Articles on this page are available in 1 other language: Spanish (10) (learn more)

Overview

Brief Summary

Biology

Active during the day, the turkey vulture is commonly encountered perched, with wings outstretched in the morning sun. The reason for this behaviour is not entirely clear, but it may be to dry out the feathers, prior to taking to the air (3). Once aloft, this species is a graceful flyer, often gliding close to the ground, with wings angled upwards forming a slight V-shape (3) (4). The turkey vulture feeds almost exclusively on carrion and, unlike most birds, has a highly developed sense of smell, which it uses to locate carcasses, even under a cover of vegetation. This ability means that the turkey vulture is often the first scavenger to arrive at a carcass, allowing it to feed before the arrival of larger birds of prey, which drive this species away (2) (5). In response to its diet of rotting meat, the turkey vulture has evolved a remarkably high tolerance for microbial toxins, and plays an important ecological role in disposing of carcasses that could otherwise breed disease (5). Unlike some larger vultures, the turkey vulture very rarely kills, and only tackles sick or injured animals, nestlings and insects (2) (5). The turkey vulture's breeding season varies according to location, with populations in temperate parts of North America laying eggs between May and June, while populations in Central America lay between February and April (2). Breeding in tropical parts of South America is less well known (2), although egg-laying has been recorded between August and January in Chile (5). Turkey vultures do not provide nesting material, and simply lay a clutch of two eggs directly on the ground in shallow caves or under dense undergrowth, or alternatively in a hollow tree stump or log. After 38 to 41 days of incubation, the eggs hatch, and the young are brooded for a further 70 to 80 days before fledging (2). Although turkey vulture populations in Central and South America generally remain in a single location throughout the year, North American subspecies make lengthy migrations. During the period between September and November, loose flocks of tens of thousands of birds form, which fly south to South America, sometimes as far as Paraguay, to spend the winter (2) (5).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 1 person

Average rating: 3.0 of 5

Cathartes aura

A large (26-32 inches) dark raptor, the Turkey Vulture is most easily identified by its dark brown body, featherless red head, and huge wingspan. This species may be separated from the related Black Vulture (Coragyps atratus) by that species’ smaller size, gray head, and shorter tail. Male and female Turkey Vultures are similar to one another in all seasons. The Turkey Vulture breeds across much of the United States (patchily distributed in the Great Plains) and southern Canada south to southern South America. Populations breeding on northern and interior portions of this range migrate south to the southern half of the U.S.for the winter. Populations breeding in the southeastern U.S., California, and the tropics are generally non-migratory. Turkey Vultures typically breed and roost in dense woodland while feeding in more open habitats, such as grasslands, meadows, and fields. In some areas, Turkey Vultures also utilize man-made structures, such as abandoned buildings and utility poles. This species feeds almost exclusively on carrion, rarely killing prey itself. Due to this species’ need to scavenge for food, Turkey Vultures are most easily observed soaring high above the ground in search of carrion. Scientists have discovered that this species possesses a more developed sense of smell than the Black Vulture, and that Black Vultures often wait for Turkey Vultures to find food before driving them off and taking the carcass for themselves. This species is primarily active during the day.

Threat Status: Least concern

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Unknown

Supplier: DC Birds

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Description

With a bright, pinkish-red head, brownish-black plumage and a two metre wingspan, the turkey vulture is a highly distinctive bird of prey (2). The head is almost entirely bald, except for some sparse black bristles, and often bears a number of whitish warts. The reddish colouration, which contrasts strongly with the whitish beak, develops as individuals mature, with juvenile birds initially possessing dark grey skin on the head, covered thinly by short downy feathers (2) (3). There are currently six recognised subspecies of turkey vulture (3), which can be distinguished by location, size and intensity of head colouration (2) (3).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Distribution

Geographic Range

Turkey vultures range as far north as the southern border of Canada and as far south as the southernmost part of South America. Over the past few decades, they have been expanding their range northward.

Biogeographic Regions: nearctic (Native ); neotropical (Native )

  • Wallace, M. 2004. New World vultures. Pp. 275-285 in M Hutchins, D Thoney, M McDade, eds. Grzimek's Animal Life Encyclopedia, Vol. 8, 2 Edition. Detroit: Gale.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Geographic Range

Turkey vultures range as far north as the southern border of Canada and as far south as Tierra del Fuego, Chile. Over the past few decades, they have been expanding their geographic range northward. This expansion may be a result of laws and restrictions on hunting this species.

Biogeographic Regions: nearctic (Native ); neotropical (Native )

  • Wallace, M. 2004. New World vultures. Pp. 275-285 in M Hutchins, D Thoney, M McDade, eds. Grzimek's Animal Life Encyclopedia, Vol. 8, 2 Edition. Detroit: Gale.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

occurs (regularly, as a native taxon) in multiple nations

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

National Distribution

Canada

Origin: Native

Regularity: Regularly occurring

Currently: Present

Confidence: Confident

Type of Residency: Breeding

United States

Origin: Native

Regularity: Regularly occurring

Currently: Present

Confidence: Confident

Type of Residency: Year-round

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Global Range: (>2,500,000 square km (greater than 1,000,000 square miles)) BREEDS: southern British Columbia to southern Manitoba and New England, south through U.S. and Middle America to South America and Greater Antilles (introduced in Puerto Rico). Recently has expanded range in the northeastern U.S. and southeastern Canada. NORTHERN WINTER: mainly from northern California, Arizona, Nebraska, Ohio Valley, and Maryland south. Winter concentrations occur Texas, Florida, and along the Wabash River in Indiana (Root 1988).

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Range

The turkey vulture has an extremely expansive range, with the nominate subspecies Cathartes aura aura being found in south-western North America, south to Costa Rica and the Greater Antilles (3). An introduced population also occurs in Puerto Rico (2). Cathartes aura septentrionalis occupies eastern and south-eastern North America, while Cathartes aura meridionalis inhabits southern Canada and northern and central USA (3). Cathartes aura ruficollis is found in southern Central America and lowland South America east of Andes (3), as well as in Trinidad (2). Cathartes aura jota occupies the slopes and valleys of the Andes from Colombia to Patagonia, while Cathartes aura falklandicus is foundfrom Ecuador, south through the western Andes to Tierra del Fuego and the Falklands (3).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Physical Description

Morphology

Physical Description

Turkey vultures vary from 0.85 to 2 kg and can have a total length between 64 and 81 cm. Sexes do not differ, all have a brownish black plumage with a bare head and neck. The skin color on their head and neck can vary from pink to bright red. Turkey vultures are commonly mistaken for black vultures <>. However, black vultures have grey primary and secondary feathers and black heads and necks. Turkey vultures have long, broad wings that help them to soar for long times and not use too much energy in flapping flight.

Range mass: 0.85 to 2.00 kg.

Range length: 64 to 81 cm.

Range wingspan: 170 to 183 cm.

Other Physical Features: endothermic ; homoiothermic; bilateral symmetry

Sexual Dimorphism: sexes alike

  • Palmer, R. 1988. Handbook of North American Birds, Volume 4. New Haven and London: Yale University Press.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Physical Description

There are six subspecies of turkey vultures: three in North America and three in South and Central America. Cathartes aura septentrionalis is found in the eastern United States and west into Minnesota, Kansas, Oklahoma, and eastern Texas. Cathartes aura meridionalis is located mainly west of C. a. septentrionalis and into Baja California, excluding the lower Colorado River valley. Cathartes aura aura is found in the lower Colorado River valley, including most of Arizona, and in southern New Mexico and Texas. Cathartes aura ruficollis is found from Costa Rica south to northern Argentina and east of the Andes, Cathartes aura jota is found in the highlands of southern Colombia through Argentina, and Cathartes aura falklandica is found west of the Andes from Ecuador and Peru through Chile and on the Falkland Islands.

Depending on the subspecies, turkey vultures vary from 0.85 to 2 kg and can have a total length between 64 and 81 cm. Sexes do not differ, all have a brownish black plumage with a bare head and neck. The head and neck skin color can vary from pink to bright red. Turkey vultures are commonly mistaken for black vultures. However, they can be distinguished by their grey primary and secondary feathers and their black head and neck color.

Based on their wing surface to weight ratio, turkey vultures have light wing loading. This makes them more buoyant in air than other vultures and better able to utilize thermals to help them stay in flight with minimal energy usage.

Range mass: 0.85 to 2.00 kg.

Range length: 64 to 81 cm.

Range wingspan: 170 to 183 cm.

Other Physical Features: endothermic ; homoiothermic; bilateral symmetry

Sexual Dimorphism: sexes alike

  • Palmer, R. 1988. Handbook of North American Birds, Volume 4. New Haven and London: Yale University Press.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Size

Length: 69 cm

Weight: 1467 grams

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Ecology

Habitat

Turkey vultures occupy a wide variety of habitats. They are found in forested as well as open environments. Turkey vultures can be found anywhere they can find their carrion food supply.

Habitat Regions: temperate ; tropical ; terrestrial

Terrestrial Biomes: tundra ; desert or dune ; savanna or grassland ; chaparral ; forest ; scrub forest ; mountains

Other Habitat Features: urban ; suburban ; agricultural ; riparian ; estuarine

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Habitat and Ecology

Systems
  • Terrestrial
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Turkey vultures occupy a diverse range of habitats. They are found in forested as well as open environments. Turkey vultures can be found anywhere they can effectively find a carrion food supply. They are easily habituated to humans and human development.

Habitat Regions: temperate ; tropical ; terrestrial

Terrestrial Biomes: tundra ; desert or dune ; savanna or grassland ; chaparral ; forest ; scrub forest ; mountains

Other Habitat Features: urban ; suburban ; agricultural ; riparian ; estuarine

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Comments: Forested and open situations, more commonly in the latter, from lowlands to mountains (AOU 1983). May roost in large flocks at night in trees; roosts often near or over water. In Pennsylvania, selected large conifers for mid-winter roost (Wright et al. 1986).

Eggs are laid in caves (especially in West); on cliffs; in hollow logs, trees, or stumps (tree-cavity nesting formerly more common); on ground in dense shrubbery (especially in eastern U.S.); sometimes in/under abandoned building in woods (Jackson 1983, Palmer 1988); sometimes in abandoned hawk nest (Hilty and Brown 1986). In Pennsylvania/Maryland, nested in areas that were roadless, forested, and undeveloped (Coleman and Fraser 1989).

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

In accordance with the turkey vulture's extensive range, its habitat preferences are extremely broad. Populations are found in coastal deserts, grassland, savanna, temperate forest, and even dense tropical rainforest (2) (3).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Migration

Non-Migrant: Yes. At least some populations of this species do not make significant seasonal migrations. Juvenile dispersal is not considered a migration.

Locally Migrant: Yes. At least some populations of this species make local extended movements (generally less than 200 km) at particular times of the year (e.g., to breeding or wintering grounds, to hibernation sites).

Locally Migrant: Yes. At least some populations of this species make annual migrations of over 200 km.

Generally arrives in northernmost breeding areas in March-April, departs September-November (Bent 1937). Large numbers pass through Panama late February-early April and October-November (Ridgely and Gwynne 1989). Migrants and residents coexist in Panama from Novemnber to April (Smith 1980). Large migratory flocks pass through Costa Rica, mainly over Caribbean lowlands, in both fall (September-October) and spring (late January to mid-May (Stiles and Skutch 1989). Generally avoids crossing wide expanses of water. Has been described as nomadic, rather than migratory, in North America.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Trophic Strategy

Food Habits

Turkey vultures eat mainly carrion, they are scavengers. Very rarely turkey vultures will kill and eat small animals, such as insects, lizards, or bird nestlings. Near humans they rely heavily on roadkill or dead domesticated animals. In areas with fewer humans they eat wild carrion.

Animal Foods: birds; reptiles; carrion ; insects

Other Foods: dung

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Food Habits

Turkey vulture diets vary depending on their habitat. Vultures living around agriculture feed mainly on the carrion of domestic animals, mostly livestock. They also rely heavily on roadkill in areas of human development. A study in South Carolina found that in non-agricultural areas, their primary source of food was wild carrion. Turkey vultures preferentially feed on smaller carcasses, but will feed on dead animals of any size. They prefer freshly dead carcasses but cannot get through the thick skin of larger animals, so must wait for some decay to enable entering body cavities. To find their food they rely on their keen sense of smell and vision. They are one of the few bird species that has an acute sense of smell. In some cases, turkey vultures have been seen eating rotten fruits and vegetables and occasionally they prey on insects, reptiles, or bird nestlings. Turkey vultures have also been observed eating coyote and domestic animal dung.

Animal Foods: birds; reptiles; carrion ; insects

Other Foods: dung

Primary Diet: carnivore (Scavenger )

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Comments: Eats mainly vertebrate carrion (domestic animals and wild sources, down to the size of small amphibians; often small mammals); prefers fresh meat. Sometimes eats ripe or rotten fruits. Sometimes kills small animals. Locates food visually and/or by odor. Can survive for over two weeks without food.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Associations

Ecosystem Roles

Turkey vultures are scavengers. They are important in ecosystems because they eat dead animals; they are part of natural recycling of nutrients in ecosystems.

Ecosystem Impact: biodegradation

Commensal/Parasitic Species:

  • black vultures (Coragyps_atratus)
  • Haematosiphon_inodorus
  • Olfersia_bisulcata
  • Chlamydia_psittaci

  • Wilson, N., G. Oliver, Jr.. 1978. Noteworthy Records of Two Ectoparasites (Cimididae and Hippoboscidae) from the Turkey Vulture in Texas. The Southwestern Naturalist, 23(2): 305-307.
  • Fowler, M., T. Schulz, A. Ardans, B. Reynolds, D. Behymer. 1990. Chlamydiosis in Captive Raptors. Avian Diseases, 34(3): 657-662.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Predation

Most turkey vultures die as a result of being hit by cars, flying into power lines or other structures, or getting caught in fences or leg-hold traps. Eggs and chicks are sometimes eaten by nest predators such as raccoons. Large owls prey on young and adult birds. Turkey vultures escape a lot of predation by being large birds. They also tend to spend a lot of time soaring in the air, where no predators can reach them. When harassed they will regurgitate their stomach contents of rotten meat, which is usually enough to deter predators because of its putrid smell.

Known Predators:

  • humans (Homo_sapiens)
  • great horned owls (Bubo_virginianus)
  • raccoons (Procyon_lotor)

  • Lowney, M. 1999. Damage by black and turkey vultures in Virginia, 1990-1996. Wildlife Society Bullein: Vol. 2, 27(3): 715-719.
  • Rodríguez-Estrella, R., J. Donázar, F. Hiraldo. 1995. Yellow-Footed Gulls Attack Turkey Vultures on Isla Espiritu Santo, Baja California, Mexico. Colonial Waterbirds, 18(1): 100-101.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Ecosystem Roles

Because turkey vultures are major consumer of carrion, they play an important role in biodegradation.

Black vultures follow turkey vultures to carcasses and then aggressively out-compete them at the carcass.

There are multiple parasitic bacteria that have been associated with turkey vultures. In a study in Texas, two ectoparasites from families Cimididae and Hippoboscidae were found to be on some turkey vultures. Another study at the University of California showed that turkey vultures are capable of contracting Chlamydiosis. This was observed in a captive subject at a raptor rehabilitation center in California in 1983.

Ecosystem Impact: biodegradation

Commensal/Parasitic Species:

  • Wilson, N., G. Oliver, Jr.. 1978. Noteworthy Records of Two Ectoparasites (Cimididae and Hippoboscidae) from the Turkey Vulture in Texas. The Southwestern Naturalist, 23(2): 305-307.
  • Fowler, M., T. Schulz, A. Ardans, B. Reynolds, D. Behymer. 1990. Chlamydiosis in Captive Raptors. Avian Diseases, 34(3): 657-662.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Predation

Turkey vulture chicks and eggs are preyed on by mammalian nest predators, such as raccoons. Young and adults are sometimes preyed on by owls. Although turkey vultures have few natural predators, they are known for their defense mechanism of regurgitating semi-digested meat--which deters most predators due to its putrid smell.

Most documented mortality of turkey vultures is caused by human interactions, including collisions with vehicles and structures and entrapment in fencing and leg-hold traps. Problems caused by black vultures are sometimes blamed on turkey vultures by association. Humans sometimes destroy turkey vultures and their roosts.

In 1994 there was an observation at Isla Espiritu Santo, Baja California, Mexico, of yellow-footed gulls (Larus livens) attacking a turkey vulture that had flown near their breeding colony.

Known Predators:

  • Lowney, M. 1999. Damage by black and turkey vultures in Virginia, 1990-1996. Wildlife Society Bullein: Vol. 2, 27(3): 715-719.
  • Rodríguez-Estrella, R., J. Donázar, F. Hiraldo. 1995. Yellow-Footed Gulls Attack Turkey Vultures on Isla Espiritu Santo, Baja California, Mexico. Colonial Waterbirds, 18(1): 100-101.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Known prey organisms

Cathartes aura preys on:
carcass
Egretta tricolor

Based on studies in:
USA: Arizona, Sonora Desert (Desert or dune)
USA: New Mexico, Aden Crater (Carrion substrate)

This list may not be complete but is based on published studies.
  • P. G. Howes, The Giant Cactus Forest and Its World: A Brief Biology of the Giant Cactus Forest of Our American Southwest (Duell, Sloan, and Pearce, New York; Little, Brown, Boston; 1954), from pp. 222-239, from p. 227.
  • M. McKinnerney, 1977. Carrion communities in the northern Chihuahuan Desert. M.S. thesis. University of Texas-El Paso, Texas; and 1978, Carrion communities in the northern Chihuahuan Desert. Southw. Nat. 23:563-576, from thesis and p. 571.
  • Myers, P., R. Espinosa, C. S. Parr, T. Jones, G. S. Hammond, and T. A. Dewey. 2006. The Animal Diversity Web (online). Accessed February 16, 2011 at http://animaldiversity.org. http://www.animaldiversity.org
Creative Commons Attribution 3.0 (CC BY 3.0)

© SPIRE project

Source: SPIRE

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Population Biology

Global Abundance

>1,000,000 individuals

Comments: Estimated number of breeding pairs in Canada was 5000-20,000 in the early 1990s (Kirk et al. 1995).

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

General Ecology

Roosts singly or in groups. Average distance between communal roost and feeding site was 8 km in Maryland/Pennsylvania (Coleman and Fraser 1987). Mean summer range of two known breeders was 6942 hectares; 90% of locations were within 10 kilometers of roost (Kirk and Mossman 1998). Roosts may be temporary (at a food source), seasonal (spring-fall), or permanent (peak numbers in early winter) (Palmer 1988). Human disturbance and canid predation may be significant causes of nest failure in the eastern U.S. (Coleman and Fraser 1989).

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Life History and Behavior

Behavior

Communication and Perception

Like most vultures, turkey vultures have simple calls, such as grunts, hisses, and barking sounds, used mainly to deter predators. They use their vision also to communicate with other turkey vultures.  Turkey vultures have a well-developed sense of smell and are one of the only species of birds worldwide that uses smell. They use their keen sense of smell and their vision to locate carcasses. Black vultures take advantage of this, following turkey vultures to carcasses and then excluding them.

Communication Channels: visual ; acoustic

  • Stevenson, H., B. Anderson. 1994. Birdlife of Florida. Florida: Gainesville University Press.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Communication and Perception

Like most vultures, turkey vultures lack complexity in vocalizations. Most vocalizations are grunts, hisses, and barking sounds, used mainly for predator deterrence. Visual cues are used in mating rituals and may be used in other forms of communication.

Turkey vultures have a well-developed sense of smell and are one of the only species of birds worldwide that uses smell extensively. They use their keen sense of smell and their vision to locate carcasses. Black vultures take advantage of this, following turkey vultures to carcasses and then excluding them.

Communication Channels: visual ; acoustic

  • Stevenson, H., B. Anderson. 1994. Birdlife of Florida. Florida: Gainesville University Press.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Cyclicity

Comments: In one study, most left roost 3.5-5 hours after sunrise. May remain at roost up to 2 or more days during rainy weather. (Palmer 1988).

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Life Expectancy

Lifespan/Longevity

There is not much known about how long turkey vultures live, although one wild turkey vulture lived more than 16 years.

Range lifespan

Status: wild:
17 (high) years.

Average lifespan

Status: wild:
10 years.

Average lifespan

Status: wild:
202 months.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Lifespan/Longevity

There is little recorded information on the lifespan of turkey vultures. A banded individual lived up to 16 years and 10 months. One study demonstrated that up to one-fifth of all adult turkey vultures die each year.

Range lifespan

Status: wild:
17 (high) years.

Average lifespan

Status: wild:
10 years.

Average lifespan

Status: wild:
202 months.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Lifespan, longevity, and ageing

Maximum longevity: 20.8 years
Creative Commons Attribution 3.0 (CC BY 3.0)

© Joao Pedro de Magalhaes

Source: AnAge

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Reproduction

Turkey vultures gather on the ground and begin hopping around in a circle with wings partially spread in order to attract mates. Males and females often mate for life or at least for many years, and often stay together throughout the year.

Mating System: monogamous

Turkey vultures breed from March to June in North America. Nests are lined with debris and are found in hollow trees or logs, crevices in cliffs, or in old buildings. Eggs are off-white and marked with brown and lavender. Young turkey vultures hatch in 30 to 40 days and then take another 9 to 10 weeks to learn how to fly. They are are independent about a week later.

Breeding interval: Turkey vultures breed once yearly.

Breeding season: Breeding occurs from March to June in North America.

Range eggs per season: 1 to 3.

Range time to hatching: 30 to 40 days.

Range fledging age: 70 to 80 days.

Range time to independence: 80 to 90 days.

Key Reproductive Features: seasonal breeding ; gonochoric/gonochoristic/dioecious (sexes separate)

Average eggs per season: 2.

Turkey vulture chicks are helpless at hatching. Both parents regurgitate food for their young several times a day until they are 70 to 80 days old, when they learn to fly.

Parental Investment: altricial ; pre-fertilization (Provisioning, Protecting: Female); pre-hatching/birth (Provisioning: Female, Protecting: Male, Female); pre-weaning/fledging (Provisioning: Male, Female, Protecting: Male, Female); pre-independence (Provisioning: Male, Female, Protecting: Male, Female)

  • Kaufman, K. 1996. Lives of North American Birds. New York, NY: Houghton Mifflin Field Guides.
  • Fergus, C. 2003. Wildlife of Virginia and Maryland. Mechanicsburg, PA: Stackpole Books.
  • Rabenold, P. 1986. Family Associations in Communally Roosting Black Vultures. The Auk, 103(1): 32-41.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

To start the mating ritual, several birds gather on the ground and begin hopping around in a circle with wings partially spread. In flight a bird might closely follow a potential mate while continuing a ritual of flapping and diving.

Adult mated pairs spend much more time with one another than with other vultures. Mating-pair bonds last throughout the breeding season and often all year long.

Mating System: monogamous

Breeding takes place from March to June in North America. Nest sites are usually found in sheltered areas such as hollow trees or logs, crevices in cliffs, or in old buildings. Little or no nest is actually built in these sites. Their eggs are laid on debris or the flat bottom of the nest site. Eggs are off-white and marked with brown and lavender. Incubation time is typically 30 to 40 days. Young reach the fledging stage at 70 to 80 days old and are independent about a week later.

Breeding interval: Turkey vultures breed once yearly.

Breeding season: Breeding occurs from March to June in North America.

Range eggs per season: 1 to 3.

Range time to hatching: 30 to 40 days.

Range fledging age: 70 to 80 days.

Range time to independence: 80 to 90 days.

Key Reproductive Features: seasonal breeding ; gonochoric/gonochoristic/dioecious (sexes separate)

Average eggs per season: 2.

Turkey vulture chicks are altricial. Adults care for them for 70 to 80 days by regurgitating well-digested food several times daily and providing some protection. Both adults care fr the young. If adults are threatened when nesting, they might flee, regurgitate on the intruder, or play dead.

Parental Investment: altricial ; pre-fertilization (Provisioning, Protecting: Female); pre-hatching/birth (Provisioning: Female, Protecting: Male, Female); pre-weaning/fledging (Provisioning: Male, Female, Protecting: Male, Female); pre-independence (Provisioning: Male, Female, Protecting: Male, Female)

  • Kaufman, K. 1996. Lives of North American Birds. New York, NY: Houghton Mifflin Field Guides.
  • Fergus, C. 2003. Wildlife of Virginia and Maryland. Mechanicsburg, PA: Stackpole Books.
  • Rabenold, P. 1986. Family Associations in Communally Roosting Black Vultures. The Auk, 103(1): 32-41.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Clutch size is usually 2. Incubation lasts 5-6 weeks, by both sexes. Young first fly at about 9 weeks. Family may stay together several months after young fledge. Does not renest if clutch is lost.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Barcode data: Cathartes aura

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There are 7 barcode sequences available from BOLD and GenBank.  Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.  See the BOLD taxonomy browser for more complete information about this specimen and other sequences.

AATCGATGACTATTCTCAACCAACCACAAAGACATCGGTACCTTATACTTAATTTTCGGCGCATGAGCTGGCATAGCCGGTACTGCCCTTAGTCTGCTAATTCGGGCAGAGCTCGGACAACCCGGAACCCTCTTAGGAGAT---GACCAAATCTATAACGTAATTGTCACTGCCCATGCCTTCGTGATAATTTTCTTCATAGTAATACCCATCATAATTGGAGGATTTGGAAACTGATTAGTCCCACTTATAATCGGCGCCCCCGATATAGCATTTCCACGAATAAACAACATAAGCTTCTGACTACTTCCCCCATCCTTCCTACTCCTACTAGCCTCTTCTACAGTAGAAGCTGGGGCGGGCACAGGATGAACTGTATACCCCCCACTAGCTGGCAACCTTGCCCATGCTGGGGCATCGGTAGACCTAGCTATTTTCTCCCTTCACCTAGCTGGAGTATCGTCCATCTTAGGTGCAATCAACTTTATTACAACCGCTATCAACATAAAACCCCCAGCCCTCTCACAGTACCAAACCCCCCTATTCGTATGATCCGTCCTCATCACCGCAGTACTACTACTCCTCTCACTTCCAGTCCTTGCTGCTGGAATCACTATGCTACTAACAGACCGAAACTTAAACACCACATTCTTTGACCCTGCTGGAGGAGGCGATCCGGTCCTATATCAACACCTCTTCTGATTCTTCGGCCACCCAGAAGTCTATATCCTGATTCTACCAGGCTTTGGAATCATCTCACACGTAGTAACATATTATGCTGGCAAAAAAGAACCATTCGGTTACATGGGAATAGTATGGGCCATGCTATCCATCGGATTCCTAGGCTTTATCGTATGAGCTCACCACATGTTTACAGTAGGAATAGATGTAGACACCCGAG
-- end --

Download FASTA File
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Statistics of barcoding coverage: Cathartes aura

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 8
Specimens with Barcodes: 13
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Conservation

Conservation Status

Turkey vultures are a common species throughout their range. The IUCN lists them as a species of Least Concern.

IUCN Red List of Threatened Species: least concern

US Migratory Bird Act: no special status

US Federal List: no special status

CITES: no special status

State of Michigan List: no special status

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

IUCN Red List Assessment


Red List Category
LC
Least Concern

Red List Criteria

Version
3.1

Year Assessed
2009

Assessor/s
BirdLife International

Reviewer/s
Bird, J., Butchart, S.

Contributor/s

Justification
This species has an extremely large range, and hence does not approach the thresholds for Vulnerable under the range size criterion (Extent of Occurrence <20,000 km2 combined with a declining or fluctuating range size, habitat extent/quality, or population size and a small number of locations or severe fragmentation). The population trend appears to be stable, and hence the species does not approach the thresholds for Vulnerable under the population trend criterion (>30% decline over ten years or three generations). The population size is extremely large, and hence does not approach the thresholds for Vulnerable under the population size criterion (<10,000 mature individuals with a continuing decline estimated to be >10% in ten years or three generations, or with a specified population structure). For these reasons the species is evaluated as Least Concern.

History
  • 2008
    Least Concern
  • 2004
    Least Concern
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Turkey vultures are a common species throughout their range. The IUCN lists them as a species of Least Concern.

US Migratory Bird Act: no special status

US Federal List: no special status

CITES: no special status

State of Michigan List: no special status

IUCN Red List of Threatened Species: least concern

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

National NatureServe Conservation Status

Canada

Rounded National Status Rank: N5B - Secure

United States

Rounded National Status Rank: N5B,N5N : N5B: Secure - Breeding, N5N: Secure - Nonbreeding

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

NatureServe Conservation Status

Rounded Global Status Rank: G5 - Secure

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Status

Classified as Least Concern (LC) on the IUCN Red List (1).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Global Short Term Trend: Relatively stable (=10% change)

Comments: Apparently declining in some areas (e.g., northern Florida, southern Atlantic coast of U.S., Arizona, prairie of Canada, parts of Mexico) in the early 1980s (Wilbur 1983). Increased throughout Canada, 1966-1991 (Kirk et al. 1995).

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Threats

Comments: According to Ehrlich et al. (1992), jeopardized by widespread eggshell thinning resulting from ingestion of contaminated food.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

There are currently no major threats to the turkey vulture, its population and range are extremely large, stable and in some areas are increasing (1) (2). Nevertheless, due to the unjustified negative associations sometimes held with regard to vultures, in some regions the turkey vulture faces local persecution (3) (6).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Management

Management Requirements: See Wallace and Temple (1983) for information on propagation and release.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Conservation

While there is little requirement at present to conserve the turkey vulture (1), the Turkey Vulture Society is working to promote scientific study of this fascinating and ecologically important species and reduce its persecution (6).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Relevance to Humans and Ecosystems

Benefits

Economic Importance for Humans: Negative

Sometimes turkey vultures are blamed for the same bad behaviors as their cousins, Coragyps atratus. Black vultures will kill newborn cows, goats, or sheep, and cats or small dogs. Turkey vultures eat mainly carrion and almost never kill anything larger than a mouse. People out to kill black vultures will also kill turkey vultures because they roost together or because they confuse them with black vultures.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Economic Importance for Humans: Positive

Turkey vultures are important as scavengers. They remove dead carcasses, which can pose a health risk to humans and livestock.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Economic Importance for Humans: Negative

Because turkey vultures commonly roost with black vultures where they co-occur, they are sometimes associated with the negative impacts of black vultures. In Virginia, black vultures have been caught killing young livestock and harassing, injuring, or even killing domestic pets. Numerous non-lethal attempts have been made to remove vultures from the area include: deter these roosts by removing carrion, moving expectant cattle to alternate pastures, pyrotechnics to scare off vultures, and monitoring livestock several times a day. These efforts are generally ineffective. Lethal methods of removal are common among farmers to prevent further economic losses. Turkey vultures rarely kill small animals, relying almost exclusively on carrion.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Economic Importance for Humans: Positive

Turkey vultures are important as scavengers. They remove dead carcasses, which can pose a health risk to humans and livestock.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Wikipedia

Turkey Vulture

The Turkey Vulture (Cathartes aura), also known in some North American regions as the turkey buzzard (or just buzzard), and in some areas of the Caribbean as the John crow or carrion crow,[2] is the most widespread of the New World vultures.[3] One of three species in the genus Cathartes, in the family Cathartidae, the Turkey Vulture ranges from southern Canada to the southernmost tip of South America. It inhabits a variety of open and semi-open areas, including subtropical forests, shrublands, pastures, and deserts.[1]

It, like all New World vultures, is not related to the Old World vultures of Europe, Africa, and Asia. It looks nearly identical because of convergent evolution, where natural selection similarly shapes unrelated animals adapting to the same conditions.

The Turkey Vulture is a scavenger and feeds almost exclusively on carrion.[4] It finds its food using its keen eyes and sense of smell, flying low enough to detect the gases produced by the beginnings of the process of decay in dead animals.[4] In flight, it uses thermals to move through the air, flapping its wings infrequently. It roosts in large community groups. Lacking a syrinx—the vocal organ of birds—its only vocalizations are grunts or low hisses.[5] It nests in caves, hollow trees, or thickets. Each year it generally raises two chicks, which it feeds by regurgitation.[6] It has very few natural predators.[7] In the United States of America, the vulture receives legal protection under the Migratory Bird Treaty Act of 1918.[8]

Contents

Taxonomy

In flight over Florida, USA

The Turkey Vulture received its common name from the resemblance of the adult's bald red head and its dark plumage to that of the male Wild Turkey, while the name "vulture" is derived from the Latin word vulturus, meaning "tearer," and is a reference to its feeding habits.[9] The word buzzard is used by North Americans to refer to this bird, yet in the Old World this word refers to members of the genus Buteo.[10] The generic term Cathartes means "purifier" and is the Latinized form from the Greek kathartēs/καθαρτης.[11] The species name, aura, is Latinized from the Native Mexican word for the bird, auroura.[9] The Turkey Vulture was first formally described by Linnaeus as Vultur aura in his Systema Naturae in 1758, and characterised as V. fuscogriseus, remigibus nigris, rostro albo ("brown-gray vulture, with black wings and a white beak").[12] It is a member of the family Cathartidae, along with the other six species of New World vultures, and included in the genus Cathartes, along with the Greater Yellow-headed Vulture and the Lesser Yellow-headed Vulture. Like other New World vultures, the Turkey Vulture has a diploid chromosome number of 80.[13]

The exact taxonomic placement of the Turkey Vulture and the remaining six species of New World Vultures remains unclear.[14] Though both are similar in appearance and have similar ecological roles, the New World and Old World Vultures evolved from different ancestors in different parts of the world. Just how different the two are is currently under debate, with some earlier authorities suggesting that the New World vultures are more closely related to storks.[15] More recent authorities maintain their overall position in the order Falconiformes along with the Old World Vultures[16] or place them in their own order, Cathartiformes.[17] The South American Classification Committee has removed the New World Vultures from Ciconiiformes and instead placed them in Incertae sedis, but notes that a move to Falconiformes or Cathartiformes is possible.[14]

There are five subspecies of Turkey Vulture:

  • C. a. aura is the nominate subspecies. It is found from Mexico south through South America and the Greater Antilles. This subspecies occasionally overlaps its range with other subspecies. It is the smallest of the subspecies but is nearly indistinguishable from C. a. meridionalis in color.[18]
  • C. a. jota, the Chilean Turkey Vulture, is larger, browner, and slightly paler than C. a. ruficollis. The secondary feathers and wing coverts may have gray margins.[19]
  • C. a. meridionalis, the Western Turkey Vulture, is a synonym for C. a. teter. C. a. teter was identified as a subspecies by Friedman in 1933, but in 1964 Alexander Wetmore separated the western birds, which took the name meridionalis, which was applied earlier to a migrant from South America. It breeds from southern Manitoba, southern British Columbia, central Alberta and Saskatchewan south to Baja California, south-central Arizona, and south-central Texas.[20] It is the most migratory subspecies, migrating as far as South America, where it overlaps the range of the smaller C. a. aura. It differs from the Eastern Turkey Vulture in color, as the edges of the lesser wing coverts are darker brown and narrower.[18]
  • C. a. ruficollis is found in Panama south through Uruguay and Argentina. It is also found on the island of Trinidad.[21] It is darker and more black than C. a. aura, with brown wing edgings which are narrower or absent altogether.[21] The head and neck are dull red with yellow-white or green-white markings. Adults generally have a pale yellow patch on the crown of the head.[19]
  • C. a. septentrionalis is known as the Eastern Turkey Vulture. The Eastern and Western Turkey Vultures differ in tail and wing proportions. It ranges from southeastern Canada south through the eastern United States. It is less migratory than C. a. meridionalis and rarely migrates to areas south of the United States.[18]

Description

A large bird, it has a wingspan of 160–183 cm (63–72 in), a length of 62–81 cm (24–32 in), and weight of 0.8 to 2.3 kg (1.8 to 5.1 lb).[22][23][24] While birds in the Northern limit of the species' range average around 2 kg (4.4 lb), vulture from the neotropics are generally smaller, averaging around 1.45 kg (3.2 lb).[25][26] It displays minimal sexual dimorphism; sexes are identical in plumage and in coloration, although the female is slightly larger.[27] The body feathers are mostly brownish-black, but the flight feathers on the wings appear to be silvery-gray beneath, contrasting with the darker wing linings.[22] The adult's head is small in proportion to its body and is red in color with few to no feathers. It also has a relatively short, hooked, ivory-colored beak.[28] The irises of the eyes are gray-brown; legs and feet are pink-skinned, although typically stained white. The eye has a single incomplete row of eyelashes on the upper lid and two rows on the lower lid.[29]

The two front toes of the foot are long and have small webs at their bases.[30] Tracks are large, between 3.75 and 5.5 inches in length (9.5–14 cm) and 3.25 and 4 inches in width (8.2–10.2 cm), both measurements including claw marks. Toes are arranged in the classic, anisodactyl pattern.[31] The feet are flat, relatively weak, and poorly adapted to grasping; the talons are also not designed for grasping, as they are relatively blunt.[3] In flight, the tail is long and slim. The Black Vulture is relatively shorter-tailed and shorter-winged, which makes it appear rather smaller in flight than the Turkey vulture, although the body masses of the two species are roughly the same. The nostrils are not divided by a septum, but rather are perforate; from the side one can see through the beak.[32] It undergoes a molt in late winter to early spring. It is a gradual molt, which lasts until early autumn.[6] The immature bird has a gray head with a black beak tip; the colors change to those of the adult as the bird matures.[33] How long turkey vultures can live in captivity is not well known. While 21 years is generally given as a maximum age, the Gabbert Raptor Center on the University of Minnesota campus is home to a turkey vulture named Nero with a confirmed age of 37. The oldest wild captured banded bird was 16 years old.[4]

Leucistic (sometimes mistakenly called "albino") Turkey Vultures are sometimes seen.[34] The well-documented records come from the United States of America, but this probably reflects the fact that such birds are more commonly reported by birders there, rather than a geographical variation. Even in the United States, white Turkey Vultures (although they presumably always turned up every now and then) were only discussed in birder and raptor conservation circles and are not scientifically studied.[35]

The Turkey Vulture, like most other vultures, has very few vocalization capabilities. Because it lacks a syrinx, it can only utter hisses and grunts.[5] It usually hisses when it feels threatened. Grunts are commonly heard from hungry young and from adults in their courtship display.

Distribution and habitat

The Turkey Vulture has a large range, with an estimated global occurrence of 28,000,000 km². It is the most abundant vulture in the Americas.[3] Its global population is estimated to be 4,500,000 individuals.[1] It is found in open and semi-open areas throughout the Americas from southern Canada to Cape Horn. It is a permanent resident in the southern United States, though northern birds may migrate as far south as South America.[4] The Turkey Vulture is widespread over open country, subtropical forests, shrublands, deserts, and foothills.[36] It is also found in pastures, grasslands, and wetlands.[1] It is most commonly found in relatively open areas which provide nearby woods for nesting and it generally avoids heavily forested areas.[22]

Ecology and behavior

Spread-winged adult

The Turkey Vulture is gregarious and roosts in large community groups, breaking away to forage independently during the day. Several hundred vultures may roost communally in groups which sometimes even include Black Vultures. It roosts on dead, leafless trees, and will also roost on man-made structures such as water or microwave towers. Though it nests in caves, it does not enter them except during the breeding season.[6] The Turkey Vulture lowers its night-time body temperature by about 6 degrees Celsius to 34 °C (93 °F), becoming slightly hypothermic.[30]

This vulture is often seen standing in a spread-winged stance. The stance is believed to serve multiple functions: drying the wings, warming the body, and baking off bacteria. It is practiced more often following damp or rainy nights. This same behavior is displayed by other New World vultures, by Old World vultures, and by storks.[7] Like storks, the Turkey Vulture often defecates on its own legs, using the evaporation of the water in the feces and/or urine to cool itself, a process known as urohidrosis.[37] It cools the blood vessels in the unfeathered tarsi and feet, and causes white uric acid to streak the legs.[38] The Turkey Vulture has few natural predators. Adult, immature and fledging vultures may fall prey to golden eagles, bald eagles and great horned owls, while eggs and nestlings may be preyed on by mammals such as raccoons, virginia opossum and foxes.[7][23] Its primary form of defense is regurgitating semi-digested meat, a foul-smelling substance which deters most creatures intent on raiding a vulture nest.[6] It will also sting if the predator is close enough to get the vomit in its face or eyes. In some cases, the vulture must rid its crop of a heavy, undigested meal in order to take flight to flee from a potential predator.[28] Its life expectancy in the wild ranges upward of 16 years, with a captive life span of over 30 years being possible.[39][40]

The Turkey Vulture is awkward on the ground with an ungainly, hopping walk. It requires a great deal of effort to take flight, flapping its wings while pushing off the ground and hopping with its feet.[28] While soaring, the Turkey Vulture holds its wings in a shallow V-shape and often tips from side to side, frequently causing the gray flight feathers to appear silvery as they catch the light. The flight of the Turkey Vulture is an example of static soaring flight, in which it flaps its wings very infrequently, and takes advantage of rising thermals to stay soaring.[41]

Diet

Feeding on dead gull at Morro Bay, California, USA

The Turkey Vulture feeds primarily on a wide variety of carrion, from small mammals to large grazers, preferring those recently dead, and avoiding carcasses that have reached the point of putrefaction. It may rarely feed on plant matter, shoreline vegetation, pumpkin and other crops, live insects and other invertebrates.[36] In South America, it has been seen and recorded on photo feeding on the fruits of the introduced Oil Palm.[42][43][44] It rarely, if ever, kills prey itself.[45] The Turkey Vulture can often be seen along roadsides feeding on roadkill, or near bodies of water, feeding on washed-up fish.[4] It also will feed on fish or insects which have become stranded in shallow water.[6] Like other vultures, it plays an important role in the ecosystem by disposing of carrion which would otherwise be a breeding ground for disease.[46]

The Turkey Vulture forages by smell, an ability that is uncommon in the avian world. It often will fly low to the ground to pick up the scent of ethyl mercaptan, a gas produced by the beginnings of decay in dead animals.[7] The olfactory lobe of its brain, responsible for processing smells, is particularly large compared to that of other animals.[7] This heightened ability to detect odors allows it to search for carrion below the forest canopy. King Vultures, Black Vultures and condors, which lack the ability to smell carrion, follow the Turkey Vulture to carcasses. The Turkey Vulture arrives first at the carcass, or with Greater Yellow-headed Vultures or Lesser Yellow-headed Vultures, which also share the ability to smell carrion.[7] It displaces the Yellow-headed Vultures from carcasses due to its larger size,[46] but is displaced in turn by the King Vulture and both types of condor, which make the first cut into the skin of the dead animal. This allows the smaller, weaker-billed, Turkey Vulture access to food, because it cannot tear the tough hides of larger animals on its own. This is an example of mutual dependence between species.[47]

Reproduction

The breeding season of the Turkey Vulture varies according to latitude.[48] In the southern United States, it commences in March, peaks in April to May, and continues into June.[49] In more northerly latitudes, the season starts later and extends into August.[50] Courtship rituals of the Turkey Vulture involve several individuals gathering in a circle, where they perform hopping movements around the perimeter of the circle with wings partially spread. In the air, one bird closely follows another while flapping and diving.[36]

Eggs are generally laid in the nesting site in a protected location such as a cliff, a cave, a rock crevice, a burrow, inside a hollow tree, or in a thicket. There is little or no construction of a nest; eggs are laid on a bare surface. Females generally lay two eggs, but sometimes one and rarely three. The eggs are cream-colored, with brown or lavender spots around their larger end.[36] Both parents incubate, and the young hatch after 30 to 40 days. Chicks are altricial, or helpless at birth. Both adults feed the chicks by regurgitating food for them, and care for them for 10 to 11 weeks. When adults are threatened while nesting, they may flee, or they may regurgitate on the intruder or feign death.[6] If the chicks are threatened in the nest, they defend themselves by hissing and regurgitating.[36] The young fledge at about nine to ten weeks. Family groups remain together until fall.[36]

Relationship with humans

A side view, showing the perforated nostrils.

The Turkey Vulture is sometimes accused of carrying anthrax or hog cholera, both livestock diseases, on its feet or bill by cattle ranchers and is therefore occasionally perceived as a threat.[51] However, the virus that causes hog cholera is destroyed when it passes through the Turkey Vulture's digestive tract.[28] This species also may be perceived as a threat by farmers due to the similar Black Vulture's tendency to attack and kill newborn cattle. The Turkey Vulture does not kill live animals but will mix with flocks of Black Vultures and will scavenge what they leave behind. Nonetheless, its appearance at a location where a calf has been killed gives the incorrect impression that the Turkey Vulture represents a danger to calves.[52] The droppings produced by Turkey Vultures and other vultures can harm or kill trees and other vegetation.[53] The Turkey Vulture can be held in captivity, though the Migratory Bird Treaty Act prevents this in the case of uninjured animals or animals capable of returning to the wild.[54] In captivity, it can be fed fresh meat, and younger birds will gorge themselves if given the opportunity.[28]

The Turkey Vulture species receives special legal protections under the Migratory Bird Treaty Act of 1918 in the United States,[8] by the Convention for the Protection of Migratory Birds in Canada,[55] and by the Convention for the Protection of Migratory Birds and Game Mammals in Mexico.[55] In the USA it is illegal to take, kill, or possess Turkey Vultures, and violation of the law is punishable by a fine of up to $15,000 and imprisonment of up to six months.[54] It is listed as a species of Least Concern by the IUCN Red List. Populations appear to remain stable, and it has not reached the threshold of inclusion as a threatened species, which requires a decline of more than 30 percent in ten years or three generations.[1]

References

Notes

  1. ^ a b c d e BirdLife International (2012). "Cathartes aura". IUCN Red List of Threatened Species. Version 2012.1. International Union for Conservation of Nature. Retrieved 16 July 2012. 
  2. ^ Turkey Vulture (Cathartes aura). peregrinefund.org
  3. ^ a b c "turkey vulture". Britannica Concise Encyclopedia. Encyclopædia Britannica. Retrieved 2007-10-14. 
  4. ^ a b c d e Attwood, E. "Cathartes aura". Animal Diversity Web. University of Michigan Museum of Zoology. Retrieved 2007-09-30. 
  5. ^ a b Miskimen, Mildred (January 1957). "Absence of Syrinx in the Turkey Vulture (Cathartes Aura)" (PDF). The Auk 74 (1): 104–105. doi:10.2307/4082043. Retrieved 2006-10-24. 
  6. ^ a b c d e f Fergus, Charles (2003). Wildlife of Virginia and Maryland Washington D.C.. Stackpole Books. p. 171. ISBN 0-8117-2821-8. 
  7. ^ a b c d e f Snyder, Noel F. R. and Helen Snyder (2006). Raptors of North America: Natural History and Conservation. Voyageur Press. p. 40. ISBN 0-7603-2582-0. 
  8. ^ a b "Birds Protected by the Migratory Bird Treaty Act". US Fish & Wildlife Service. Archived from the original on October 10, 2007. Retrieved 2007-10-14. 
  9. ^ a b Holloway, Joel Ellis (2003). Dictionary of Birds of the United States: Scientific and Common Names. Timber Press. p. 59. ISBN 0-88192-600-0. 
  10. ^ "Turkey Vulture". Birds of Texas. Texas Parks & Wildlife. 2001. Retrieved 2007-10-29. 
  11. ^ Liddell, Henry George; Robert Scott (1980). Greek-English Lexicon, Abridged Edition. Oxford: Oxford University Press. ISBN 0-19-910207-4. 
  12. ^ (Latin) Linnaeus, Carolus (1758). Systema naturae per regna tria naturae, secundum classes, ordines, genera, species, cum characteribus, differentiis, synonymis, locis. Tomus I. Editio decima, reformata. Holmiae. (Laurentii Salvii). p. 86. 
  13. ^ Tagliarini, Marcella Mergulhão; Pieczarka, Julio Cesar; Nagamachi, Cleusa Yoshiko; Rissino, Jorge; de Oliveira, Edivaldo Herculano C. (2009). "Chromosomal analysis in Cathartidae: distribution of heterochromatic blocks and rDNA, and phylogenetic considerations". Genetica 135 (3): 299–304. doi:10.1007/s10709-008-9278-2. PMID 18504528. 
  14. ^ a b Remsen, J. V., Jr.; C. D. Cadena; A. Jaramillo; M. Nores; J. F. Pacheco; M. B. Robbins; T. S. Schulenberg; F. G. Stiles; D. F. Stotz & K. J. Zimmer. (2007). A classification of the bird species of South America. South American Classification Committee. Retrieved on 2007–10–15
  15. ^ Sibley, Charles G. and Burt L. Monroe. 1990. Distribution and Taxonomy of the Birds of the World. Yale University Press. ISBN 0-300-04969-2. Retrieved 2007-04-11.
  16. ^ Sibley, Charles G., and Jon E. Ahlquist. (1991). Phylogeny and Classification of Birds: A Study in Molecular Evolution. Yale University Press. ISBN 0-300-04085-7. Retrieved 2007-04-11.
  17. ^ Ericson, Per G. P.; Anderson, Cajsa L.; Britton, Tom; Elżanowski, Andrzej; Johansson, Ulf S.; Kallersjö, Mari; Ohlson, Jan I.; Parsons, Thomas J.; Zuccon, Dario & Mayr, Gerald (2006). "Diversification of Neoaves: integration of molecular sequence data and fossils". Biology Letters 2 (4): 1–5. doi:10.1098/rsbl.2006.0523. 
  18. ^ a b c Amadon, Dean (1977). "Notes on the Taxonomy of Vultures" (PDF). Condor (Cooper Ornithological Society) 79 (4): 413–416. doi:10.2307/1367720. JSTOR 1367720. 
  19. ^ a b Blake, Emmet Reid (1953). Birds of Mexico: A Guide for Field Identification. University of Chicago Press. p. 267. ISBN 0-226-05641-4. 
  20. ^ Peters J. L.; Mayr E.& Cottrell,W. (1979). Check-list of Birds of the World. Museum of Comparative Zoology. p. 276. 
  21. ^ a b Brown, Leslie & Amadon, Dean (1968). Eagles, Hawks, and Falcons of the World. McGraw-Hill. p. 175. 
  22. ^ a b c Hilty, Stephen L. (1977). A Guide to the Birds of Colombia. Princeton University Press. p. 87. ISBN 0-691-08372-X. 
  23. ^ a b "ADW: Cathartes aura: Information". Animaldiversity.ummz.umich.edu. 2009-12-20. Retrieved 2009-12-24. 
  24. ^ "Turkey Vulture". Peregrinefund.org. Retrieved 2012-01-11. 
  25. ^ "Turkey Vulture, Life History, All About Birds — Cornell Lab of Ornithology". Allaboutbirds.org. Retrieved 2009-12-24. 
  26. ^ Raptors of the World by Ferguson-Lees, Christie, Franklin, Mead & Burton. Houghton Mifflin (2001), ISBN 0-618-12762-3
  27. ^ Hill, N. P. (1944). "Sexual Dimorphism in the Falconiformes" (PDF). Auk 61 (April): 228. doi:10.2307/4079366. Retrieved 2007-10-14. 
  28. ^ a b c d e Terres, J. K. (1980). The Audubon Society Encyclopedia of North American Birds. New York, NY: Knopf. p. 959. ISBN 0-394-46651-9. 
  29. ^ Fisher, Harvey I. (February). "The Pterylosis of the Andean Condor". Condor (Cooper Ornithological Society) 44 (1): 30–32. doi:10.2307/1364195. JSTOR 1364195. 
  30. ^ a b Feduccia, J. Alan (1999). The Origin and Evolution of Birds. Yale University Press. p. 116. ISBN 0-226-05641-4. 
  31. ^ Elbroch, Mark (2001). Bird Tracks & Sign. Mechanicsburg, PA: Stackpole Books. p. 456. ISBN 0-8117-2696-7. 
  32. ^ Allaby, Michael (1992). The Concise Oxford Dictionary of Zoology. Oxford, UK: Oxford University Press. p. 348. ISBN 0-19-286093-3. 
  33. ^ "Turkey Vulture". Cornell Lab of Ornithology. 2003. Retrieved 2007-09-30. 
  34. ^ Kirk, D. A.; Mossman, M. J. (1998). "Turkey Vulture (Cathartes aura)". In A. Poole and F. Gill. The Birds of North America 339. Philadelphia, PA.: The Birds of North America, Inc. 
  35. ^ Golden Gate Raptor Observatory: Rare Raptors. Retrieved 2007-09-17.
  36. ^ a b c d e f Kaufman, Kenn (1996). Lives of North American Birds. Houghton Mifflin Field Guides. p. 112. ISBN 0-618-15988-6. 
  37. ^ Ridenhou, Larry. "NCA – Turkey Vulture". Snake River Birds of Prey National Conservation Area. Bureau of Land Management. Retrieved 2006-12-17. 
  38. ^ Gordon, Malcolm S. (1977). Animal Physiology: Principles and Adaptations. Macmillan. p. 357. 
  39. ^ "QandA". Vulturesociety.homestead.com. Retrieved 2012-08-13. 
  40. ^ TURKEY VULTURE (Cathartes aura). raptorrehab.org
  41. ^ "Turkey vulture, Cathartes aura". U.S. Geological Survey. Retrieved 2007-09-30. 
  42. ^ Pinto, O. M. O. (1965). "Dos frutos da palmeira Elaeis guineensis na dieta de Cathartes aura ruficollis". Hornero 8: 276–277. 
  43. ^ Galetti, Mauro and Guimarães, Paulo R., Jr. "Seed dispersal of Attalea phalerata (Palmae) by Crested caracaras (Caracara plancus) in the Pantanal and a review of frugivory by raptors". Ararajuba 12 (2): 133–135. 
  44. ^ Souza, J. S. (2012). WA794679, Cathartes aura (Linnaeus, 1758). Wiki Aves – A Enciclopédia das Aves do Brasil. Retrieved February 14 2013
  45. ^ Kritcher, John C. (1999). A Neotropical Companion. Princeton University Press. p. 286. ISBN 0-691-00974-0. 
  46. ^ a b Gomez, LG; Houston, DC; Cotton, P; Tye, A, Luis G.; Houston, David C.; Cotton, Peter; Tye, Alan (1994). "The role of greater yellow-headed vultures Cathartes melambrotus as scavengers in neotropical forest". Ibis 136 (2): 193–196. doi:10.1111/j.1474-919X.1994.tb01084.x. Retrieved 2007-10-03. 
  47. ^ Muller-Schwarze, Dietland (2006). Chemical Ecology of Vertebrates. Cambridge University Press. p. 350. ISBN 0-521-36377-2. 
  48. ^ Burton, Maurice; Burton, Robert (2002). The International Wildlife Encyclopedia, third edition 20. Marshall Cavendish. p. 2788. ISBN 0-7614-7286-X. 
  49. ^ "Species Description: Turkey Vulture (Cathartes aura)". Georgia Museum of Natural History. Retrieved 2007-10-14. 
  50. ^ "TURKEY VULTURE (Cathartes aura)". Government of British Columbia. Retrieved 2011-12-01. 
  51. ^ Kirk, D. A., and M. J. Mossman. 1998. Turkey Vulture (Cathartes aura). In The Birds of North America, No. 339 (A. Poole and F. Gill, eds.). The Birds of North America, Inc., Philadelphia, PA.
  52. ^ Paulik, Laurie (2007-08-06). "Vultures and Livestock". AgNIC Wildlife Damage Management Web. Retrieved 2007-10-15. 
  53. ^ Paulik, Laurie (2007-08-06). "Vultures". AgNIC Wildlife Damage Management Web. Retrieved 2007-10-15. 
  54. ^ a b "Migratory Bird Treaty Act". US Code Collection. Cornell Law School. Retrieved 2007-10-14. 
  55. ^ a b "Game and Wild Birds: Preservation". US Code Collection. Cornell Law School. Retrieved 2007-10-29. 

Bibliography

Creative Commons Attribution Share Alike 3.0 (CC BY-SA 3.0)

 

Source: Wikipedia

Unreviewed

Article rating from 0 people

Average rating: 2.5 of 5

Names and Taxonomy

Taxonomy

Comments: Transferred to Ciconiiformes (AOU 1998) but is now tentatively returned to the order Falconiformes after re-evaluation of the reasons for the earlier change. Further, some genetic studies (Cracraft et al. 2004, Fain and Houde 2004, Ericson et al. 2006) have shown that the New World vultures are not closely related to the storks, although their precise phylogenetic relationship to the Falconiformes is yet undetermined (AOU 2007).

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!