity.org. http://www.animaldiversity.org
  • R. D. Bird, Biotic communities of the Aspen Parkland of central Canada, Ecology, 11:356-442, from p. 406 (1930).
  • R. D. Bird, Biotic communities of the Aspen Parkland of central Canada, Ecology, 11:356-442, from p. 410 (1930).
  • Waide RB, Reagan WB (eds) (1996) The food web of a tropical rainforest. University of Chicago Press, Chicago
Creative Commons Attribution 3.0 (CC BY 3.0)

© SPIRE project

Source: SPIRE

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Population Biology

Number of Occurrences

Note: For many non-migratory species, occurrences are roughly equivalent to populations.

Estimated Number of Occurrences: > 300

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Global Abundance

10,000 - 1,000,000 individuals

Comments: Very difficult to estimate population numbers; no range-wide census available. Regional estimates range from 30,100 for U.S. wintering population (Johnsgard 1990) to 500,000-1,000,000 breeding pairs in Canada (Kirk et al. 1995).

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

General Ecology

In Puerto Rico, breeding density in suitable habitat 1 individual per sq km (Delannoy and Cruz 1988); average distance between nests was 4.3 km in Oregon (see Palmer 1988).

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Habitat-related Fire Effects

The effects of fire on sharp-shinned hawk habitat are related to habitat
structure and to prey abundance and availability. The sharp-shinned
hawk is most benefited by a mixture of habitats. Fire in dense conifers
tends to thin understories and open canopies, making them less suitable
for sharp-shinned hawk nesting habitat; severe fire can destroy nest
trees, roost sites, and perching sites [33,58]. However, open canopies
are more suitable for hunting. Thus, the sharp-shinned hawk is
vulnerable to either extreme: loss of nesting habitat with fire, or the
lack of open foraging areas without fire [58]. Lehman and Allendorf
[33] stated that lack of fire, with concomitant increases in the density
of vegetation, can result in an increase in sharp-shinned hawk numbers.
However, sharp-shinned hawks occur in the following fire-dependent
(sensu Wright and Bailey [56]) ecosystems: ponderosa pine, Douglas-fir,
redwood (Sequoia sempervirens), sequoia (Sequoiadendron giganticus), and
chaparral [33].

Lawrence [31] reported that predatory birds increased in burned
chaparral for the first 2 postfire years, but declined the third year.
Sharp-shinned hawks were more abundant in the burned area in the first
postfire years, probably due to the increased vulnerability of prey.
Declines in later postfire years were attributed to increased vegetative
cover.

In the Southwest, sharp-shinned hawk prey populations and diversity
decreased during long fire-free intervals; the loss was attributed to a
reduction in grassy understory and in structural diversity caused by
lack of fire [12].
  • 12. Dodd, Norris L. 1988. Fire management and southwestern raptors. In: Gliski, R. L.; Pendleton, Beth Giron; Moss, Mary Beth; [and others]
  • 31. Lawrence, George E. 1966. Ecology of vertebrate animals in relation to chaparral fire in the Sierra Nevada foothills. Ecology. 47(2): 278-291. [147]
  • 33. Lehman, Robert N.; Allendorf, John W. 1989. The effects of fire, fire exclusion and fire management on raptor habitats in the western United States. In: Proceedings of the western raptor management symposium and workshop; 1987 October 26-28; Boise, ID. Scientific and Technical Series No. 12. Washington, DC: National Wildlife Federation: 236-244. [22324]
  • 56. Wright, Henry A.; Bailey, Arthur W. 1982. Fire ecology: United States and southern Canada. New York: John Wiley & Sons. 501 p. [2620]
  • 58. Snyder, Noel F. R.; Snyder, Helen A. 1975. Raptors in range habitat. In: Symposium on management of forest and range habitats for nongame birds: Proceedings; 1975 May 6-9; Tucson, AZ. Gen. Tech. Rep. WO-1. Washington, DC: U.S. Department of Agriculture, Forest Service: 190-209. [22700]

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Timing of Major Life History Events

Spring Migration: In Maryland, spring migration occurs from February 25
to March 5, with peak activity from April 5 to May 5 [48]. In Oregon,
sharp-shinned hawks arrived on nesting grounds in late April, the latest
of the three accipiter species nesting in the area [42].

Nest Building: In Maryland, nesting activities commence in early May.
Nesting is initiated until mid-July [48]. The sharp-shinned hawk nest
consists of sticks and twigs and is lined with strips of bark. It is up
to 2 feet (0.6 m) across, usually situated in a crotch or branch of a
tree next to the trunk, and ranges from 10 to 60 feet (3-18 m) above the
ground. New nests are usually built each year, but sharp-shinned hawks
occasionally adapt a squirrel (Tasaciurus and Sciurus spp.) or crow
(Corvus spp.) nest [14,50].

Clutch: Eggs are laid from May to July. During egg production, eggs
are laid on alternate days [40]. In New York, egg dates range from
April 16 to June 21 [9]. In Wyoming, the earliest egg laying date was
June 16 [7]. In Oregon, mean clutch completion date was May 26 and did
not vary much with elevation [42]. Clutch size is usually four or five
eggs, but ranges from three to eight eggs [14,50]. Eggs are incubated
by both parents [50]; incubation periods range from 34 to 35 days [9],
and all eggs usually hatch within a 36-hour period [40]. There is
usually only one brood per nesting season [9].

Development of Young: In Wyoming the average number of days in the nest
was 21, with a maximum number of 28 days [7]. Reynolds [42] reported an
average nestling period in Oregon of 23 days. Other authors reported
that females fledge at approximately 27 days and males fledge at
approximately 24 days after hatching [9,14]. In an Oregon study, 70 to
100 percent of hatched young survived to fly [44]. The fledglings
remain near the nest area and are fed by both parents for at least 21
and up to 50 days [39,42,50]. Food delivery by the parents decreases
markedly at 42 to 47 days [39]. Juvenile sharp-shinned hawks go through
first molt and acquire adult plumage at just over 1 year of age [23].

Fall Migration: Most sharp-shinned hawks in northern portions of the
breeding range migrate; birds that remain in the far north over the
winter are mostly juveniles, and do not usually survive the winter.
Most southwestern nesting sharp-shinned hawks also leave nesting
territories on a seasonal basis, but these birds probably do not travel
extensively [39]. Sharp-shinned hawks form large flocks during
migration [15] and often follow migrating flocks of songbirds. Migration
activity is initiated from late August to October [35]. In Maryland,
fall migration occurs from September 1 to November 25 [48].

Breeding Age and Longevity: Some sharp-shinned hawks first breed as
yearlings, but most do not breed until later [39]. Sharp-shinned hawk
ages of up to 12 years have been recorded; however, few sharp-shinned
hawks live longer than 5 years [39,50].

Mortality: Major identifiable causes of sharp-shinned hawk mortality
include "road kill" and predators [25]. Evans and Rosenfield [8]
reported sharp-shinned hawk mortality from collision with windows. In
the first half of this century, a large number of sharp-shinned hawks
were shot during migration (large flocks were easy targets); hawks are
now under legal protection so this threat is greatly reduced [45].
These hawks are still shot in the belief that they represent a threat to
domestic fowl or to songbirds [8,39]. Juvenile mortality is highest in
fall and winter. However, almost half of mortality in older birds
occurs in spring, apparently caused by the rigors of spring travel, and
occurs mostly among females [39].
  • 14. Ehrlich, Paul R.; Dobkin, David S.; Wheye, Darryl. 1988. The birder's handbook: a field guide to the natural history of North American birds. New York: Simon & Schuster, Inc. 785 p. [21559]
  • 15. Ehrlich, Paul R.; Dobkin, David S.; Wheye, Darryl. 1992. Birds in jeopardy. Stanford, CA: Stanford University Press. 259 p. [23303]
  • 23. Jones, Stephen. 1979. The accipiters: Goshawk, Cooper's hawk, sharp-shinned hawk. Unpublished report. BLM Contract No. YA-530-PH9-159. 51 p. On file with: U.S. Department of Agriculture, Forest Service, Intermountain Research Station, Fire Science Laboratory, Missoula, MT. [24586]
  • 25. Keran, Doug. 1981. The incidence of man-caused and natural mortalities to raptors. Raptor Research. 15(4): 108-112. [24965]
  • 35. Mansell, William. 1980. North American birds of prey. New York: William Morrow and Co., Inc. 176 p. [24538]
  • 39. Palmer, Ralph S., ed. 1988. Handbook of North American birds. New Haven, CT: Yale University Press. 5 volumes. [23780]
  • 40. Platt, Joseph B. 1976. Sharp-shinned hawk nesting and nest site selection in Utah. Condor. 78(1): 102-103. [23781]
  • 42. Reynolds, Richard T. 1983. Management of western coniferous forest habitat for nesting accipiter hawks. Gen. Tech. Rep. RM-102. Fort Collins, CO: U.S. Department of Agriculture, Forest Service, Rocky Mountain Forest and Range Experiment Station. 7 p. [21388]
  • 44. Reynolds, Richard T.; Wight, Howard M. 1978. Distribution, density, and productivity of accipiter hawks breeding in Oregon. Wilson Bulletin. 90(2): 182-196. [24966]
  • 45. Rosenfield, Robert N.; Bielefeldt, John; Anderson, Raymond K.; Papp, Joseph M. 1991. Accipiters. In: Pendleton, Beth Giron; Krahe, Diane L., eds. Proceedings of the Midwest raptor management symposium and workshop; [Date of conference unknown]
  • 48. Stewart, Robert E.; Robbins, Chandler S. 1958. Birds of Maryland and the District of Columbia. North American Fauna: No. 62. Washington, DC: U.S. Department of the Interior, Fish and Wildlife Service. 401 p. [24044]
  • 50. Terres, John K. 1980. The Audubon Society encyclopedia of North American birds. New York: Alfred A. Knopf. 1109 p. [16195]
  • 7. Craighead, John J.; Craighead, Frank C., Jr. 1969. Hawks, owls and wildlife. Dover Edition. New York: Dover Publications, Inc. 443 p. [24517]
  • 8. Evans, David L.; Rosenfield, Robert N. 1985. Migration and mortality of sharp-shinned hawks ringed at Duluth, Minnesota, USA. In: Newton, I.; Chancellor, R. D., eds. World conference on birds of prey: Conservation studies on raptors. ICBP Tech. Publ. No. 5. Cambridge, MA: 311-316. [24415]
  • 9. DeGraaf, Richard M.; Yamasaki, Mariko. 1986. New England wildlife: habitat, natural history, and distribution. Gen. Tech. Rep. NE-108. Broomall, PA: U.S. Department of Agriculture, Forest Service, Northeastern Forest Experiment Station. 491 p. [21385]

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Life History and Behavior

Behavior

Sharp-shinned hawks are usually quite silent. They vocalize more frequently during the breeding season. Their alarm calls sound like “kek-kek-kek” or “kik-kik-kik.” Males make a “kip…kip” or “kew kew kew” call when approaching the nest, and females reply with a “keeeep.” Females and nestlings also make “eee” calls.

Communication Channels: visual ; acoustic

Perception Channels: visual ; tactile ; acoustic ; chemical

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Communication and Perception

Sharp-shinned hawks are usually quite silent. They call more often during the breeding season. Their alarm calls sound like “kek-kek-kek” or “kik-kik-kik.” Males make a “kip…kip” or “kew kew kew” call when they come to the nest, and females reply with a “keeeep.” Females and nestlings also make “eee” calls.

Communication Channels: visual ; acoustic

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: BioKIDS Critter Catalog

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Life Expectancy

The longest recorded lifespan for a sharp-shinned hawk is 13 years. However, most do not live longer than 3 years. Causes of mortality include predators, hunting and collisions with cars and buildings.

Range lifespan

Status: wild:
19.9 (high) years.

Average lifespan

Status: wild:
3 years.

Average lifespan

Status: wild:
239 months.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Lifespan/Longevity

The oldest known sharp-shinned hawk lived to be 13 years old. However, most do not live longer than 3 years. Sharp-shinned hawks are killed by predators, hunters, and collisions with cars and buildings.

Range lifespan

Status: wild:
19.9 (high) years.

Average lifespan

Status: wild:
3 years.

Average lifespan

Status: wild:
239 months.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: BioKIDS Critter Catalog

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Lifespan, longevity, and ageing

Maximum longevity: 19.9 years (wild) Observations: Though breeding at just over one year of age is possible, most animals breed at later ages. Few of these animals live over 5 years in the wild (http://www.fs.fed.us/database/feis/).
Creative Commons Attribution 3.0 (CC BY 3.0)

© Joao Pedro de Magalhaes

Source: AnAge

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Reproduction

Due to the secretive nature of sharp-shinned hawks, little is known about their mating behavior. They are known to have courtship flights and are presumed to be monogamous.

Mating System: monogamous

The breeding season of sharp-shinned hawks corresponds with the time of maximum prey availability; usually between late March and June. Sharp-shinned hawks begin building their nests soon after they arrive at the breeding ground. Nests are built in trees, usually below the canopy (2.4 to 19 m above ground). The nests are made of twigs and are often lined with bark chips. Both the male and female gather nesting material, but the female does most of the building. Nest sites are re-used from year to year and old nests are refurbished or new nests are built on top of old ones. The birds are territorial during the breeding season and defend their nest site against intruders.

Sharp-shinned hawks normally have only one brood per year and lay 4 to 5 eggs per clutch on average (range 3 to 8). Females usually lay eggs on alternate days. Eggs are white or bluish with dark spots, approximately 37 by 30 mm and weigh about 9 g (approximately 11 percent of the female’s body mass). Incubation lasts 21 to 35 days, and the eggs hatch within one to two days of each other. Females do most of the incubating, but males will bring food to females while they are on the nest. After hatching, the altricial chicks are brooded by the female for 16 to 23 days. The nestlings fledge after 21 to 32 days. Males usually fledge sooner than females. Young continue to receive parental care for about 3.5 weeks after fledging. Most sharp-shinned hawks begin to breed when they are two years old.

Breeding interval: Sharp-shinned hawks usually have only one brood per year

Breeding season: Late March to June

Range eggs per season: 3 to 8.

Average eggs per season: 4.5.

Range time to hatching: 21 to 35 days.

Range fledging age: 21 to 32 days.

Average time to independence: 3.5 weeks.

Average age at sexual or reproductive maturity (female): 2 years.

Average age at sexual or reproductive maturity (male): 2 years.

Key Reproductive Features: iteroparous ; seasonal breeding ; gonochoric/gonochoristic/dioecious (sexes separate); sexual ; fertilization ; oviparous

Average eggs per season: 4.

Average age at sexual or reproductive maturity (male)

Sex: male:
365 days.

Average age at sexual or reproductive maturity (female)

Sex: female:
365 days.

Female sharp-shinned hawks do most of the incubating, but males bring food to females while they are on the nest. After hatching, the altricial chicks are brooded by the female for 16 to 23 days. While the chicks are in the nest, the male brings food to the female who plucks it and feeds the chicks. Females also defend the nest against predators. The nestlings fledge after 21 to 32 days. Young continue to receive parental care for about 3.5 weeks after fledging.

Parental Investment: no parental involvement; altricial ; pre-hatching/birth (Protecting: Female); pre-weaning/fledging (Provisioning: Male, Female, Protecting: Female); pre-independence (Provisioning: Male, Female)

  • Bildstein, K., K. Meyer. 2000. Sharp-shinned hawk (Accipiter striatus). A Poole, F Gill, eds. In The Birds of North America, No. 482. Philadelphia, PA: The Birds of North America, Inc.
  • Campbell, R., N. Dawe, I. McTaggart-Cowan, J. Cooper, G. Kaiser, M. McNall. 1990. The Birds of British Columbia, Volume II: Non-passerines, Diurnal Birds of Prey through Woodpeckers. Victoria: The Royal British Columbia Museum.
  • Snyder, N., H. Snyder. 1991. Birds of Prey: Natural History and Conservation of North American Raptors. Stillwater, MN: Voyageur Press.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Clutch size commonly is 4-5 (but average 2.6 in Puerto Rico). Incubation lasts 30-32 days (34-35 days also reported), mainly by female (male brings food). Young fledge at 3-4.5 weeks, independent at about 7 weeks. First breeds: usually 2 years (sometimes as yearling).

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Little is known about the mating behavior of sharp-shinned hawks. They are known to perform mating displays and are thought to have only one mate at a time.

Mating System: monogamous

Sharp-shinned hawks breed during the season when there is a lot of food available. This is usually between late March and June. Sharp-shinned hawks begin building their nests soon after they arrive at the breeding ground. Nests are built in trees, usually 2.4 to 19 m above ground. The nests are made of twigs and are often lined with bark chips. The male and female both gather nesting material but the female does most of the building. Nest sites are re-used from year to year and new nests are built on top of old ones. The birds are territorial during breeding season and defend their nest site against intruders.

Sharp-shinned hawks normally breed only once a year and lay 4 to 5 eggs. Females usually lay one egg every-other day. Eggs are white or bluish with dark spots. They are about 37 by 30 mm and weigh about 9 g. Incubation lasts 21 to 35 days. Females do most of the incubating, but males will bring food to females while they are on the nest.

All of the eggs hatch within one or two days of each other. After hatching, the female broods the chicks for 16 to 23 days. This means that she uses her body to cover the chicks the same way that she covered the eggs to keep them warm and protected. The nestlings fledge (leave the nest) after 21 to 32 days. Male nestlings usually fledge sooner than females. The parents continue to feed the chicks for about 3.5 weeks after they fledge. Most sharp-shinned hawks breed for the first time when they are two years old.

Breeding interval: Sharp-shinned hawks usually have only one brood per year

Breeding season: Late March to June

Range eggs per season: 3 to 8.

Average eggs per season: 4.5.

Range time to hatching: 21 to 35 days.

Range fledging age: 21 to 32 days.

Average time to independence: 3.5 weeks.

Average age at sexual or reproductive maturity (female): 2 years.

Average age at sexual or reproductive maturity (male): 2 years.

Key Reproductive Features: seasonal breeding ; gonochoric/gonochoristic/dioecious (sexes separate); fertilization

Average eggs per season: 4.

Average age at sexual or reproductive maturity (male)

Sex: male:
365 days.

Average age at sexual or reproductive maturity (female)

Sex: female:
365 days.

Female sharp-shinned hawks do most of the incubating, but males bring food to females while they are on the nest. After hatching, the chicks are brooded (the female sits over the chicks to keep them warm and protect them in the same way she sits over the eggs) for 16 to 23 days. While the chicks are in the nest the male brings food to the female who tears it apart and feeds it to the chicks. Females also defend the nest against predators. The nestlings fledge (leave the nest) after 21 to 32 days. They continue to be cared for by the parents for about 3.5 weeks after fledging.

Parental Investment: no parental involvement; altricial ; pre-hatching/birth (Protecting: Female); pre-weaning/fledging (Provisioning: Male, Female, Protecting: Female); pre-independence (Provisioning: Male, Female)

  • Bildstein, K., K. Meyer. 2000. Sharp-shinned hawk (Accipiter striatus). A Poole, F Gill, eds. In The Birds of North America, No. 482. Philadelphia, PA: The Birds of North America, Inc.
  • Campbell, R., N. Dawe, I. McTaggart-Cowan, J. Cooper, G. Kaiser, M. McNall. 1990. The Birds of British Columbia, Volume II: Non-passerines, Diurnal Birds of Prey through Woodpeckers. Victoria: The Royal British Columbia Museum.
  • Snyder, N., H. Snyder. 1991. Birds of Prey: Natural History and Conservation of North American Raptors. Stillwater, MN: Voyageur Press.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: BioKIDS Critter Catalog

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Barcode data: Accipiter striatus

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There are 14 barcode sequences available from BOLD and GenBank.

Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.

See the BOLD taxonomy browser for more complete information about this specimen and other sequences.

NNNTTATACTTAATCTTTGGCGCTTGAGCCGGCATAGTTGGCACTGCCCTTAGCCTACTCATTCGCGCAGAACTTGGCCAACCAGGCACACTCCTAGGCGATGACCAAATCTATAATGTTATCGTCACCGCACATGCCTTCGTAATAATTTTCTTCATAGTTATACCAATCATAATTGGAGGCTTCGGAAACTGACTCGTCCCGCTCATAATTGGCGCTCCTGATATAGCTTTCCCACGTATAAATAACATAAGCTTCTGACTACTCCCCCCATCATTCCTCCTCTTACTAGCCTCTTCAACAGTAGAAGCAGGAGCAGGAACCGGATGAACTGTCTACCCTCCATTAGCTGGTAATATAGCCCATGCCGGAGCCTCAGTAGACCTAGCTATCTTCTCACTACACCTAGCAGGAATTTCATCCATCCTAGGGGCAATTAACTTTATCACAACCGCTATTAACATAAAACCCCCTGCCCTCTCCCAATACCAAACACCCCTATTCGTATGATCCGTCCTCATCACTGCTGTCCTCCTACTACTCTCACTACCAGTCCTAGCTGCTGGCATTACTATACTACTAACAGATCGAAACCTCAATACAACATTCTTCGATCCTGCTGGTGGAGGCGACCCTATCCTATATCAACACCTCTTCTGATTCTTCGGACACCCAGAAGTCTACATTCTCATTCTA
-- end --

Download FASTA File

Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Statistics of barcoding coverage: Accipiter striatus

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 20
Specimens with Barcodes: 26
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Conservation

Conservation Status

Sharp-shinned hawk populations experienced declines between the 1940’s and the 1970’s. The pesticide DDT caused eggshell thinning in many raptors and reduced the success of breeding pairs (eggs were often crushed underneath incubating parents). Conservation concerns today include declines in prey species, environmental contaminants and the fragmentation and reduction of contiguous forest habitat.

Sharp-shinned hawks are protected under the US Migratory Bird Treaty Act and are listed as Appendix II by CITES.

US Migratory Bird Act: protected

US Federal List: no special status

CITES: appendix ii

State of Michigan List: no special status

IUCN Red List of Threatened Species: least concern

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

IUCN Red List Assessment


Red List Category
LC
Least Concern

Red List Criteria

Version
3.1

Year Assessed
2012

Assessor/s
BirdLife International

Reviewer/s
Butchart, S. & Symes, A.

Contributor/s

Justification
This species has an extremely large range, and hence does not approach the thresholds for Vulnerable under the range size criterion (Extent of Occurrence <20,000 km2 combined with a declining or fluctuating range size, habitat extent/quality, or population size and a small number of locations or severe fragmentation). The population trend appears to be increasing, and hence the species does not approach the thresholds for Vulnerable under the population trend criterion (>30% decline over ten years or three generations). The population size is extremely large, and hence does not approach the thresholds for Vulnerable under the population size criterion (<10,000 mature individuals with a continuing decline estimated to be >10% in ten years or three generations, or with a specified population structure). For these reasons the species is evaluated as Least Concern.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

National NatureServe Conservation Status

Canada

Rounded National Status Rank: N5B,N5N : N5B: Secure - Breeding, N5N: Secure - Nonbreeding

United States

Rounded National Status Rank: N5B,N5N : N5B: Secure - Breeding, N5N: Secure - Nonbreeding

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

NatureServe Conservation Status

Rounded Global Status Rank: G5 - Secure

Reasons: Large breeding range extending from North America to South America; plenty of good habitat; no compelling evidence of decline or imminent threats.

Other Considerations: Populations have relatively high turnover rate, which may facilitate rapid recovery from a population crash.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Sharp-shinned hawk populations declined between the 1940’s and the 1970’s. The pesticide DDT that was commonly used at that time was harmful to the birds. The pesticide caused egg shells to be too thin and the eggs broke when the parents incubated them. Today there are other threats to sharp-shinned hawks. The birds that they rely on for food are becoming less common, there are harmful chemicals in the environment and the forest habitat of sharp-shinned hawks is being destroyed.

IUCN Red List of Threatened Species: least concern

US Migratory Bird Act: protected

US Federal List: no special status

CITES: appendix ii

State of Michigan List: no special status

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: BioKIDS Critter Catalog

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Information on state-level protected status of animals is available at NatureServe.

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

U.S. Federal Legal Status

The Puerto Rican sharp-shinned hawk (Accipiter striatus venator) is
Endangered [61].
  • 61. U.S. Fish and Wildlife Service. 2013. Listed animals. In: Environmental Conservation Online System, [Online]

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Population

Population
(Rich et al. 2004)

Population Trend
Increasing
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Global Short Term Trend: Relatively stable (=10% change)

Comments: In Canada, stable or increasing (Flood and Bortolotti, 1986 COSEWIC report), with declines noted in some areas (Kirk et al. 1995). Current trends are difficult to discern from migration data. Peterjohn (1992) noted that some migration counts are down and some are not, so that overall, no clear trends emerge for the species. There was no consistent trend in migration counts in eastern North America, 1972-1987 (Titus and Fuller 1990). Data from breeding populations must also be evaluated, because migration counts do not always correlate with known changes in breeding populations (Rosenfield et al. 1991). For example, Robbins (1986) reported only a modest upswing in the U.S. breeding population size in the 1970s. Breeding Bird Survey (BBS) data are of limited use because this species is only rarely detected.
In a survey by the National Wildlife Federation of midwest state agencies, only Indiana reported an increasing trend, while Michigan and Kansas reported stable populations and other states reported that trends were unknown (Rosenfield et al. 1991). Responses to a 1992 questionnaire sent to Heritage program biologists indicated possible increases in breeding populations in Illinois, Michigan, New Hampshire, Quebec, and South Carolina, possible declines in Arkansas, California, and Maryland, and apparent stability in Indiana, Montana, Missouri, Nevada, Ontario, and Saskatchewan. Trends were unknown in 17 other states/provinces (Soule, unpublished data). In summary, what little information is available suggests that populations recovered substantially from declines by the 1970s and currently, the overall North American population is probably stable.

Global Long Term Trend: Increase of 10-25% to decline of 30%

Comments: Populations in North America apparently declined in the DDT era around the mid-1900s, but increased in the late 1960s and early 1970s (Spofford 1969, Brown 1973, Snyder et al. 1973, Bednarz et al. 1990, Rosenfield et al. 1991). Bednarz et al. (1990), using 1935-1987 migration data from Hawk Mountain Sanctuary, Pennsylvania, and adjusting for number of viewer-hours, dated the period of decline to about 1950 to 1964. Apparently recovered fairly rapidly and appeared to reach or surpass 1930s levels by the late 1970s (Bednarz et al. 1990). The recovery began prior to the U.S. ban of DDT, but coincided with marked reduction in use of DDT in Canada, where the majority of the species breeds.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Threats

Major Threats
Habitat alteration, especially removal of forest, is thought to affect some populations.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Degree of Threat: Medium

Comments: Preference for young dense forest stands in boreal forest provides the species with a large area of suitable habitat, perhaps the northern 2/3 of its breeding range, that, until recently, had not been greatly affected by development or deforestation. However, logging in the boreal forest is increasing dramatically. Habitat is more threatened on the southern periphery of the breeding range, where habitat is marginal or scarce, and human populations are larger. Organochlorines remain a threat for some birds. Even though now banned in the United States, these pesticides are still widely employed in Latin America where sharp-shins and many of their prey species spend the winter (Evans 1982). As recently as the early 1980s Meyer (1987) observed one nest failure in Canada clearly related to organochlorine residues: only one egg was laid in this nest and after it failed to hatch its shell thickness was found to be 23% below normal. Subsequent assays for organochlorine residues in the egg tissues were positive. Meyer speculated that the parents became contaminated either when they wintered south of the United States or when they fed on prey species that had wintered there. This may be the explanation for why breeding sharp-shins showed only a modest upswing during the 1970s (Robbins 1986), however, no one has studied the extent of the current threat of pesticides for sharp-shins. In addition, one death of a sharp-shinned was attributed to organophosphate pesticide poisoning (Johnsgard 1990). Shooting also continues to be a threat south of the U.S. and illegally, in the U.S., but the magnitude of the problem has not been evaluated.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Management

Biological Research Needs: For future protection efforts it will be necessary to know minimum area of habitat needed for protection, more details on critical habitat variables (e.g., do nest sites need to be near streams?), impacts of pesticides from the Neotropics, and effective survey methods.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Global Protection: Many to very many (13 to >40) occurrences appropriately protected and managed

Comments: Habitat choice of this species results in many EOs in wilderness areas and parks (especially in Idaho and Montana, and probably Alberta). Many others nest in publicly owned forests, although this may not provide adequate protection where forest management practices are in conflict with the species' needs.

Needs: Near the southern edge of the breeding range, protection of nesting habitat is important to assure that the population is maintained.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Management Considerations

More info for the terms: density, presence, selection

Sharp-shinned hawk populations are fairly stable in the United States,
although the species is endangered in some states [10,23]. The
sharp-shinned hawk is uncommonly seen except in the extreme southeastern
United States and in Canada [39]. It is uncommon in New England during
the breeding season, and uncommon to rare in winter [9].

The decline of sharp-shinned hawk populations in the eastern United
States in the 1960's and 1970's was attributed to the thinning effect of
DDT on eggshells [50]. Most populations appear to be in recovery from
declines in the early 1970's and 1980's [10], although in some regions
they continue to decline. Sauer and others [47] summarized breeding
bird surveys and banding studies from 1966 to 1987; in the central
region sharp-shinned hawks declined by 2.3 percent per year in breeding
bird surveys (38 survey routes). Rosenfield and others [45] noted that
sharp-shinned hawks are difficult to census, particularly during
breeding season when they spend most of the time below the canopy in
dense forests.

Land use impacts on raptor habitat include reduction and fragmentation
of habitat and reduction in prey availability [38].

The sharp-shinned hawk is rated as a generalist with respect to
microhabitat (is not associated with a specific microhabitat), a
generalist in response to edge (uses both interiors and edges), and has
a positive response to suitable habitat patch size. It is rated as 18
on a scale of 20 to sensitivity to landscape change, indicating that it
is very sensitive to landscape change [20]. Reynolds [42] also stated
that sharp-shinned hawks are vulnerable to changes in forest stands
resulting from timber harvesting. The sharp-shinned hawk showed extreme
sensitivity to forest fragmentation west of the Cascade Range in
Washington, Oregon, and California; it was not found in areas that were
broken up into small patches of forest [21].

A table showing the effects of different logging practices on raptors in
the northeastern United States indicated that any logging has negative
effects on sharp-shinned hawk nesting. Selection cuts and clearcuts,
however, are beneficial for home range (i.e., foraging) and local
population size, probably due to increased availability of prey [37].
Munro and Cowan [36] noted that the sharp-shinned hawk was present in
regenerating cutover and burned areas in British Columbia. It seems
likely that the hawks were foraging in these areas due to an influx of
granivorous birds, but nesting elsewhere.

General recommendations for forest timber management to preserve sharp-
shinned hawk habitat include small clearcuts only (that is, no large
clearcuts), a mosaic of different-aged stands, and most importantly,
the maintenance of large uncut tracts of mature timber [2,5]. During
the breeding season, large areas around active nest sites need to be
left undisturbed [5]. Reynolds [42] recommended uncut areas of a
minimum of 9.9 acres (4 ha) around active nests in Oregon. In addition,
management of raptor habitat needs to take into account nest site
turnover; sharp-shinned hawks usually build new nests every year.
Neither active nor prospective nest sites should be precommercially or
commercially thinned. To maintain nesting densities of sharp-shinned
hawks at the level found in Oregon, currently suitable nest sites should
be provided at a density of approximately 20 sites per township (36
square miles [90 sq km]). Further study is needed to determine the size
and shape of home ranges and the extent to which these habitats are used
for foraging. In addition, studies are needed to determine appropriate
densities for nest sites in other localities [42].

The sharp-shinned hawk is listed as a species that depends on forests
and undisturbed riparian habitats, and is likely to decline or be
eliminated from areas that are converted to agricultural use.
Sharp-shinned hawks occasionally use agricultural areas in winter; the
response to conversion of winter habitat to agricultural use is likely
to depend on the extent of human activity and availability of prey [57].
Mansell [35] noted the presence of a sharp-shinned hawk in and near a
25-year-old abandoned field (presumably in the eastern United States),
but sharp-shinned hawks had not been present while the field was in
cultivation, despite the presence of domestic fowl.

Grimm and Yahner [18] suggested that in the Northeast, sharp-shinned
hawks may respond best to selection cuts favoring conifers growing under
an overstory of hardwoods. Nearby patches of early successional
vegetation produced by clearcuts may also represent habitat improvement,
if silvicultural treatments are not extensive in size [37].

In Rhode Island, migrant sharp-shinned hawks were observed using placed
perches consisting of dead trees, but were never observed using
artificial perches constructed of milled timber [41].
  • 10. DeGraaf, Richard M.; Scott, Virgil E.; Hamre, R. H.; [and others]
  • 18. Grimm, Jeffrey W.; Yahner, Richard H. 1985. Status and management of selected species of avifauna in Pennsylvania with emphasis on raptors: 1985 Final Report. Final Report to the Pennsylvania Game Commission. Contract No. 802136. University Park, PA: The Pennsylvania State University, School of Forest Resources. 79 p. (+ Appendices). [26236]
  • 2. Benson, Patrick C. 1979. Land use and wildlife with emphasis on raptors. [Ogden, UT]
  • 20. Hansen, Andrew J.; Garman, Steven L.; Marks, Barbara; Urban, Dean L. 1993. An approach for managing vertebrate diversity across multiple-use landscapes?. Ecological Applications. 3(3): 481-496. [22872]
  • 21. Hejl, Sallie J. 1992. The importance of landscape patterns to bird diversity: a perspective from the Northern Rocky Mountains. Northwest Environmental Journal. 8: 119-137. [22066]
  • 23. Jones, Stephen. 1979. The accipiters: Goshawk, Cooper's hawk, sharp-shinned hawk. Unpublished report. BLM Contract No. YA-530-PH9-159. 51 p. On file with: U.S. Department of Agriculture, Forest Service, Intermountain Research Station, Fire Science Laboratory, Missoula, MT. [24586]
  • 35. Mansell, William. 1980. North American birds of prey. New York: William Morrow and Co., Inc. 176 p. [24538]
  • 36. Munro, J. A.; Cowan, I. McT. 1947. A review of the bird fauna of British Columbia. Special Publication No. 2. [Place of publication unknown]
  • 37. Nelson, Brad B.; Titus, Kimberly. 1988. Silviculture practices and raptor habitat associations in the Northeast. In: Pendleton, Beth Giron; LeFranc, Maurice N., Jr.; Moss, Mary Beth, eds. Proceedings of the northeast raptor management symposium and workshop; 1988 May 16-18; Syracuse, NY. NWF Science and Technology Series No. 13. Washington, DC: National Wildlife Federation: 171-179. [22697]
  • 38. Newton, I. 1979. Population ecology of raptors. Vermillion, SD: Buteo Books. 399 p. [24536]
  • 39. Palmer, Ralph S., ed. 1988. Handbook of North American birds. New Haven, CT: Yale University Press. 5 volumes. [23780]
  • 41. Reinert, Steven E. 1984. Use of introduced perches by raptors: experimental results and management implications. Raptor Research. 18(1): 25-29. [22256]
  • 42. Reynolds, Richard T. 1983. Management of western coniferous forest habitat for nesting accipiter hawks. Gen. Tech. Rep. RM-102. Fort Collins, CO: U.S. Department of Agriculture, Forest Service, Rocky Mountain Forest and Range Experiment Station. 7 p. [21388]
  • 45. Rosenfield, Robert N.; Bielefeldt, John; Anderson, Raymond K.; Papp, Joseph M. 1991. Accipiters. In: Pendleton, Beth Giron; Krahe, Diane L., eds. Proceedings of the Midwest raptor management symposium and workshop; [Date of conference unknown]
  • 47. Galbreath, Donald S.; Moreland, Raleigh. 1953. The chukar partridge in Washington. Biological Bulletin No. 11. Olympia, WA: Washington State Game Department. 55 p. [23778]
  • 5. Call, Mayo. 1979. Habitat management guides for birds of prey. Techical Note 338. Denver, CO: U.S. Department of the Interior, Bureau of Land Management, Denver Service Center. 70 p. [22451]
  • 50. Terres, John K. 1980. The Audubon Society encyclopedia of North American birds. New York: Alfred A. Knopf. 1109 p. [16195]
  • 57. Young, Leonard S. 1989. Effects of agriculture on raptors in the western United States: an overview. In: Proceedings of the western raptor symposium and workshop; 1987 October 26-28; Boise, ID. NWF Scientific and Technical Series No. 12. Washington, DC: National Wildlife Federation: 209-218. [22649]
  • 9. DeGraaf, Richard M.; Yamasaki, Mariko. 1986. New England wildlife: habitat, natural history, and distribution. Gen. Tech. Rep. NE-108. Broomall, PA: U.S. Department of Agriculture, Forest Service, Northeastern Forest Experiment Station. 491 p. [21385]

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Relevance to Humans and Ecosystems

Benefits

Sharp-shinned hawks prey on songbirds, game birds and domestic fowl.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Sharp-shinned hawks may play a role in reducing pest species such as European starlings (Sturnus vulgaris) and house sparrows (Passer domesticus).

Positive Impacts: controls pest population

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Economic Importance for Humans: Negative

Sharp-shinned hawks prey on songbirds, game birds and domestic fowl.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: BioKIDS Critter Catalog

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Economic Importance for Humans: Positive

Sharp-shinned hawks may play a role in reducing pest species such as European starlings (Sturnus vulgaris) and house sparrows (Passer domesticus).

Positive Impacts: controls pest population

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: BioKIDS Critter Catalog

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Wikipedia

Sharp-shinned hawk

The sharp-shinned hawk (Accipiter striatus) is a small hawk described from Hispaniola, with males being the smallest hawks in the United States and Canada, but with the species averaging larger than some Neotropical species, such as tiny hawk. The taxonomy is far from resolved, with some authorities considering the southern taxa to represent three separate species: white-breasted hawk (A. chionogaster), plain-breasted hawk (A. ventralis), and rufous-thighed hawk (A. erythronemius).

Distribution[edit]

This species is widespread in North America, Central America, South America and the Greater Antilles. Below, the distributions of the four groups (see taxonomy) are described as they occur roughly from north to south:

  • The nominate (A. s. striatus) group is widespread in North America, occurring in all of the forested part of USA and Canada, breeding in most of it. Populations in the northern part of the range migrate south and spend the non-breeding season (winter) in the southern USA, Mexico and Central America as far south as Panama, with a smaller number spending the winter in the Greater Antilles. Resident populations exist in temperate parts of the USA, Canada (in a few coastal regions), Mexico (highlands from Sonora to Oaxaca), Cuba, Hispaniola and Puerto Rico.
  • A. (s.) chionogaster (white-breasted hawk) occurs in highlands from far southern Mexico (Chiapas and Oaxaca), through Honduras, Guatemala and El Salvador, to Nicaragua. It is, as far as known, resident, but some local movements may occur.
  • A. (s.) ventralis (plain-breasted hawk) occurs in the coastal mountains of northern Venezuela and Colombia, south through the Andes from western Venezuela, through Colombia, Ecuador and Peru, to central Bolivia. A disjunct population occurs in the Tepuis of southern Venezuela (likely to extend into adjacent parts of Roraima in far northern Brazil, but this remains unconfirmed). It is, as far as known, resident, but some local movements may occur.
  • A. (s.) erythronemius (rufous-thighed hawk) is widespread in eastern South America in eastern and southern Brazil, Uruguay, Paraguay, north-eastern Argentina and south-eastern Bolivia. It is, as far as known, resident in some regions and migratory in others. The movements are generally poorly understood, but it only occurs seasonally at some localities in Argentina.

Taxonomy[edit]

With a chick (nominate group)

Sharp-shinned hawk is often separated into four species, with the northern group (see distribution) retaining both the scientific name and the common name: Sharp-shinned hawk (A. striatus). In addition to the nominate taxon (A. s. striatus), it includes subspecies perobscurus, velox, suttoni, madrensis, fringilloides, and venator. The three remaining taxa, each considered a monotypic species if split, are the white-breasted hawk (A. chionogaster; Kaup, 1852), plain-breasted hawk (A. ventralis; Sclater, 1866) and rufous-thighed hawk (A. erythronemius; Kaup, 1850). The breeding ranges of the groups are entirely allopatric, although the wintering range of the nominate group partially overlaps with the range of chionogaster (as is also the case with certain taxa within the nominate group). This allopatry combined with differences in plumage (see appearance) and, apparently, certain measurements, has been the background for the split, but hard scientific data are presently lacking (AOU). Disregarding field guides, most material published in recent years (e.g. AOU, Ferguson-Lees et al. p. 586, and Dickinson et al.) has therefore considered all to be members of a single widespread species – but not without equivocation: Ferguson-Lees et al. say that if they were to make a world list, they would include the three taxa as separate species (p. 75), and the AOU's comment includes the note "split almost certainly good".

Storer (1952) suggested that the southernmost populations within the nominate group were paler below, thus approaching chionogaster. This has also been reflected in recent guides, where A. s. madrensis of southern Mexico is described as being relatively pale below (compared to more northern subspecies), but if this is a sign of intergradation with chionogaster or a north-south cline which includes both the members of the nominate group and chionogaster remains unclear. In Bolivia, ventralis and erythronemius approach each other, but no evidence of intergradation is known – something that, without actual specimens, also would be hard to prove due to the variability in the plumage of ventralis.

Habitat[edit]

A. (s.) ventralis in Ecuador

It occurs in a wide range of woodland and forest types, both dominated by conifers and by various types of broad-leaved trees (especially oaks) The largest populations of the nominate group (see taxonomy) are thought to occur in the temperate boreal forests, but winter in warmer regions farther south (see distribution). The taxa suttoni, madrensis (both from the nominate group), chionogaster (white-breasted hawk) and ventralis (plain-breasted hawk), are found in upper tropical to temperate highlands; mainly at altitudes of 300–3,000 m (980–9,840 ft), but occasionally down to near sea-level and up to 4,000 m (13,000 ft). The taxon erythronemius (rufous-thighed hawk) is found in tropical and subtropical regions; both in lowlands and highlands.

Appearance[edit]

This is a small Accipiter hawk, with males 23 to 30 cm (9.1 to 11.8 in) long, with a wingspan of 42 to 58 cm (17 to 23 in) and weight from 82–115 g (2.9–4.1 oz). As common in Accipiter hawks, females are distinctly larger in size, averaging some 30% longer, and with a weight advantage of more than 50% being common. The female measures 29 to 37 cm (11 to 15 in) in length, has a wingspan of 58 to 68 cm (23 to 27 in) and weighs 150 to 219 g (5.3 to 7.7 oz). The wings measure 14.1–22.9 cm (5.6–9.0 in) each, the tail is 12–19 cm (4.7–7.5 in) long and the tarsus is 4.5–5.9 cm (1.8–2.3 in). Measurements given here are for the northern group, but they are comparable for the remaining subspecies.[2] Adults have short broad wings and a medium-length tail banded in blackish and gray with the tip varying among individuals from slightly notched through square to slightly rounded (often narrowly tipped white). The remiges (typically only visible in flight) are whitish barred blackish. The legs are long and very slender (hence the common name) and yellow. The hooked bill is black and the cere is yellowish. The remaining plumage varies depending on group:

  • Nominate group: Cap dark and upperparts blue-grey (the former darker). Often, a few more-or-less random white spots can be seen on the scapulars (feathers attached to the wing that cover the meeting of wing and body). Underparts white with rufous or tawny bars. Crissum white. Thighs rufous, but often barred white. The cheeks are tinged rufous (sometimes faint, but generally very distinct in taxa from the Greater Antilles). The irides are dark orange to red, but these are yellowish to pale orange in juveniles. Juveniles have dark brownish upperparts, each feather edged rufous, giving a rather scaly appearance. The brown head is streaked whitish, and the whitish underparts are extensively streaked brown or reddish and usually with reddish barring on the sides.
A juvenile sharp-shinned hawk in Parrish, Florida.
  • A. (s.) chionogaster (white-breasted hawk): Resembles the members of the nominate group, but upperparts darker (often appears almost black), thighs whitish-buff and underparts and cheeks entirely white. Juveniles have darker upperparts and distinctly finer streaking below than juveniles of the nominate group.
  • A. (s.) ventralis (plain-breasted hawk): Polymorphic. The most common morph has dark grey upperparts (often appears almost black) and white underparts variably barred, shaded, or mottled with rufous or tawny-buff (extensively marked individuals may appear almost entirely rufous or tawny-buff below). Occasionally, the barring to the lower belly and flanks may appear duskier. The white morph has bluish-grey upperparts (similar to the nominate group), but its underparts are all white except for its rufous thighs. The rare dark morph, the only morph which sometimes lacks rufous thighs, is entirely sooty (occasionally with slight white barring to belly and faint grey bands in tail). The underparts of the females average paler than males of the same morph. The iris is typically yellow (contra illustrations in some books), but individuals (mainly sub-adults?) with a darker iris are occasionally seen. Juveniles have dark brownish or dusky upperparts with each feather typically edged rufous, giving a rather scaly appearance. The underparts are white streaked brown, and the thighs are rufous barred white. Occasionally, juveniles with underparts extensively rufous streaked blackish are seen.
  • A. (s.) erythronemius (rufous-thighed hawk): Resembles the nominate group, but upperparts darker, streaking to underparts rufous or dusky, cheeks typically with a clear rufous patch (occasionally lacking almost entirely) and iris yellow (contra illustrations in some books). Juveniles resemble juveniles of the nominate group, but streaking to underparts typically restricted to throat and central underparts, with flanks scaled or barred (often also belly).

Identification[edit]

Comparison of Cooper's hawk (left), sharp-shinned hawk (right)
  • The northern group is easily mistaken for the slightly larger and lankier Cooper's hawk, which match the sharp-shinned in plumage. In flight, the Cooper's, with its longer wings and larger head, is sometimes compared to a "flying cross"; whereas the broader-winged and smaller-headed sharp-shinned is described as a "flying mallet".
  • A. (s.) ventralis (plain-breasted hawk), while itself very variable in plumage, is generally easily recognized by the Accipiter shape and the colour of the underparts. The grey underparts of the bicolored hawk are not duplicated by any plumage of ventralis and juv. bicoloured (which may be whitish below) has a nuchal collar. The smaller tiny hawk mainly occurs in lowlands, is very small and lacks the rufous thighs of ventralis. The rare dark morph ventralis is arguably the plumage most likely to cause confusion with other species (e.g. white-rumped hawk, dark morph collared forest falcon and various Buteo hawks), but the yellow eyes and the overall shape means that it too is relatively distinctive.
  • A. (s.) erythronemius (rufous-thighed hawk) is distinctive within its range, but commonly confused with the roadside hawk (with a very different shape). The bicolored hawk is the only other Accipiter within the range of erythronemius which may show yellow eyes and rufous thighs, but it has a different pattern below.

Food and hunting[edit]

These birds surprise and capture most their prey from cover or while flying quickly through dense vegetation. They are adept at navigating dense thickets and many attacks are successful, although this hunting method is often hazardous to the hawk. The great majority of this hawk's prey are small birds, especially various songbirds such as sparrows, wood-warblers, finches, wrens, nuthatches, tits, icterids and thrushes. Birds caught range in size from a 4.4 g (0.16 oz) Anna's hummingbird to a 577 g (1.272 lb) ruffed grouse and virtually any bird within this size range is potential prey. Typically, males will target smaller birds, such as sparrows and wood-warblers, and females will pursue larger prey, such as American robins and flickers, leading to a lack of conflict between the sexes for prey. These hawks often exploit backyard bird feeders in order to target congregations of ideal prey. They often pluck the feathers off their prey on a post or other perch. Rarely, sharp-shinned hawks will also eat rodents, lizards, frogs, snakes, and large insects, the latter typically being dragonflies captured on the wing during the hawk's migration.

Reproduction[edit]

Immature (nominate group)

Sharp-shinned hawks construct a stick nest in a large conifer or dense group of deciduous trees. Clutches of 3 to 8 eggs have been recorded, but 4 to 5 eggs is the typical clutch size. The eggs measure 37.6 mm × 30 mm (1.48 in × 1.18 in) and weigh about 19 g (0.67 oz). The eggs are prized by egg-collectors, because they are heavily marked with surprisingly colorful and varied markings. The incubation period is thought to average at about 30 days. After hatching, the young are brooded for 16 to 23 days by the female, while the male defends the territory and catches prey. The young fledge at about a month old and rely on their parents for feeding and protection another four weeks. The nesting sites and breeding behavior of sharp-shinned hawks are generally secretive, in order to avoid the predation of larger raptors, such as the northern goshawk and the Cooper's hawk. While in migration, adults are sometimes preyed on by most of the bird-hunting, larger raptors, especially the peregrine falcon. The breeding behavior of the taxa chionogaster (white-breasted hawk), ventralis (plain-breasted hawk) and erythronemius (rufous-thighed hawk) are comparably poorly known, but based on the available knowledge they appear to differ little from that of the nominate group

Conservation[edit]

Endangered subspecies venator, endemic to Puerto Rico

In North America this species declined in numbers in the 1960s and 1970s, probably as a result of the use of DDT and other pesticides. The population of USA and Canada has rebounded since and might even exceed historical numbers today, probably due to the combination of the ban on DDT and the proliferation of backyard bird feeders in North America which create unnaturally reliable and easy prey Accipiters. Migratory sharp-shinned hawks are one of the most numerous raptors recorded at "hawk watches" across the country. An exception is the subspecies from Puerto Rico, Accipiter striatus venator, which is rare and listed as endangered by the U.S. Fish & Wildlife Service. The remaining resident subspecies from the Greater Antilles, fringilliodes from Cuba and nominate (A. s. striatus) from Hispaniola, are uncommon, local, and, at least in the case of the latter, decreasing. Both ventralis (plain-breasted hawk) and erythronemius (rufous-thighed hawk) are fairly common (but easily overlooked due to their secretive behavior) and presently considered safe. The situation for chionogaster (white-breasted hawk) is potentially more problematic due to its limited range, although it, at least locally, remains fairly common.

References[edit]

  1. ^ BirdLife International (2012). "Accipiter striatus". IUCN Red List of Threatened Species. Version 2013.2. International Union for Conservation of Nature. Retrieved 26 November 2013. 
  2. ^ Raptors of the World by Ferguson-Lees, Christie, Franklin, Mead, and Burton. Houghton Mifflin (2001), ISBN 0-618-12762-3
  • Dickinson, E. (2003). The Howard and Moore Complete Checklist of the Birds of the World. Christopher Helm. ISBN 0-7136-6536-X
  • Ferguson-Lees, J., D. Christie, P. Burton, K. Franklin & D. Mead (2001). Raptors of the World. Christopher Helm. ISBN 0-7136-8026-1
  • Hilty, S. (2002). Birds of Venezuela. Christopher Helm. ISBN 0-7136-6418-5
  • Howell, S., & S. Webb (1995). A Guide to the Birds of Mexico and Northern Central America. Oxford University Press. ISBN 0-19-854012-4
  • Sibley, D. (2000). North American Bird Guide. Pica Press. ISBN 1-873403-98-4
  • Raffaele, H., J. Wiley, O. Garrido, A. Keith & J. Raffaeile (1998). Birds of the West Indies. Christopher Helm. ISBN 0-7136-4905-4
  • Remsen, J. V., Jr., C. D. Cadena, A. Jaramillo, M. Nores, J. F. Pacheco, M. B. Robbins, T. S. Schulenberg, F. G. Stiles, D. F. Stotz, and K. J. Zimmer. Version 9 October 2007. A classification of the bird species of South America. American Ornithologists' Union.
  • Restall, R., Clemencia Rodner & Miguel Lentino (2006). Birds of Northern South America vol. 1 & 2. Christopher Helm. ISBN 0-7136-7242-0 (vol. 1) and ISBN 0-7136-7243-9 (vol. 2).
  • Sick, H. (1993). Birds in Brazil: A Natural History. Princeton University Press. ISBN 0-691-08569-2
  • Storer, R. W. (1952). Variation in the resident Sharp-shinned Hawks of Mexico. Condor 54: 283-9.
Creative Commons Attribution Share Alike 3.0 (CC BY-SA 3.0)

Source: Wikipedia

Unreviewed

Article rating from 0 people

Default rating: 2.5 of 5

Names and Taxonomy

Taxonomy

Comments: The resident Latin American forms have been treated as three distinct species (Accipiter chionogaster [northern Middle America], Accipiter ventralis [Andes], and Accipiter erythronemius [Brazil through southeastern South America]), but there are no published data supporting this split.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Common Names

sharp-shinned hawk
blue darter
sparrow hawk

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

The accepted scientific name of sharp-shinned hawk is Accipiter striatus
Vieillot [1,48].

There are 10 generally accepted subspecies. The American
Ornithologists' Union notes that some of the subspecies are sometimes
given species status. Geographic variation of the subspecies is clinal
and complex. Sharp-shinned hawks in Mexico are larger than those in the
rest of North America. Subspecies in the West Indies are generally
smaller than North American birds [23].

The subspecies that occur in Canada and the United States are [22,39]:

Accipiter striatus velox (Wilson) (Canada, U. S.)
Accipiter striatus. perobscurus Snyder (Queen Charlotte Is., B. C.)

The subspecies occurring from Mexico to South America are [22,39]:

Accipiter striatus suttoni van Rossem (northern Mexico)
Accipiter striatus madrensis Storer (southwestern Mexico)
Accipiter striatus chionogaster Kaup (southern Mexico, Guatemala to Nicaragua)
Accipiter striatus ventralis Sclater (western Venezuela, Columbia to western Bolivia)
Accipiter striatus erythronemius Kaup (eastern Bolivia and southern Brazil to Uruguay)

Subspecies occurring on islands in the West Indies are [22,39]:

Accipiter striatus fringilloides Vigors (Cuba)
Accipiter striatus striatus Vieillot (Hispaniola)
Accipiter striatus venator Wetmore (Puerto Rico)
  • 1. American Ornithologists' Union. 1983. Checklist of North American birds. 6th ed. Lawrence, KS: Allen Press, Inc. 877 p. [21234]
  • 22. Howard, R.; Moore, Alick. 1980. A complete checklist of the birds of the world. Oxford: Oxford University Press. 701 p. [24537]
  • 23. Jones, Stephen. 1979. The accipiters: Goshawk, Cooper's hawk, sharp-shinned hawk. Unpublished report. BLM Contract No. YA-530-PH9-159. 51 p. On file with: U.S. Department of Agriculture, Forest Service, Intermountain Research Station, Fire Science Laboratory, Missoula, MT. [24586]
  • 39. Palmer, Ralph S., ed. 1988. Handbook of North American birds. New Haven, CT: Yale University Press. 5 volumes. [23780]
  • 48. Stewart, Robert E.; Robbins, Chandler S. 1958. Birds of Maryland and the District of Columbia. North American Fauna: No. 62. Washington, DC: U.S. Department of the Interior, Fish and Wildlife Service. 401 p. [24044]

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!