Articles on this page are available in 1 other language: Spanish (11) (learn more)

Overview

Distribution

Range Description

Agamia agami is a Neotropical species, and is generally scarce throughout its distribution. Its range extends from east Mexico in the north through Guatemala, Belize, El Salvador, Honduras, Nicaragua and Costa Rica. It was considered widespread and common in Panama in the 1960s, but is rare to the south in bordering Colombia. In the west, the species reaches north-west Ecuador (del Hoyo et al. 1992). To the east, the species occurs in French Guiana, where it is considered widespread; the largest known colony (c.2,000 pairs) was discovered here recently (Restall et al. 2006). A second, disjunct range spreads south-east from French Guiana, through Suriname and Guyana (del Hoyo et al. 1992). In Venezuela it is uncommon and very local, although recorded regularly in forest at Hato Piñeiro, Hato Cedral, and the Camani area (Hilty 2003). In north and central Brazil, it is thought to be unusually common along the Rio Juruá, and likewise in south-east Peru. Its distribution spreads as far as east Bolivia (del Hoyo et al. 1992).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Range

Tropical s Mexico to n Bolivia and w Amazonian Brazil.
  • Clements, J. F., T. S. Schulenberg, M. J. Iliff, D. Roberson, T. A. Fredericks, B. L. Sullivan, and C. L. Wood. 2014. The eBird/Clements checklist of birds of the world: Version 6.9. Downloaded from http://www.birds.cornell.edu/clementschecklist/download/

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Ecology

Habitat

Habitat and Ecology

Habitat and Ecology
This species occurs in swampy stream and lake margins within tropical forest, and also in seasonal marshes. It tends to remain in lowlands under 300 m in elevation, but has been recorded at 2,600 m in Colombia's east Andes. Fish are its primary food source, with cichlids (Aequidens) and characins (Triportheus, Astyanax) recorded as prey. The breeding season appears to coincide with the arrival of rains; nest building occurs between June and September in both Costa Rica and Venezuela (del Hoyo et al. 1992). The species is semicolonial (Hilty 2003). Nests are built in a tree or bush 1-2 m above water (del Hoyo et al. 1992).

Systems
  • Terrestrial
  • Freshwater
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Barcode data: Agamia agami

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There are 3 barcode sequences available from BOLD and GenBank.

Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.

See the BOLD taxonomy browser for more complete information about this specimen and other sequences.

GTGACCTTCATTACCCGATGATTATTCTCAACCAACCACAAAGATATCGGCACCCTATACCTAATCTTCGGAGCATGAGCTGGCATAGTTGGGACTGCCCTAAGCCTACTCATCCGAGCTGAGCTTGGACAACCAGGAACACTTCTAGGAGACGACCAAATCTACAATGTAATCGTCACTGCCCATGCCTTCGTAATAATCTTCTTTATAGTAATGCCCATTATAATCGGAGGATTTGGAAATTGACTAGTCCCACTCATAATTGGTGCCCCAGACATAGCATTCCCACGTATAAACAACATAAGCTTCTGACTACTACCACCATCATTCATACTCCTCCTAGCCTCATCCACCGTTGAAGCAGGAGCAGGCACAGGATGAACTGTATATCCGCCACTAGCCGGCAACCTAGCCCATGCCGGAGCCTCAGTAGACCTAGCCATCTTCTCCCTCCACCTAGCAGGTGTATCCTCCATCCTAGGAGCAATCAACTTCATCACAACTGCCATCAACATAAAACCCCCAGCCCTATCACAATACCAAACCCCCCTATTCGTATGATCAGTCCTAATTACCGCTGTTCTACTACTCCTCTCACTCCCAGTCCTCGCCGCAGGCATTACAATATTACTAACCGACCGAAACCTGAACACTACATTTTTCGACCCTGCTGGAGGCGGAGACCCAGTTCTTTATCAACATCTCTTCTGATTCTTTGGCCACCCAGAAGTCTACATCCTAATCCT
-- end --

Download FASTA File

Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Statistics of barcoding coverage: Agamia agami

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 3
Specimens with Barcodes: 3
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Conservation

Conservation Status

IUCN Red List Assessment


Red List Category
VU
Vulnerable

Red List Criteria
A3c

Version
3.1

Year Assessed
2012

Assessor/s
BirdLife International

Reviewer/s
Taylor, J. & Butchart, S.

Contributor/s
Lees, A. & Panjabi, A.

Justification

Based on a model of future deforestation in the Amazon basin, and its susceptibility to hunting, it is suspected that the population of this species will decline rapidly over the next three generations, and it has therefore been uplisted to Vulnerable.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Population

Population
Partners in Flight estimate the total population to number 50,000-499,999 individuals (A. Panjabi in litt. 2008).

Population Trend
Unknown
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Threats

Major Threats

The primary threat to this species is accelerating deforestation in the Amazon basin as land is cleared for cattle ranching and soy production, facilitated by expansion of the road network (Soares-Filho et al. 2006, Bird et al. 2011). It is also susceptible to hunting (A. Lees in litt. 2011).

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Management

Conservation Actions

Conservation Actions

Conservation Actions Underway
None is known.

Conservation Actions Proposed

Expand the protected area network to effectively protect IBAs. Effectively resource and manage existing and new protected areas, utilising emerging opportunities to finance protected area management with the joint aims of reducing carbon emissions and maximizing biodiversity conservation. Conservation on private lands, through expanding market pressures for sound land management and preventing forest clearance on lands unsuitable for agriculture, is also essential (Soares-Filho et al. 2006).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Wikipedia

Agami heron

The agami heron (Agamia agami) is a medium-sized heron. It is a resident breeding bird from Central America south to Peru and Brazil.

It is sometimes known as the chestnut-bellied heron, and is the only member of the genus Agamia (Reichenbach, 1853).

Chicks

The agami heron's habitat is forest swamps and similar wooded wetlands. They nest in colonies on platforms of sticks in trees over water, which may gather more than 100 nests (Fleck 2003). The normal clutch is two blue eggs. This uncommon and localised species is 66–76 cm in length. It is short-legged for a heron, but has a very long thin bill. The neck and underparts are chestnut, with a white line down the centre of the foreneck, and the wings are green. There are wispy pale blue feathers decorating the head, sides of the foreneck, and lower back. The legs, bill, and bare facial patch are dull yellow.

The sexes are similar, but immature agami herons are largely brown above with a white foreneck, and streaked brown-and-white underparts.

Despite its stunning plumage, this reclusive species' preference for shade and overhanging vegetation means that it is rarely seen at its best.

This is a quiet bird, but pairs and family groups may make various snoring or rattling sounds.

Agami herons stalk their fish prey in shaded shallow water, often standing still or moving very slowly. They rarely wade in open water. They also take frogs, small reptiles, and snails.

References[edit]

  • Birds of Venezuela by Hilty, ISBN 0-7136-6418-5
  • Fleck, L. C. (2003). Aspectos reprodutivos e conservação de um ninhal de Agamia agami (AVES: ARDEIDAE) na RDS Amanã – AM. Anais do XI Congresso Brasileiro de Ornitologia, p. 3.
Creative Commons Attribution Share Alike 3.0 (CC BY-SA 3.0)

Source: Wikipedia

Unreviewed

Article rating from 0 people

Default rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!