Articles on this page are available in 1 other language: Chinese (Simplified) (7) (learn more)

Overview

Comprehensive Description

Longueur 33-38 cm, envergure 52-58 cm, poids 140-150 g.

Il habite les marais d’eau douce de plaine ou les plans d’eau bordés de roseaux et autres plantes aquatiques émergentes. Les ceintures de saules ou d’aulnes sont également appréciées, l’espèce étant nettement arboricole. Elle fréquente par ailleurs les milieux artificiels tels que piscicultures, canaux, bassins ornementaux et plans d’eau de carrière, y compris parfois dans de grands parcs urbains.

Le Blongios se nourrit de poissons, d’amphibiens et d’insectes. Il chasse en solitaire et plutôt au crépuscule, immobile dans le couvert des roseaux ou avançant lentement sur les berges. L’espèce vit seule ou en couple, parfois en petits groupes lâches lors des migrations. Elle est monogame et le mâle établit son territoire au début de la reproduction. Les deux parents s’occupent des jeunes jusqu’à leur envol.

Le nid est un empilement dense de roseaux et de feuilles, d’une trentaine de centimètres de diamètre. Il est construit dans les roselières denses, les fourrés de saules ou les buissons. En roselière, il est normalement à quelques dizaines de centimètres de hauteur et au-dessus d’eaux d’une profondeur de 25–30 cm. La ponte unique de 5 ou 6 œufs (extrêmes : 4 à 9) est déposée à partir de la mi-mai. L’incubation dure 18 jours et les jeunes s’envolent vers l’âge de 1 mois.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Muséum national d'Histoire naturelle. Service du Patrimoine naturel

Source: Inventaire National du Patrimoine Naturel

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Distribution

Subspecies and Distribution:


    *minutus (Linnaeus, 1766) - C & S Europe and N Africa E to W Siberia and through Iran to NE India; winters Africa to India. *payesii (Hartlaub, 1858) - Africa S of Sahara.*podiceps (Bonaparte, 1855) - Madagascar. *novaezelandiae (Potts, 1871) - South I, New Zealand (probably extinct). *dubius Mathews, 1912 - SW & E Australia; S New Guinea.


Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© New Guinea Birds

Source: Birds of Papua New Guinea

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Physical Description

Size

27–36 cm length, 40–58 cm wingspan, 60-150 g weight

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© New Guinea Birds

Source: Birds of Papua New Guinea

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Diagnostic Description

The smallest specimens are perhaps the smallest herons on earth. It has a short neck, longish bill and buff underparts. The male's back and crown are black, and the wings are black with a large white patch on each wing. The female has a browner back and a buff-brown wing patch.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© New Guinea Birds

Source: Birds of Papua New Guinea

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Ecology

Habitat

Habitat and Ecology

Habitat and Ecology
Behaviour Palearctic populations of this species undergo extensive post-breeding dispersal movements in all directions and are also fully migratory, travelling southward on a broad front (del Hoyo et al. 1992) between August and October and returning to the north from March to April (Kushlan and Hancock 2005). Other populations (e.g. in the tropics) are resident but may make partial migratory movements connected with fluctuations in water-level (del Hoyo et al. 1992). In the western Palearctic and India the species breeds mainly between May and July, breeding from June to February in South Africa, or in relation to the rains in tropical Africa (del Hoyo et al. 1992). It breeds singly or occasionally in small loose groups in favourable areas (del Hoyo et al. 1992) (e.g. 2-3 nests were spaced 50 m apart at the same pond, Africa) (Brown et al. 1982). When not breeding the species may be found singly, in pairs (Africa) (Brown et al. 1982), in small flocks of 5-15 individuals (Snow and Perrins 1998) (e.g. on migration) (del Hoyo et al. 1992), or roosting in groups of 30 individuals (Africa) (Brown et al. 1982). In most areas it is mainly a crepuscular feeder (del Hoyo et al. 1992, Kushlan and Hancock 2005) although it may be diurnal in some regions (e.g. South Africa) (Kushlan and Hancock 2005). Habitat The species is most common in freshwater marshes with beds of bulrushes Typha spp., reeds Phragmites spp. (Hockey et al. 2005) or other dense aquatic vegetation, preferably also with deciduous bushes and trees (del Hoyo et al. 1992) such as willow Salix spp. or alder Alnus spp. (del Hoyo et al. 1992, Kushlan and Hancock 2005). It may also occupy the margins of lakes, pools and reservoirs (del Hoyo et al. 1992), wooded and marshy banks of streams and rivers (Kushlan and Hancock 2005), desert oases, peat bogs (del Hoyo et al. 1992), wooded swamps, wet grasslands, rice-fields (del Hoyo et al. 1992), rank vegetation around sewage ponds (Hockey et al. 2005), and in places mangroves, the margins of saline lagoons (del Hoyo et al. 1992) and saltmarshes (Kushlan and Hancock 2005). Diet Its diet varies with region and season (del Hoyo et al. 1992) but it is essentially insectivorous and takes aquatic adult and larval insects such as crickets, grasshoppers, caterpillars (del Hoyo et al. 1992) and beetles (Kushlan and Hancock 2005). Other food items include spiders, molluscs, crustaceans (del Hoyo et al. 1992) (e.g. shrimp and crayfish) (Kushlan and Hancock 2005), fish, frogs, tadpoles, small reptiles and birds (del Hoyo et al. 1992). Breeding site The nest is constructed from reeds and twigs (del Hoyo et al. 1992) and is normally placed near open poolsin thick emergent vegetation (Kushlan and Hancock 2005) (such as beds of bulrushes Typha spp. or reeds Phragmites spp.) (Hockey et al. 2005) close to the surface of the water or up to 60 cm above it (Snow and Perrins 1998). Alternatively nests may be placed in low bushes or trees (e.g. alder Alnus spp. or willow Salix spp.) up to 2 m above water (del Hoyo et al. 1992, Kushlan and Hancock 2005). Preferred nesting sites are usually 5-15 m out from the shore in water 20-30 cm deep (Snow and Perrins 1998). The species usually nests singly but may nest in loose colonies in favourable habitats with neighbouring nests as close as 5 m apart (solitary nests are usually 30-100 m apart) (Kushlan and Hancock 2005). Nests are often reused in consecutive years (Kushlan and Hancock 2005).

Systems
  • Terrestrial
  • Freshwater
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Breeds in reedbeds around lakes, dykes and fishponds. From lowland up to 1500 m. During winter and migration occurs in more open waters.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© New Guinea Birds

Source: Birds of Papua New Guinea

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Trophic Strategy

Varies with season and region. unting small fish, frogs and invertebrates (mainly).

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© New Guinea Birds

Source: Birds of Papua New Guinea

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Associations

In Great Britain and/or Ireland:
Animal / parasite / ectoparasite
imago of Icosta ardeae ectoparasitises Ixobrychus minutus

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Life History and Behavior

Behavior

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© New Guinea Birds

Source: Birds of Papua New Guinea

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Life Expectancy

Lifespan, longevity, and ageing

Maximum longevity: 6 years (wild)
Creative Commons Attribution 3.0 (CC BY 3.0)

© Joao Pedro de Magalhaes

Source: AnAge

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Barcode data: Ixobrychus minutus

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There is 1 barcode sequence available from BOLD and GenBank.

Below is the sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.

See the BOLD taxonomy browser for more complete information about this specimen.

Other sequences that do not yet meet barcode criteria may also be available.

CCTATACTTAATCTTCGGAGCATGAGCTGGCATAATCGGAACCGCCCTAAGCCTACTCATCCGAGCCGAACTTGGCCAACCAGGAACACTTCTAGGAGATGACCAAATTTACAACGTTATTGTCACTGCTCATGCCTTCGTAATAATTTTCTTCATAGTAATACCAATTATAATCGGCGGATTCGGAAACTGATTAGTCCCCCTCATAATTGGTGCCCCCGACATAGCATTCCCACGCATAAACAACATAAGCTTCTGACTACTACCACCATCATTCATGCTTTTACTAGCCTCATCAACAGTTGAAGCAGGAGCAGGTACAGGTTGAACAGTATATCCCCCACTAGCTGGTAACCTAGCCCATGCCGGAGCCTCAGTAGACTTAGCCATTTTTTCCCTACACCTAGCAGGTGTATCCTCCATCCTAGGGGCAATCAACTTCATTACAACTGCCATCAACATAAAACCTCCAACTCTATCACAATACCAAACCCCCCTATTCGTCTGATCCGTCTTAATTACCGCCGTTCTACTCCTACTCTCACTCCCAGTTCTTGCTGCAGGTATCACAATACTCCTTACAGATCGAAACCTAAACACCACATTCTTTGACCCCGCTGGAGGAGGAGACCCAGTCCTCTACCAGCACCTATTTTGATTCTTTGGACACCCAGAAGTCTACATCCTTATCCTC
-- end --

Download FASTA File

Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Statistics of barcoding coverage: Ixobrychus minutus

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 2
Specimens with Barcodes: 6
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Conservation

Conservation Status

IUCN Red List Assessment


Red List Category
LC
Least Concern

Red List Criteria

Version
3.1

Year Assessed
2014

Assessor/s
BirdLife International

Reviewer/s
Butchart, S.

Contributor/s

Justification
This species has an extremely large range, and hence does not approach the thresholds for Vulnerable under the range size criterion (Extent of Occurrence <20,000 km2 combined with a declining or fluctuating range size, habitat extent/quality, or population size and a small number of locations or severe fragmentation). Despite the fact that the population trend appears to be decreasing, the decline is not believed to be sufficiently rapid to approach the thresholds for Vulnerable under the population trend criterion (>30% decline over ten years or three generations). The population size has not been quantified, but it is not believed to approach the thresholds for Vulnerable under the population size criterion (<10,000 mature individuals with a continuing decline estimated to be >10% in ten years or three generations, or with a specified population structure). For these reasons the species is evaluated as Least Concern.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Status in Egypt

Resident breeder, regular passage visitor and winter visitor.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Bibliotheca Alexandrina

Source: Bibliotheca Alexandrina - EOL Ar

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Not Threatened.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© New Guinea Birds

Source: Birds of Papua New Guinea

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Population

Population
The global population size has not been estimated owing to recent taxonomic splits.

Population Trend
Decreasing
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Wikipedia

Little bittern

The little bittern (Ixobrychus minutus) is a wading bird in the heron family Ardeidae, native to the Old World, breeding in Africa, central and southern Europe, western and southern Asia, and Madagascar. Birds from temperate regions in Europe and western Asia are migratory, wintering in Africa and further south in Asia, while those nesting in the tropics are sedentary. It is rare north of its breeding range.[2]

Description[edit]

Immature

It is a very small bittern; measuring 25–36 cm (9.8–14.2 in) in length, 40–58 cm (16–23 in) across the wings and weighing 59–150 g (2.1–5.3 oz). It is among the smallest herons on earth. It has a short neck, longish bill and buff underparts. The male's back and crown are black, and the wings are black with a large white patch on each wing. The female has a browner back and a buff-brown wing patch.

Taxonomy[edit]

There are three subspecies:

  • Ixobrychus minutus minutus (Linnaeus, 1766). Europe, Asia, northern Africa; winters in Sub-Saharan Africa and southern Asia
  • Ixobrychus minutus payesii (Hartlaub, 1858). Sub-Saharan Africa, resident
  • Ixobrychus minutus podiceps (Bonaparte, 1855). Madagascar, resident

The Australian little bittern (Ixobrychus dubius) and the extinct New Zealand little bittern (Ixobrychus novaezelandiae) were formerly considered subspecies of the little bittern.[3]

Status[edit]

The little bittern is one of the species to which the Agreement on the Conservation of African-Eurasian Migratory Waterbirds (AEWA) applies.

Behaviour[edit]

The little bittern's breeding habitat is reed beds. It nests on platforms of reeds in shrubs, and four to eight eggs are laid. It can be difficult to see, given its skulking lifestyle and reed bed habitat.

These bitterns feed on fish, insects and amphibians.

References[edit]

  1. ^ BirdLife International (2012). "Ixobrychus minutus". IUCN Red List of Threatened Species. Version 2013.2. International Union for Conservation of Nature. Retrieved 26 November 2013. 
  2. ^ Rasmussen, Pamela C. and John C. Anderton (2005) Birds of South Asia. The Ripley Guide
  3. ^ Christidis, Les; Boles, Walter E. (2008). Systematics and Taxonomy of Australian Birds. CSIRO Publishing. ISBN 978-0-643-06511-6. 

Bibliography[edit]

Creative Commons Attribution Share Alike 3.0 (CC BY-SA 3.0)

Source: Wikipedia

Unreviewed

Article rating from 0 people

Default rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!