Articles on this page are available in 1 other language: Spanish (10) (learn more)

Overview

Brief Summary

Biology

Active during the day, the turkey vulture is commonly encountered perched, with wings outstretched in the morning sun. The reason for this behaviour is not entirely clear, but it may be to dry out the feathers, prior to taking to the air (3). Once aloft, this species is a graceful flyer, often gliding close to the ground, with wings angled upwards forming a slight V-shape (3) (4). The turkey vulture feeds almost exclusively on carrion and, unlike most birds, has a highly developed sense of smell, which it uses to locate carcasses, even under a cover of vegetation. This ability means that the turkey vulture is often the first scavenger to arrive at a carcass, allowing it to feed before the arrival of larger birds of prey, which drive this species away (2) (5). In response to its diet of rotting meat, the turkey vulture has evolved a remarkably high tolerance for microbial toxins, and plays an important ecological role in disposing of carcasses that could otherwise breed disease (5). Unlike some larger vultures, the turkey vulture very rarely kills, and only tackles sick or injured animals, nestlings and insects (2) (5). The turkey vulture's breeding season varies according to location, with populations in temperate parts of North America laying eggs between May and June, while populations in Central America lay between February and April (2). Breeding in tropical parts of South America is less well known (2), although egg-laying has been recorded between August and January in Chile (5). Turkey vultures do not provide nesting material, and simply lay a clutch of two eggs directly on the ground in shallow caves or under dense undergrowth, or alternatively in a hollow tree stump or log. After 38 to 41 days of incubation, the eggs hatch, and the young are brooded for a further 70 to 80 days before fledging (2). Although turkey vulture populations in Central and South America generally remain in a single location throughout the year, North American subspecies make lengthy migrations. During the period between September and November, loose flocks of tens of thousands of birds form, which fly south to South America, sometimes as far as Paraguay, to spend the winter (2) (5).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 1 person

Average rating: 3.0 of 5

Cathartes aura

A large (26-32 inches) dark raptor, the Turkey Vulture is most easily identified by its dark brown body, featherless red head, and huge wingspan. This species may be separated from the related Black Vulture (Coragyps atratus) by that species’ smaller size, gray head, and shorter tail. Male and female Turkey Vultures are similar to one another in all seasons. The Turkey Vulture breeds across much of the United States (patchily distributed in the Great Plains) and southern Canada south to southern South America. Populations breeding on northern and interior portions of this range migrate south to the southern half of the U.S. for the winter. Populations breeding in the southeastern U.S., California, and the tropics are generally non-migratory. Turkey Vultures typically breed and roost in dense woodland while feeding in more open habitats, such as grasslands, meadows, and fields. In some areas, Turkey Vultures also utilize man-made structures, such as abandoned buildings and utility poles. This species feeds almost exclusively on carrion, rarely killing prey itself. Due to this species’ need to scavenge for food, Turkey Vultures are most easily observed soaring high above the ground in search of carrion. Scientists have discovered that this species possesses a more developed sense of smell than the Black Vulture, and that Black Vultures often wait for Turkey Vultures to find food before driving them off and taking the carcass for themselves. This species is primarily active during the day.

Threat Status: Least Concern

  • Cathartes aura. Xeno-canto. Xeno-canto Foundation, n.d. Web. 20 July 2012. .
  • Turkey Vulture (Cathartes aura). The Internet Bird Collection. Lynx Edicions, n.d. Web. 20 July 2012. .
  • eBird Range Map - Turkey Vulture. eBird. Cornell Lab of Ornithology, N.d. Web. 20 July 2012. .
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Smithsonian Institution

Supplier: DC Birds

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Description

With a bright, pinkish-red head, brownish-black plumage and a two metre wingspan, the turkey vulture is a highly distinctive bird of prey (2). The head is almost entirely bald, except for some sparse black bristles, and often bears a number of whitish warts. The reddish colouration, which contrasts strongly with the whitish beak, develops as individuals mature, with juvenile birds initially possessing dark grey skin on the head, covered thinly by short downy feathers (2) (3). There are currently six recognised subspecies of turkey vulture (3), which can be distinguished by location, size and intensity of head colouration (2) (3).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Distribution

Turkey vultures range as far north as the southern border of Canada and as far south as Tierra del Fuego, Chile. Over the past few decades, they have been expanding their geographic range northward. This expansion may be a result of laws and restrictions on hunting this species.

Biogeographic Regions: nearctic (Native ); neotropical (Native )

  • Wallace, M. 2004. New World vultures. Pp. 275-285 in M Hutchins, D Thoney, M McDade, eds. Grzimek's Animal Life Encyclopedia, Vol. 8, 2 Edition. Detroit: Gale.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

National Distribution

Canada

Origin: Native

Regularity: Regularly occurring

Currently: Present

Confidence: Confident

Type of Residency: Breeding

United States

Origin: Native

Regularity: Regularly occurring

Currently: Present

Confidence: Confident

Type of Residency: Year-round

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Global Range: (>2,500,000 square km (greater than 1,000,000 square miles)) BREEDS: southern British Columbia to southern Manitoba and New England, south through U.S. and Middle America to South America and Greater Antilles (introduced in Puerto Rico). Recently has expanded range in the northeastern U.S. and southeastern Canada. NORTHERN WINTER: mainly from northern California, Arizona, Nebraska, Ohio Valley, and Maryland south. Winter concentrations occur Texas, Florida, and along the Wabash River in Indiana (Root 1988).

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Geographic Range

Turkey vultures range as far north as the southern border of Canada and as far south as the southernmost part of South America. Over the past few decades, they have been expanding their range northward.

Biogeographic Regions: nearctic (Native ); neotropical (Native )

  • Wallace, M. 2004. New World vultures. Pp. 275-285 in M Hutchins, D Thoney, M McDade, eds. Grzimek's Animal Life Encyclopedia, Vol. 8, 2 Edition. Detroit: Gale.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: BioKIDS Critter Catalog

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Range

The turkey vulture has an extremely expansive range, with the nominate subspecies Cathartes aura aura being found in south-western North America, south to Costa Rica and the Greater Antilles (3). An introduced population also occurs in Puerto Rico (2). Cathartes aura septentrionalis occupies eastern and south-eastern North America, while Cathartes aura meridionalis inhabits southern Canada and northern and central USA (3). Cathartes aura ruficollis is found in southern Central America and lowland South America east of Andes (3), as well as in Trinidad (2). Cathartes aura jota occupies the slopes and valleys of the Andes from Colombia to Patagonia, while Cathartes aura falklandicus is foundfrom Ecuador, south through the western Andes to Tierra del Fuego and the Falklands (3).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Physical Description

Morphology

There are six subspecies of turkey vultures: three in North America and three in South and Central America. Cathartes aura septentrionalis is found in the eastern United States and west into Minnesota, Kansas, Oklahoma, and eastern Texas. Cathartes aura meridionalis is located mainly west of C. a. septentrionalis and into Baja California, excluding the lower Colorado River valley. Cathartes aura aura is found in the lower Colorado River valley, including most of Arizona, and in southern New Mexico and Texas. Cathartes aura ruficollis is found from Costa Rica south to northern Argentina and east of the Andes, Cathartes aura jota is found in the highlands of southern Colombia through Argentina, and Cathartes aura falklandica is found west of the Andes from Ecuador and Peru through Chile and on the Falkland Islands.

Depending on the subspecies, turkey vultures vary from 0.85 to 2 kg and can have a total length between 64 and 81 cm. Sexes do not differ, all have a brownish black plumage with a bare head and neck. The head and neck skin color can vary from pink to bright red. Turkey vultures are commonly mistaken for black vultures. However, they can be distinguished by their grey primary and secondary feathers and their black head and neck color.

Based on their wing surface to weight ratio, turkey vultures have light wing loading. This makes them more buoyant in air than other vultures and better able to utilize thermals to help them stay in flight with minimal energy usage.

Range mass: 0.85 to 2.00 kg.

Range length: 64 to 81 cm.

Range wingspan: 170 to 183 cm.

Other Physical Features: endothermic ; homoiothermic; bilateral symmetry

Sexual Dimorphism: sexes alike

  • Palmer, R. 1988. Handbook of North American Birds, Volume 4. New Haven and London: Yale University Press.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Physical Description

Turkey vultures vary from 0.85 to 2 kg and can have a total length between 64 and 81 cm. Sexes do not differ, all have a brownish black plumage with a bare head and neck. The skin color on their head and neck can vary from pink to bright red. Turkey vultures are commonly mistaken for black vultures <>. However, black vultures have grey primary and secondary feathers and black heads and necks. Turkey vultures have long, broad wings that help them to soar for long times and not use too much energy in flapping flight.

Range mass: 0.85 to 2.00 kg.

Range length: 64 to 81 cm.

Range wingspan: 170 to 183 cm.

Other Physical Features: endothermic ; homoiothermic; bilateral symmetry

Sexual Dimorphism: sexes alike

  • Palmer, R. 1988. Handbook of North American Birds, Volume 4. New Haven and London: Yale University Press.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: BioKIDS Critter Catalog

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Size

Length: 69 cm

Weight: 1467 grams

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Ecology

Habitat

Habitat and Ecology

Systems
  • Terrestrial
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Turkey vultures occupy a diverse range of habitats. They are found in forested as well as open environments. Turkey vultures can be found anywhere they can effectively find a carrion food supply. They are easily habituated to humans and human development.

Habitat Regions: temperate ; tropical ; terrestrial

Terrestrial Biomes: tundra ; desert or dune ; savanna or grassland ; chaparral ; forest ; scrub forest ; mountains

Other Habitat Features: urban ; suburban ; agricultural ; riparian ; estuarine

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Comments: Forested and open situations, more commonly in the latter, from lowlands to mountains (AOU 1983). May roost in large flocks at night in trees; roosts often near or over water. In Pennsylvania, selected large conifers for mid-winter roost (Wright et al. 1986).

Eggs are laid in caves (especially in West); on cliffs; in hollow logs, trees, or stumps (tree-cavity nesting formerly more common); on ground in dense shrubbery (especially in eastern U.S.); sometimes in/under abandoned building in woods (Jackson 1983, Palmer 1988); sometimes in abandoned hawk nest (Hilty and Brown 1986). In Pennsylvania/Maryland, nested in areas that were roadless, forested, and undeveloped (Coleman and Fraser 1989).

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Turkey vultures occupy a wide variety of habitats. They are found in forested as well as open environments. Turkey vultures can be found anywhere they can find their carrion food supply.

Habitat Regions: temperate ; tropical ; terrestrial

Terrestrial Biomes: tundra ; desert or dune ; savanna or grassland ; chaparral ; forest ; scrub forest ; mountains

Other Habitat Features: urban ; suburban ; agricultural ; riparian ; estuarine

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: BioKIDS Critter Catalog

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

In accordance with the turkey vulture's extensive range, its habitat preferences are extremely broad. Populations are found in coastal deserts, grassland, savanna, temperate forest, and even dense tropical rainforest (2) (3).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Migration

Non-Migrant: Yes. At least some populations of this species do not make significant seasonal migrations. Juvenile dispersal is not considered a migration.

Locally Migrant: Yes. At least some populations of this species make local extended movements (generally less than 200 km) at particular times of the year (e.g., to breeding or wintering grounds, to hibernation sites).

Locally Migrant: Yes. At least some populations of this species make annual migrations of over 200 km.

Generally arrives in northernmost breeding areas in March-April, departs September-November (Bent 1937). Large numbers pass through Panama late February-early April and October-November (Ridgely and Gwynne 1989). Migrants and residents coexist in Panama from Novemnber to April (Smith 1980). Large migratory flocks pass through Costa Rica, mainly over Caribbean lowlands, in both fall (September-October) and spring (late January to mid-May (Stiles and Skutch 1989). Generally avoids crossing wide expanses of water. Has been described as nomadic, rather than migratory, in North America.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Trophic Strategy

Turkey vulture diets vary depending on their habitat. Vultures living around agriculture feed mainly on the carrion of domestic animals, mostly livestock. They also rely heavily on roadkill in areas of human development. A study in South Carolina found that in non-agricultural areas, their primary source of food was wild carrion. Turkey vultures preferentially feed on smaller carcasses, but will feed on dead animals of any size. They prefer freshly dead carcasses but cannot get through the thick skin of larger animals, so must wait for some decay to enable entering body cavities. To find their food they rely on their keen sense of smell and vision. They are one of the few bird species that has an acute sense of smell. In some cases, turkey vultures have been seen eating rotten fruits and vegetables and occasionally they prey on insects, reptiles, or bird nestlings. Turkey vultures have also been observed eating coyote and domestic animal dung.

Animal Foods: birds; reptiles; carrion ; insects

Other Foods: dung

Primary Diet: carnivore (Scavenger )

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Comments: Eats mainly vertebrate carrion (domestic animals and wild sources, down to the size of small amphibians; often small mammals); prefers fresh meat. Sometimes eats ripe or rotten fruits. Sometimes kills small animals. Locates food visually and/or by odor. Can survive for over two weeks without food.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Food Habits

Turkey vultures eat mainly carrion, they are scavengers. Very rarely turkey vultures will kill and eat small animals, such as insects, lizards, or bird nestlings. Near humans they rely heavily on roadkill or dead domesticated animals. In areas with fewer humans they eat wild carrion.

Animal Foods: birds; reptiles; carrion ; insects

Other Foods: dung

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: BioKIDS Critter Catalog

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Associations

Because turkey vultures are major consumer of carrion, they play an important role in biodegradation.

Black vultures follow turkey vultures to carcasses and then aggressively out-compete them at the carcass.

There are multiple parasitic bacteria that have been associated with turkey vultures. In a study in Texas, two ectoparasites from families Cimididae and Hippoboscidae were found to be on some turkey vultures. Another study at the University of California showed that turkey vultures are capable of contracting Chlamydiosis. This was observed in a captive subject at a raptor rehabilitation center in California in 1983.

Ecosystem Impact: biodegradation

Commensal/Parasitic Species:

  • black vultures (Coragyps atratus)
  • Haematosiphon inodorus
  • Olfersia bisulcata
  • Chlamydia psittaci

  • Fowler, M., T. Schulz, A. Ardans, B. Reynolds, D. Behymer. 1990. Chlamydiosis in Captive Raptors. Avian Diseases, 34(3): 657-662.
  • Wilson, N., G. Oliver, Jr.. 1978. Noteworthy Records of Two Ectoparasites (Cimididae and Hippoboscidae) from the Turkey Vulture in Texas. The Southwestern Naturalist, 23(2): 305-307.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Turkey vulture chicks and eggs are preyed on by mammalian nest predators, such as raccoons. Young and adults are sometimes preyed on by owls. Although turkey vultures have few natural predators, they are known for their defense mechanism of regurgitating semi-digested meat--which deters most predators due to its putrid smell.

Most documented mortality of turkey vultures is caused by human interactions, including collisions with vehicles and structures and entrapment in fencing and leg-hold traps. Problems caused by black vultures are sometimes blamed on turkey vultures by association. Humans sometimes destroy turkey vultures and their roosts.

In 1994 there was an observation at Isla Espiritu Santo, Baja California, Mexico, of yellow-footed gulls (Larus livens) attacking a turkey vulture that had flown near their breeding colony.

Known Predators:

  • humans (Homo sapiens)
  • great horned owls (Bubo virginianus)
  • raccoons (Procyon lotor)

  • Lowney, M. 1999. Damage by black and turkey vultures in Virginia, 1990-1996. Wildlife Society Bullein: Vol. 2, 27(3): 715-719.
  • Rodríguez-Estrella, R., J. Donázar, F. Hiraldo. 1995. Yellow-Footed Gulls Attack Turkey Vultures on Isla Espiritu Santo, Baja California, Mexico. Colonial Waterbirds, 18(1): 100-101.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Ecosystem Roles

Turkey vultures are scavengers. They are important in ecosystems because they eat dead animals; they are part of natural recycling of nutrients in ecosystems.

Ecosystem Impact: biodegradation

Commensal/Parasitic Species:

  • black vultures (Coragyps_atratus)
  • Haematosiphon_inodorus
  • Olfersia_bisulcata
  • Chlamydia_psittaci

  • Fowler, M., T. Schulz, A. Ardans, B. Reynolds, D. Behymer. 1990. Chlamydiosis in Captive Raptors. Avian Diseases, 34(3): 657-662.
  • Wilson, N., G. Oliver, Jr.. 1978. Noteworthy Records of Two Ectoparasites (Cimididae and Hippoboscidae) from the Turkey Vulture in Texas. The Southwestern Naturalist, 23(2): 305-307.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: BioKIDS Critter Catalog

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Predation

Most turkey vultures die as a result of being hit by cars, flying into power lines or other structures, or getting caught in fences or leg-hold traps. Eggs and chicks are sometimes eaten by nest predators such as raccoons. Large owls prey on young and adult birds. Turkey vultures escape a lot of predation by being large birds. They also tend to spend a lot of time soaring in the air, where no predators can reach them. When harassed they will regurgitate their stomach contents of rotten meat, which is usually enough to deter predators because of its putrid smell.

Known Predators:

  • humans (Homo_sapiens)
  • great horned owls (Bubo_virginianus)
  • raccoons (Procyon_lotor)

  • Lowney, M. 1999. Damage by black and turkey vultures in Virginia, 1990-1996. Wildlife Society Bullein: Vol. 2, 27(3): 715-719.
  • Rodríguez-Estrella, R., J. Donázar, F. Hiraldo. 1995. Yellow-Footed Gulls Attack Turkey Vultures on Isla Espiritu Santo, Baja California, Mexico. Colonial Waterbirds, 18(1): 100-101.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: BioKIDS Critter Catalog

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Known prey organisms

Cathartes aura preys on:
carcass
Egretta tricolor

Based on studies in:
USA: Arizona, Sonora Desert (Desert or dune)
USA: New Mexico, Aden Crater (Carrion substrate)

This list may not be complete but is based on published studies.
  • M. McKinnerney, 1977. Carrion communities in the northern Chihuahuan Desert. M.S. thesis. University of Texas-El Paso, Texas; and 1978, Carrion communities in the northern Chihuahuan Desert. Southw. Nat. 23:563-576, from thesis and p. 571.
  • Myers, P., R. Espinosa, C. S. Parr, T. Jones, G. S. Hammond, and T. A. Dewey. 2006. The Animal Diversity Web (online). Accessed February 16, 2011 at http://animaldiversity.org. http://www.animaldiversity.org
  • P. G. Howes, The Giant Cactus Forest and Its World: A Brief Biology of the Giant Cactus Forest of Our American Southwest (Duell, Sloan, and Pearce, New York; Little, Brown, Boston; 1954), from pp. 222-239, from p. 227.
Creative Commons Attribution 3.0 (CC BY 3.0)

© SPIRE project

Source: SPIRE

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Population Biology

Global Abundance

>1,000,000 individuals

Comments: Estimated number of breeding pairs in Canada was 5000-20,000 in the early 1990s (Kirk et al. 1995).

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

General Ecology

Roosts singly or in groups. Average distance between communal roost and feeding site was 8 km in Maryland/Pennsylvania (Coleman and Fraser 1987). Mean summer range of two known breeders was 6942 hectares; 90% of locations were within 10 kilometers of roost (Kirk and Mossman 1998). Roosts may be temporary (at a food source), seasonal (spring-fall), or permanent (peak numbers in early winter) (Palmer 1988). Human disturbance and canid predation may be significant causes of nest failure in the eastern U.S. (Coleman and Fraser 1989).

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Life History and Behavior

Behavior

Like most vultures, turkey vultures lack complexity in vocalizations. Most vocalizations are grunts, hisses, and barking sounds, used mainly for predator deterrence. Visual cues are used in mating rituals and may be used in other forms of communication.

Turkey vultures have a well-developed sense of smell and are one of the only species of birds worldwide that uses smell extensively. They use their keen sense of smell and their vision to locate carcasses. Black vultures take advantage of this, following turkey vultures to carcasses and then excluding them.

Communication Channels: visual ; acoustic

Perception Channels: visual ; tactile ; acoustic ; chemical

  • Stevenson, H., B. Anderson. 1994. Birdlife of Florida. Florida: Gainesville University Press.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Communication and Perception

Like most vultures, turkey vultures have simple calls, such as grunts, hisses, and barking sounds, used mainly to deter predators. They use their vision also to communicate with other turkey vultures.  Turkey vultures have a well-developed sense of smell and are one of the only species of birds worldwide that uses smell. They use their keen sense of smell and their vision to locate carcasses. Black vultures take advantage of this, following turkey vultures to carcasses and then excluding them.

Communication Channels: visual ; acoustic

  • Stevenson, H., B. Anderson. 1994. Birdlife of Florida. Florida: Gainesville University Press.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: BioKIDS Critter Catalog

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Cyclicity

Comments: In one study, most left roost 3.5-5 hours after sunrise. May remain at roost up to 2 or more days during rainy weather. (Palmer 1988).

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Life Expectancy

There is little recorded information on the lifespan of turkey vultures. A banded individual lived up to 16 years and 10 months. One study demonstrated that up to one-fifth of all adult turkey vultures die each year.

Range lifespan

Status: wild:
17 (high) years.

Average lifespan

Status: wild:
10 years.

Average lifespan

Status: wild:
202 months.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Lifespan/Longevity

There is not much known about how long turkey vultures live, although one wild turkey vulture lived more than 16 years.

Range lifespan

Status: wild:
17 (high) years.

Average lifespan

Status: wild:
10 years.

Average lifespan

Status: wild:
202 months.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: BioKIDS Critter Catalog

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Lifespan, longevity, and ageing

Maximum longevity: 20.8 years
Creative Commons Attribution 3.0 (CC BY 3.0)

© Joao Pedro de Magalhaes

Source: AnAge

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Reproduction

To start the mating ritual, several birds gather on the ground and begin hopping around in a circle with wings partially spread. In flight a bird might closely follow a potential mate while continuing a ritual of flapping and diving.

Adult mated pairs spend much more time with one another than with other vultures. Mating-pair bonds last throughout the breeding season and often all year long.

Mating System: monogamous

Breeding takes place from March to June in North America. Nest sites are usually found in sheltered areas such as hollow trees or logs, crevices in cliffs, or in old buildings. Little or no nest is actually built in these sites. Their eggs are laid on debris or the flat bottom of the nest site. Eggs are off-white and marked with brown and lavender. Incubation time is typically 30 to 40 days. Young reach the fledging stage at 70 to 80 days old and are independent about a week later.

Breeding interval: Turkey vultures breed once yearly.

Breeding season: Breeding occurs from March to June in North America.

Range eggs per season: 1 to 3.

Range time to hatching: 30 to 40 days.

Range fledging age: 70 to 80 days.

Range time to independence: 80 to 90 days.

Key Reproductive Features: iteroparous ; seasonal breeding ; gonochoric/gonochoristic/dioecious (sexes separate); sexual ; oviparous

Average eggs per season: 2.

Turkey vulture chicks are altricial. Adults care for them for 70 to 80 days by regurgitating well-digested food several times daily and providing some protection. Both adults care fr the young. If adults are threatened when nesting, they might flee, regurgitate on the intruder, or play dead.

Parental Investment: altricial ; pre-fertilization (Provisioning, Protecting: Female); pre-hatching/birth (Provisioning: Female, Protecting: Male, Female); pre-weaning/fledging (Provisioning: Male, Female, Protecting: Male, Female); pre-independence (Provisioning: Male, Female, Protecting: Male, Female)

  • Fergus, C. 2003. Wildlife of Virginia and Maryland. Mechanicsburg, PA: Stackpole Books.
  • Kaufman, K. 1996. Lives of North American Birds. New York, NY: Houghton Mifflin Field Guides.
  • Rabenold, P. 1986. Family Associations in Communally Roosting Black Vultures. The Auk, 103(1): 32-41.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Clutch size is usually 2. Incubation lasts 5-6 weeks, by both sexes. Young first fly at about 9 weeks. Family may stay together several months after young fledge. Does not renest if clutch is lost.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Turkey vultures gather on the ground and begin hopping around in a circle with wings partially spread in order to attract mates. Males and females often mate for life or at least for many years, and often stay together throughout the year.

Mating System: monogamous

Turkey vultures breed from March to June in North America. Nests are lined with debris and are found in hollow trees or logs, crevices in cliffs, or in old buildings. Eggs are off-white and marked with brown and lavender. Young turkey vultures hatch in 30 to 40 days and then take another 9 to 10 weeks to learn how to fly. They are are independent about a week later.

Breeding interval: Turkey vultures breed once yearly.

Breeding season: Breeding occurs from March to June in North America.

Range eggs per season: 1 to 3.

Range time to hatching: 30 to 40 days.

Range fledging age: 70 to 80 days.

Range time to independence: 80 to 90 days.

Key Reproductive Features: seasonal breeding ; gonochoric/gonochoristic/dioecious (sexes separate)

Average eggs per season: 2.

Turkey vulture chicks are helpless at hatching. Both parents regurgitate food for their young several times a day until they are 70 to 80 days old, when they learn to fly.

Parental Investment: altricial ; pre-fertilization (Provisioning, Protecting: Female); pre-hatching/birth (Provisioning: Female, Protecting: Male, Female); pre-weaning/fledging (Provisioning: Male, Female, Protecting: Male, Female); pre-independence (Provisioning: Male, Female, Protecting: Male, Female)

  • Fergus, C. 2003. Wildlife of Virginia and Maryland. Mechanicsburg, PA: Stackpole Books.
  • Kaufman, K. 1996. Lives of North American Birds. New York, NY: Houghton Mifflin Field Guides.
  • Rabenold, P. 1986. Family Associations in Communally Roosting Black Vultures. The Auk, 103(1): 32-41.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: BioKIDS Critter Catalog

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Barcode data: Cathartes aura

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There are 7 barcode sequences available from BOLD and GenBank.

Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.

See the BOLD taxonomy browser for more complete information about this specimen and other sequences.

AATCGATGACTATTCTCAACCAACCACAAAGACATCGGTACCTTATACTTAATTTTCGGCGCATGAGCTGGCATAGCCGGTACTGCCCTTAGTCTGCTAATTCGGGCAGAGCTCGGACAACCCGGAACCCTCTTAGGAGAT---GACCAAATCTATAACGTAATTGTCACTGCCCATGCCTTCGTGATAATTTTCTTCATAGTAATACCCATCATAATTGGAGGATTTGGAAACTGATTAGTCCCACTTATAATCGGCGCCCCCGATATAGCATTTCCACGAATAAACAACATAAGCTTCTGACTACTTCCCCCATCCTTCCTACTCCTACTAGCCTCTTCTACAGTAGAAGCTGGGGCGGGCACAGGATGAACTGTATACCCCCCACTAGCTGGCAACCTTGCCCATGCTGGGGCATCGGTAGACCTAGCTATTTTCTCCCTTCACCTAGCTGGAGTATCGTCCATCTTAGGTGCAATCAACTTTATTACAACCGCTATCAACATAAAACCCCCAGCCCTCTCACAGTACCAAACCCCCCTATTCGTATGATCCGTCCTCATCACCGCAGTACTACTACTCCTCTCACTTCCAGTCCTTGCTGCTGGAATCACTATGCTACTAACAGACCGAAACTTAAACACCACATTCTTTGACCCTGCTGGAGGAGGCGATCCGGTCCTATATCAACACCTCTTCTGATTCTTCGGCCACCCAGAAGTCTATATCCTGATTCTACCAGGCTTTGGAATCATCTCACACGTAGTAACATATTATGCTGGCAAAAAAGAACCATTCGGTTACATGGGAATAGTATGGGCCATGCTATCCATCGGATTCCTAGGCTTTATCGTATGAGCTCACCACATGTTTACAGTAGGAATAGATGTAGACACCCGAG
-- end --

Download FASTA File

Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Statistics of barcoding coverage: Cathartes aura

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 8
Specimens with Barcodes: 13
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Conservation

Conservation Status

IUCN Red List Assessment


Red List Category
LC
Least Concern

Red List Criteria

Version
3.1

Year Assessed
2012

Assessor/s
BirdLife International

Reviewer/s
Butchart, S. & Symes, A.

Contributor/s

Justification
This species has an extremely large range, and hence does not approach the thresholds for Vulnerable under the range size criterion (Extent of Occurrence <20,000 km2 combined with a declining or fluctuating range size, habitat extent/quality, or population size and a small number of locations or severe fragmentation). The population trend appears to be stable, and hence the species does not approach the thresholds for Vulnerable under the population trend criterion (>30% decline over ten years or three generations). The population size is extremely large, and hence does not approach the thresholds for Vulnerable under the population size criterion (<10,000 mature individuals with a continuing decline estimated to be >10% in ten years or three generations, or with a specified population structure). For these reasons the species is evaluated as Least Concern.

History
  • Least Concern (LC)
  • Least Concern (LC)
  • Least Concern (LC)
  • Lower Risk/least concern (LR/lc)
  • Lower Risk/least concern (LR/lc)
  • Lower Risk/least concern (LR/lc)
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5