Articles on this page are available in 1 other language: Chinese (Simplified) (7) (learn more)

Overview

Distribution

Range

SW and e Australia and New Guinea.
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

 

Partner Web Site: Cornell Laboratory of Ornithology

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Ecology

Habitat

Habitat and Ecology

Habitat and Ecology
Behaviour Palearctic populations of this species undergo extensive post-breeding dispersal movements in all directions and are also fully migratory, travelling southward on a broad front1 between August and October and returning to the north from March to April2. Other populations (e.g. in the tropics) are resident but may make partial migratory movements connected with fluctuations in water-level1. In the western Palearctic and India the species breeds mainly between May and July, breeding from October to January in Australia, June to February in South Africa, or in relation to the rains in tropical Africa1. It breeds singly or occasionally in small loose groups in favourable areas1 (e.g. 2-3 nests were spaced 50 m apart at the same pond, Africa)3. When not breeding the species may be found singly, in pairs (Africa)3, in small flocks of 5-15 individuals5 (e.g. on migration)1, or roosting in groups of 30 individuals (Africa)3. In most areas it is mainly a crepuscular feeder1, 2 although it may be diurnal in some regions (e.g. South Africa)2. Habitat The species is most common in freshwater marshes with beds of bulrushes Typha spp., reeds Phragmites spp.4 or other dense aquatic vegetation, preferably also with deciduous bushes and trees1 such as willow Salix spp. or alder Alnus spp.1, 2. It may also occupy the margins of lakes, pools and reservoirs1, wooded and marshy banks of streams and rivers2, desert oases, peat bogs1, wooded swamps, wet grasslands, rice-fields1, rank vegetation around sewage ponds4, and in places mangroves, the margins of saline lagoons1 and saltmarshes2. Diet Its diet varies with region and season1 but it is essentially insectivorous and takes aquatic adult and larval insects such as crickets, grasshoppers, caterpillars1 and beetles2. Other food items include spiders, molluscs, crustaceans1 (e.g. shrimp and crayfish)2, fish, frogs, tadpoles, small reptiles and birds1. Breeding site The nest is constructed from reeds and twigs1 and is normally placed near open poolsin thick emergent vegetation2 (such as beds of bulrushes Typha spp. or reeds Phragmites spp.)4 close to the surface of the water or up to 60 cm above it5. Alternatively nests may be placed in low bushes or trees (e.g. alder Alnus spp. or willow Salix spp.) up to 2 m above water1, 2. Preferred nesting sites are usually 5-15 m out from the shore in water 20-30 cm deep5. The species usually nests singly but may nest in loose colonies in favourable habitats with neighbouring nests as close as 5 m apart (solitary nests are usually 30-100 m apart)2. Nests are often reused in consecutive years2.

Systems
  • Terrestrial
  • Freshwater
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Associations

In Great Britain and/or Ireland:
Animal / parasite / ectoparasite
imago of Icosta ardeae ectoparasitises Ixobrychus minutus

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Life History and Behavior

Life Expectancy

Lifespan, longevity, and ageing

Maximum longevity: 6 years (wild)
Creative Commons Attribution 3.0 (CC BY 3.0)

© Joao Pedro de Magalhaes

Source: AnAge

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Barcode data: Ixobrychus minutus

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There is 1 barcode sequence available from BOLD and GenBank.   Below is the sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.  See the BOLD taxonomy browser for more complete information about this specimen.  Other sequences that do not yet meet barcode criteria may also be available.

CCTATACTTAATCTTCGGAGCATGAGCTGGCATAATCGGAACCGCCCTAAGCCTACTCATCCGAGCCGAACTTGGCCAACCAGGAACACTTCTAGGAGATGACCAAATTTACAACGTTATTGTCACTGCTCATGCCTTCGTAATAATTTTCTTCATAGTAATACCAATTATAATCGGCGGATTCGGAAACTGATTAGTCCCCCTCATAATTGGTGCCCCCGACATAGCATTCCCACGCATAAACAACATAAGCTTCTGACTACTACCACCATCATTCATGCTTTTACTAGCCTCATCAACAGTTGAAGCAGGAGCAGGTACAGGTTGAACAGTATATCCCCCACTAGCTGGTAACCTAGCCCATGCCGGAGCCTCAGTAGACTTAGCCATTTTTTCCCTACACCTAGCAGGTGTATCCTCCATCCTAGGGGCAATCAACTTCATTACAACTGCCATCAACATAAAACCTCCAACTCTATCACAATACCAAACCCCCCTATTCGTCTGATCCGTCTTAATTACCGCCGTTCTACTCCTACTCTCACTCCCAGTTCTTGCTGCAGGTATCACAATACTCCTTACAGATCGAAACCTAAACACCACATTCTTTGACCCCGCTGGAGGAGGAGACCCAGTCCTCTACCAGCACCTATTTTGATTCTTTGGACACCCAGAAGTCTACATCCTTATCCTC
-- end --

Download FASTA File
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Statistics of barcoding coverage: Ixobrychus minutus

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 2
Specimens with Barcodes: 6
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Conservation

Conservation Status

IUCN Red List Assessment


Red List Category
LC
Least Concern

Red List Criteria

Version
3.1

Year Assessed
2009

Assessor/s
BirdLife International

Reviewer/s
Bird, J., Butchart, S.

Contributor/s

Justification
This species has an extremely large range, and hence does not approach the thresholds for Vulnerable under the range size criterion (Extent of Occurrence <20,000 km2 combined with a declining or fluctuating range size, habitat extent/quality, or population size and a small number of locations or severe fragmentation). Despite the fact that the population trend appears to be decreasing, the decline is not believed to be sufficiently rapid to approach the thresholds for Vulnerable under the population trend criterion (>30% decline over ten years or three generations). The population size is very large, and hence does not approach the thresholds for Vulnerable under the population size criterion (<10,000 mature individuals with a continuing decline estimated to be >10% in ten years or three generations, or with a specified population structure). For these reasons the species is evaluated as Least Concern.

History
  • 2008
    Least Concern
  • 2004
    Least Concern
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Status in Egypt

Resident breeder, regular passage visitor and winter visitor.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Bibliotheca Alexandrina

Source: Bibliotheca Alexandrina - EOL Ar

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Threats

Major Threats
The species is threatened by habitat degradation and loss6 through direct destruction, pollution1 and hydrological changes (e.g. in rivers)2. The species also suffers mortality as a result of drought and desertification on African staging and wintering grounds (degrades wetland habitats needed by the species)6.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Wikipedia

Black-backed Bittern

The Black-backed Bittern (Ixobrychus dubius), also known as the Black-backed Least Bittern or Australian Little Bittern, is a little-known species of heron in the Ardeidae family found in Australia and southern New Guinea. Formerly lumped with the Little Bittern, it is one of the smallest herons in the world.

Contents

Taxonomy

The bittern has sometimes been regarded as a subspecies of the Little Bittern (Ixobrychus minutus), or of the New Zealand Little Bittern (Ixobrychus novaezelandiae). However, molecular evidence has shown that it is more closely related to the Yellow Bittern (Ixobrychus sinensis) than to the African and Palaearctic forms of the Little Bittern and is now recognised as a full species.[1]

Description

This species measures from 25 to 36 cm (9.8 to 14 in),[2] has a total weight of 60–120 g (2.1–4.2 oz), averaging 84 g (3.0 oz).[3] This is a very small bittern and one of the smallest herons in the world. The adult male has largely black upperparts, including a black cap, while the underparts, as well as the neck, breast and the sides of the head, are rich chestnut. There are large buff patches on the shoulders, conspicuous in flight. The female is duller, brown and streaked on back and crown; immature birds are similar. The irides are yellow, the bill is yellow with a black culmen, and the feet and legs greenish-yellow.[4]

Distribution and movements

Australia

In Australia the bittern is found in the south-east of the continent, with most records deriving from the Murray-Darling Basin, as well as patchily along the east coast, and in south-west Western Australia where it is locally common on the Swan Coastal Plain. There are some scattered records from elsewhere, including coastal locations in the Kimberley region, the Top End and the Torres Strait islands, with vagrants occasionally reaching Lord Howe Island and New Zealand.[5]

Apart from records of vagrants, circumstantial evidence that at least part of the population makes long-distance seasonal migrations is that most records, and the highest reporting rates, of the bitterns in southern Australia occur in spring and summer, with the birds largely absent in autumn and winter. There are few breeding records from the Australian tropics.[6][7][8]

New Guinea

In New Guinea the bittern is found seasonally in the reedbeds of the Waigani Swamp near Port Moresby from November to April, only being reliably recorded elsewhere on the island from the lowlands of the Trans-Fly region.[4] There are no firm breeding records from New Guinea, though a specimen taken in the middle Fly River lagoons was of a bird ready to lay, indicating breeding in the Fly River marshes in September.[9] The lack of good breeding records suggests that at least some birds in New Guinea are seasonal migrants from Australia.[10]

New Caledonia

The bittern was recorded from New Caledonia in 2001, where it bred.[11]

Habitat

The birds are mainly found in freshwater wetlands, where they inhabit dense emergent vegetation of reeds and sedges, and inundated shrub thickets. They are also occasionally found in brackish and saline wetlands such as mangrove swamps, Juncus-dominated salt marsh and the wooded margins of coastal lagoons.[12]

Behaviour

Black-backed Bitterns are solitary, secretive and seldom seen, mainly active at dusk or at night. They are skulkers of reedbeds, walking in a crouched posture with head extended forward, crossing patches of open ground rapidly, stalking their prey at the water’s edge. When alarmed they will assume the cryptic posture typical of many bitterns, standing still with the head and bill extended vertically upwards. Usually reluctant to fly, when flushed they will do so with retracted head and dangling legs, skimming low over the water and the wetland vegetation.[13]

Breeding

The bitterns breed in spring and early summer, nesting in single pairs, or occasionally in loose colonies with the nests 15–30 m apart, in dense wetland vegetation. The nest is a platform of reeds and other plant matter, about 15–20 cm across and 10 cm thick, supported by the vertical stems of growing reeds, always situated over water and where there is overhead cover. The clutch usually comprises 4-6 matt white eggs, with an incubation period of about 21 days. The chicks are covered with orange-buff down and are fed by regurgitation by both parents.[14] Young birds may start clambering in the reeds from 9–10 days old, taking their first flight when 25–30 days old, and remaining dependent on their parents for at least another 14 days.[14][15]

Feeding

The birds feed mainly on aquatic invertebrates such as crustaceans and dragonfly larvae, sometimes small vertebrates such as fish and frogs. They hunt by waiting for potential prey animals to come within range of their bills, or by active stalking.[16]

Voice

Vocalisations of the bittern are poorly known. Outside the breeding season the birds are usually silent, though they may utter a small range of low croaking or grunting sounds. During the breeding season the advertising call, a deep, low and monotonous croaking call, repeated at half-second intervals and said to be made only by the males, may be heard.[17]

Status and conservation

Black-backed Bitterns are listed as Near Threatened nationally in Australia, and as Endangered in Victoria. The global population has been estimated to comprise about 5000 mature individuals, mainly within Australia, including a sub-population of more than 1000 individuals in south-western Western Australia. Threats include various ongoing wetland degradation factors such as salinisation, drainage and the diversion of water for irrigation, as well as the destruction of nesting habitat by inappropriate burning regimes.[18]

References

Notes

  1. ^ Christidis & Boles (2008), p.108.
  2. ^ Marchant & Higgins (1991), p.1039.
  3. ^ Marchant & Higgins (1991), p.1044.
  4. ^ a b Coates (1985).
  5. ^ Marchant & Higgins (1991), pp.1040-1041.
  6. ^ Emison et al. (1987).
  7. ^ Blakers et al. (1984).
  8. ^ Barrett et al. (2003).
  9. ^ Rand & Gilliard (1967).
  10. ^ McKilligan (2005).
  11. ^ Barré & Bachy (2003).
  12. ^ Marchant & Higgins (1991), p.1040.
  13. ^ Marchant & Higgins (1991), pp.1039-1040.
  14. ^ a b Johnstone & Storr (1998).
  15. ^ Marchant & Higgins (1991), pp.1042-1043.
  16. ^ Marchant & Higgins (1991), p.1041.
  17. ^ Marchant & Higgins (1991), p.1042.
  18. ^ Garnett & Crowley (2000).

Cited texts

  • Barré, N.; & Bachy, P. (2003). "Complément à la liste commentée des oiseaux de Nouvelle-Calédonie". Alauda 71 (1): 31–39. 
  • Barrett, Geoff; Silcocks, Andrew; Barry, Simon; Cunningham, Ross; & Poulter, Rory (2003). The New Atlas of Australian Birds. Melbourne: Royal Australasian Ornithologists Union. p. 114. ISBN 1-875122-09-5. 
  • Blakers, M.; Davies, S.J.J.F.; & Reilly, P.N. (1984). The Atlas of Australian Birds. Melbourne: Melbourne University Press. p. 59. ISBN 0-522-84285-2. 
  • Christidis, Les; & Boles, Walter E. (2008). Systematics and Taxonomy of Australian Birds. Melbourne: CSIRO Publishing. ISBN 978-0-643-06511-6. 
  • Coates, Brian J. (1985). The Birds of Papua New Guinea. Volume I: Non-Passerines. Alderley, Queensland: Dove Publications. p. 84. ISBN 0-9590257-0-7. 
  • Emison, W.B.; Beardsell, C.M.; Norman, F.I.; Loyn, R.H.; & Bennett, S.C. (1987). Atlas of Victorian Birds. Melbourne: Dept of Conservation, Forest & Lands, Victoria; and Royal Australasian Ornithologists Union. p. 62. ISBN 0-7241-8387-6. 
  • Garnett, Stephen T.; & Crowley, Gabriel M. (2000). The Action Plan for Australian Birds 2000. Canberra: Environment Australia. pp. 178–179. ISBN 0-642-54683-5. 
  • Johnstone, R.E.; & Storr, G.M. (1998). Handbook of Western Australian Birds. Volume 1: Non-Passerines (Emu to Dollarbird). Perth: Western Australian Museum. p. 117. ISBN 0-7307-1208-7. 
  • Marchant, S.; & Higgins, P.J. (eds). (1991). Handbook of Australian, New Zealand and Antarctic Birds. Volume 1: Ratites to Ducks. Melbourne: Oxford University Press. pp. 1039–1045. ISBN 0-19-553244-9. 
  • McKilligan, Neil (2005). Herons, egrets and bitterns: their biology and conservation in Australia. Melbourne: CSIRO Publishing. pp. 115–116. ISBN 0-643-09133-5. 
  • Rand, Austin L.; & Gilliard, E. Thomas (1967). Handbook of New Guinea Birds. London: Weidenfeld & Nicolson. pp. 46–47. 
Creative Commons Attribution Share Alike 3.0 (CC BY-SA 3.0)

 

Source: Wikipedia

Unreviewed

Article rating from 0 people

Average rating: 2.5 of 5

Little Bittern

The Little Bittern (Ixobrychus minutus) is a wading bird in the heron family Ardeidae, native to the Old World, breeding in Africa, central and southern Europe, western and southern Asia, and Madagascar. Birds from temperate regions in Europe and western Asia are migratory, wintering in Africa and further south in Asia, while those nesting in the tropics are sedentary. It is rare north of its breeding range.[2]

Contents

Description

Immature

It is a very small bittern; measuring 25–36 cm (9.8–14 in) in length, 40–58 cm (16–23 in) across the wings and weighing 59–150 g (2.1–5.3 oz). It is among the smallest herons on earth. It has a short neck, longish bill and buff underparts. The male's back and crown are black, and the wings are black with a large white patch on each wing. The female has a browner back and a buff-brown wing patch.

Taxonomy

There are three subspecies:

  • Ixobrychus minutus minutus (Linnaeus, 1766). Europe, Asia, northern Africa; winters in sub-saharan Africa and southern Asia.
  • Ixobrychus minutus payesii (Hartlaub, 1858). Sub-saharan Africa, resident.
  • Ixobrychus minutus podiceps (Bonaparte, 1855). Madagascar, resident.

The Australian Little Bittern (Ixobrychus dubius) and the extinct New Zealand Little Bittern (Ixobrychus novaezelandiae) were formerly considered subspecies of the Little Bittern.[3]

Status

The Little Bittern is one of the species to which the Agreement on the Conservation of African-Eurasian Migratory Waterbirds (AEWA) applies.

Behaviour

The Little Bittern's breeding habitat is reedbeds. It nests on platforms of reeds in shrubs, and 4-8 eggs are laid. It can be difficult to see, given its skulking lifestyle and reedbed habitat.

These bitterns feed on fish, insects and amphibians.

References

  1. ^ BirdLife International (2012). "Ixobrychus minutus". IUCN Red List of Threatened Species. Version 2012.1. International Union for Conservation of Nature. Retrieved 5 July 2012. 
  2. ^ Rasmussen, Pamela C. and John C. Anderton (2005) Birds of South Asia. The Ripley Guide
  3. ^ Christidis, Les; Boles, Walter E. (2008). Systematics and Taxonomy of Australian Birds. CSIRO Publishing. ISBN 978-0-643-06511-6. 

Bibliography

Creative Commons Attribution Share Alike 3.0 (CC BY-SA 3.0)

 

Source: Wikipedia

Unreviewed

Article rating from 0 people

Average rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!