Articles on this page are available in 1 other language: Spanish (11) (learn more)

Overview

Distribution

Range Description

Agamia agami is a Neotropical species, and is generally scarce throughout its distribution. Its range extends from east Mexico in the north through Guatemala, Belize, El Salvador, Honduras, Nicaragua and Costa Rica. It was considered widespread and common in Panama in the 1960s, but is rare to the south in bordering Colombia. In the west, the species reaches north-west Ecuador (del Hoyo et al. 1992). To the east, the species occurs in French Guiana, where it is considered widespread; the largest known colony (c.2,000 pairs) was discovered here recently (Restall et al. 2006). A second, disjunct range spreads south-east from French Guiana, through Suriname and Guyana (del Hoyo et al. 1992). In Venezuela it is uncommon and very local, although recorded regularly in forest at Hato Pieiro, Hato Cedral, and the Camani area (Hilty 2003). In north and central Brazil, it is thought to be unusually common along the Rio Juru, and likewise in south-east Peru. Its distribution spreads as far as east Bolivia (del Hoyo et al. 1992).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Range

Tropical s Mexico to n Bolivia and w Amazonian Brazil.
  • Clements, J. F., T. S. Schulenberg, M. J. Iliff, D. Roberson, T. A. Fredericks, B. L. Sullivan, and C. L. Wood. 2014. The eBird/Clements checklist of birds of the world: Version 6.9. Downloaded from http://www.birds.cornell.edu/clementschecklist/download/

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Ecology

Habitat

Habitat and Ecology

Habitat and Ecology
This species occurs in swampy stream and lake margins within tropical forest, and also in seasonal marshes. It tends to remain in lowlands under 300 m in elevation, but has been recorded at 2,600 m in Colombia's east Andes. Fish are its primary food source, with cichlids (Aequidens) and characins (Triportheus, Astyanax) recorded as prey. The breeding season appears to coincide with the arrival of rains; nest building occurs between June and September in both Costa Rica and Venezuela (del Hoyo et al. 1992). The species is semicolonial (Hilty 2003). Nests are built in a tree or bush 1-2 m above water (del Hoyo et al. 1992).

Systems
  • Terrestrial
  • Freshwater
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Barcode data: Agamia agami

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There are 3 barcode sequences available from BOLD and GenBank.

Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.

See the BOLD taxonomy browser for more complete information about this specimen and other sequences.

GTGACCTTCATTACCCGATGATTATTCTCAACCAACCACAAAGATATCGGCACCCTATACCTAATCTTCGGAGCATGAGCTGGCATAGTTGGGACTGCCCTAAGCCTACTCATCCGAGCTGAGCTTGGACAACCAGGAACACTTCTAGGAGACGACCAAATCTACAATGTAATCGTCACTGCCCATGCCTTCGTAATAATCTTCTTTATAGTAATGCCCATTATAATCGGAGGATTTGGAAATTGACTAGTCCCACTCATAATTGGTGCCCCAGACATAGCATTCCCACGTATAAACAACATAAGCTTCTGACTACTACCACCATCATTCATACTCCTCCTAGCCTCATCCACCGTTGAAGCAGGAGCAGGCACAGGATGAACTGTATATCCGCCACTAGCCGGCAACCTAGCCCATGCCGGAGCCTCAGTAGACCTAGCCATCTTCTCCCTCCACCTAGCAGGTGTATCCTCCATCCTAGGAGCAATCAACTTCATCACAACTGCCATCAACATAAAACCCCCAGCCCTATCACAATACCAAACCCCCCTATTCGTATGATCAGTCCTAATTACCGCTGTTCTACTACTCCTCTCACTCCCAGTCCTCGCCGCAGGCATTACAATATTACTAACCGACCGAAACCTGAACACTACATTTTTCGACCCTGCTGGAGGCGGAGACCCAGTTCTTTATCAACATCTCTTCTGATTCTTTGGCCACCCAGAAGTCTACATCCTAATCCT
-- end --

Download FASTA File

Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Statistics of barcoding coverage: Agamia agami

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 3
Specimens with Barcodes: 3
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Conservation

Conservation Status

IUCN Red List Assessment


Red List Category
VU
Vulnerable

Red List Criteria
A3c

Version
3.1

Year Assessed
2012

Assessor/s
BirdLife International

Reviewer/s
Taylor, J. & Butchart, S.

Contributor/s
Lees, A. & Panjabi, A.

Justification

Based on a model of future deforestation in the Amazon basin, and its susceptibility to hunting, it is suspected that the population of this species will decline rapidly over the next three generations, and it has therefore been uplisted to Vulnerable.


History
  • Least Concern (LC)
  • Least Concern (LC)
  • Least Concern (LC)
  • Lower Risk/least concern (LR/lc)
  • Lower Risk/near threatened (LR/nt)
  • Near Threatened (NT)
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5