Overview

Comprehensive Description

Mostly light blue-grey in colour, with a characteristic white face. In flight, the dark flight feathers of the wing contrast with the paler grey plumage, making this bird easily identifiable when viewed from below. It has a long, slim neck and a pointed grey-black bill. The legs are long and dull yellow in colour. Sexes are similar. When breeding, the birds have long feathers (nuptial plumes) on the head, neck and back. The White-faced Heron has a slow bouncing flight. Young White-faced Herons are similar in appearance to the non-breeding adults (no nuptial plumes), but are duller, with little or no white on the face. They often have a reddish colour on the underparts.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© New Guinea Birds

Source: Birds of Papua New Guinea

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Distribution

Subspecies and Distribution:


    *novaehollandiae (Latham, 1790) - New Zealand, Australia, S New Guinea, New Caledonia and S Indonesia; probably in process of colonizing Christmas I (Indian Ocean). *parryi (Mathews, 1912) - NW Australia.


Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© New Guinea Birds

Source: Birds of Papua New Guinea

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Physical Description

Size

60-70 cm

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© New Guinea Birds

Source: Birds of Papua New Guinea

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Diagnostic Description

Mostly light blue-grey in colour, with a characteristic white face. In flight, the dark flight feathers of the wing contrast with the paler grey plumage, making this bird easily identifiable when viewed from below. It has a long, slim neck and a pointed grey-black bill. The legs are long and dull yellow in colour. Sexes are similar. When breeding, the birds have long feathers (nuptial plumes) on the head, neck and back. The White-faced Heron has a slow bouncing flight. Young White-faced Herons are similar in appearance to the non-breeding adults (no nuptial plumes), but are duller, with little or no white on the face. They often have a reddish colour on the underparts.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© New Guinea Birds

Source: Birds of Papua New Guinea

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Ecology

Habitat

Habitat and Ecology

Systems
  • Terrestrial
  • Freshwater
  • Marine
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

It can be found anywhere where there is water, from tidal mudflats and coastal reefs to moist grasslands and gardens.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© New Guinea Birds

Source: Birds of Papua New Guinea

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Trophic Strategy

Feeds on a wide variety of prey, including fish, insects and amphibians. Food is obtained in a variety of ways, such as walking and disturbing prey, searching among damp crevices or simply standing in the water and watching for movement.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© New Guinea Birds

Source: Birds of Papua New Guinea

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Life History and Behavior

Behavior

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© New Guinea Birds

Source: Birds of Papua New Guinea

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Reproduction

Oct-Dec but may breed outside the breeding season in response to rainfall. Both sexes share the building of the nest, incubation of the eggs and care of the young. The nest is an untidy structure of sticks, placed in a tree. Normally only one brood of young is raised in a year.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© New Guinea Birds

Source: Birds of Papua New Guinea

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Barcode data: Ardea novaehollandiae

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There is 1 barcode sequence available from BOLD and GenBank.   Below is the sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.  See the BOLD taxonomy browser for more complete information about this specimen.  Other sequences that do not yet meet barcode criteria may also be available.

ACTCGATGATTATTCTCAACCAACCACAAAGACATCGGTACTCTATACCTAATCTTCGGAGCATGAGCCGGCATAATTGGAACCGCCCTCAGCCTCCTTATCCGAGCCGAACTTGGCCAACCAGGAACACTCCTAGGAGAT---GACCAAATCTACAATGTGATTGTCACCGCCCATGCCTTCGTGATAATCTTCTTCATAGTAATACCAATCATAATTGGAGGGTTCGGAAACTGACTAGTACCCCTCATAATTGGCGCCCCAGATATGGCATTTCCCCGCATAAACAACATAAGTTTCTGACTCCTCCCACCCTCATTTATACTCCTACTAGCCTCATCCACAGTTGAAGCAGGAGCAGGCACAGGCTGAACAGTCTACCCACCCTTAGCCGGCAATCTAGCCCATGCTGGAGCCTCAGTCGACCTAGCCATCTTCTCCCTTCACTTAGCAGGGGTATCTTCTATCCTAGGGGCAATCAACTTCATTACAACTGCCATCAACATAAAACCTCCAACCCTATCACAATACCAAACTCCCCTATTTGTATGATCCGTCCTAATTACCGCTGTCTTACTTCTACTTTCACTCCCAGTTCTCGCTGCAGGTATTACAATACTACTAACTGATCGAAACCTAAACACCACATTCTTTGACCCTGCTGGAGGCGGTGACCCAGTCCTCTATCAGCACCTATTCTGATTTTTTGGTCACCCAGAAGTCTATATCCTAATTCTCCCAGGATTCGGAATCATCTCCCACGTAGTAACCTACTACGCTGGCAAAAAGGAACCATTTGGCTATATGGGTATAGTATGAGCCATACTATCCATTGGGTTCCTAGGCTTCATTGTATGAGCCCACCATATATTTACAGTAGGAATGGATGTAGATACTCGAG
-- end --

Download FASTA File
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Statistics of barcoding coverage: Ardea novaehollandiae

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 2
Specimens with Barcodes: 3
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Barcode data: Egretta novaehollandiae

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There is 1 barcode sequence available from BOLD and GenBank.   Below is the sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.  See the BOLD taxonomy browser for more complete information about this specimen.  Other sequences that do not yet meet barcode criteria may also be available.

CACATGTAGTAGATGACCAAATCTACAATGTGATTGTCACCGCCCATGCCTTCGTGATAATCTTCTTCATAGTAATACCAATCATAATTGGAGGGTTCGGAAACTGACTAGTACCCCTCATAATTGGCGCCCCAGATATGGCATTCCCCCGCATAAACAACATAAGTTTCTGACTCCTCCCACCCTCATTTATACTCCTACTAGCCTCATCCACAGTTGAAGCAGGAGCAGGCACAGGCTGAACAGTCTACCCACCCTTAGCCGGCAATCTAGCCCATGCTGGAGCCTCAGTCGACCTAGCCATCTTCTCCCTTCACTTAGCAGGGGTATCCTCTATCCTAGGGGCAATCAACTTCATTACAACTGCCATCAACATAAAACCTCCAACCCTATCACAATACCAAACTCCCCTATTTGTATGATCCGTCCTAATTACCGCTGTCTTACTTCTACTTTCACTCCCAGTTCTCGCTGCAGGTATTACAATACTACTAACTGATCGAAACCTAAACACCACATTCTTTGACCCTGCTGGAGGCGGTGACCCAGTCCTCTATCAGCACCTATTCTGATTTTTTGGTCACCCAGAAGTCTATATCCTAATTCTCCCTGGATTCGGAATCATCTCACATGTA
-- end --

Download FASTA File
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Statistics of barcoding coverage: Egretta novaehollandiae

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 1
Specimens with Barcodes: 2
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Conservation

Conservation Status

IUCN Red List Assessment


Red List Category
LC
Least Concern

Red List Criteria

Version
3.1

Year Assessed
2012

Assessor/s
BirdLife International

Reviewer/s
Butchart, S. & Symes, A.

Contributor/s

Justification
This species has an extremely large range, and hence does not approach the thresholds for Vulnerable under the range size criterion (Extent of Occurrence <20,000 km2 combined with a declining or fluctuating range size, habitat extent/quality, or population size and a small number of locations or severe fragmentation). The population trend is not known, but the population is not believed to be decreasing sufficiently rapidly to approach the thresholds under the population trend criterion (>30% decline over ten years or three generations). The population size may be moderately small to large, but it is not believed to approach the thresholds for Vulnerable under the population size criterion (<10,000 mature individuals with a continuing decline estimated to be >10% in ten years or three generations, or with a specified population structure). For these reasons the species is evaluated as Least Concern.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Not Threatened.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© New Guinea Birds

Source: Birds of Papua New Guinea

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Population

Population Trend
Unknown
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Wikipedia

White-faced heron

The white-faced heron (Egretta novaehollandiae) also known as the white-fronted heron,[2] and incorrectly as the grey heron,[3] or blue crane,[2] is a common bird throughout most of Australasia, including New Guinea, the islands of Torres Strait, Indonesia, New Zealand, the islands of the Subantarctic, and all but the driest areas of Australia.

It is a relatively small heron, pale, slightly bluish-grey, with yellow legs and white facial markings. It can be found almost anywhere near shallow water, fresh or salt, and although it is prompt to depart the scene on long, slow-beating wings if disturbed, it will boldly raid suburban fish ponds.

Taxonomy[edit]

The species was originally described by ornithologist John Latham in 1790. It was historically considered to be closely related to Ardea but for some time it was placed in its own genus because of the absence of the plumes typical in that genus.[2] Appearance and behaviour are more closely related to those in the genus Egretta, which DNA analysis has confirmed.[2]

Subspecies E. n. novaehollandiae and E. n. parryi in Australia, E. n. nana from New Caledonia and E. n. austera from Irian Jaya have previously been described, but are now not recognised taxonomically.[2]

Description[edit]

At Royal Botanic Gardens, Sydney, Australia
Non-breeding plumage
Juvenile plumage

The adult white-faced heron is relatively small, pale blue-grey. The forehead, crown, chin and upper throat are white. The crown pattern is variable, with the white occasionally spreading down the neck; the variability makes identification of individuals possible.[2] The iris may be grey, green, dull yellow or cinnamon.[2] The regions between the eye and bill on the side of the head (lores) are black. The beak is black and often pale grey at the base.[2] During the breeding season pinkish-brown or bronze nuptial plumes appear on the foreneck and breast, with blue-grey plumes appearing on the back.[4]

The adult typically weighs 550 g[5] and ranges from 60–70 cm in height.[6]

Immature birds are paler grey with only the throat white,[3] and often have a reddish colour on the underparts.[6] Chicks are typically covered with grey down.[2]

Distribution and habitat[edit]

The white-faced heron is found throughout most of Australasia, including New Guinea, the islands of Torres Strait, Indonesia, New Caledonia, New Zealand, the islands of the Subantarctic, and all but the driest areas of Australia. The species is now resident on Christmas Island but has not yet been recorded breeding there. It is also commonly found on Lombok, Flores and Sumbawa,[2] and has appeared as a vagrant in China,[7] the Cocos Islands and the Solomon Islands.[8] It is mostly a winter visitor to the Northern Territory.[3] It was self-introduced to New Zealand in the late 1940s.[5] It is the only heron recorded breeding in Tasmania.[4]

The white-faced heron is locally nomadic and found in both fresh and salty wetlands, farm dams, pastures, grasslands, crops, shores, saltmarsh, tidal mudflats, boat-harbours, beaches, golf courses, orchards or in garden fish-ponds.[3] It is protected in Australia under the National Parks and Wildlife Act 1974.

Behaviour[edit]

In flight, Tasmania

The white-faced heron typically perches on fence-posts, trees, telephone poles and house roofs.[3] Its flight is slow and bouncing.[6]

Call[edit]

The most common call of the white-faced heron is a gravelly croak or gobble,[3] graak or graaw and is typically given in flight, in interactions or in aggressive encounters.[2] Another call, gow, gow, gow is typically given upon returning to a nest.[2] High pitched wrank, oooooooooh or aaarrrgh calls are given as alarm calls.[2]

Breeding[edit]

Breeding generally takes place in the austral spring, but the birds may breed at other times in response to rainfall.[6][9] Breeding generally takes place in southern Australia, and birds disperse for long distances at other times of year. Both sexes share the task of building the nest, incubating the eggs and caring for the young.[6] The nest is an untidy shallow bowl, made of sticks and usually placed on a leafy branch 5–12 m high,[3] at altitudes from sea level to over 1000 m.[2] When breeding the birds have long feathers (nuptial plumes) on the neck, head and back.[9] A typical clutch has three to five pale blue eggs.[3] with an average size of 48.5×35 mm.[2] Normally only one brood is raised per year.[6] Incubation lasts approximately 25 days.[2] The parents guard the chicks for 3–4 weeks and fledging takes place 40 days after hatching.[2] Typical nestling predators include kookaburras, Australian magpies, harriers and owls.

Feeding[edit]

White-faced herons eat most small aquatic creatures[10] and their varied diet is fish, frogs, small reptiles and insects.[11] It uses a variety of techniques to find food including standing still and waiting for prey movement (often employing a peculiarly rhythmic neck movement whether in water or on land), walking slowly in shallow water, wing flicking, foot raking or even chasing prey with open wings.[10] White-faced herons generally feed solitarily or independently in small groups.[2] White-faced herons are generally territorial during breeding season but may feed in groups during non-breeding season, particularly after rain or flooding.[2]

See also[edit]

References[edit]

  1. ^ BirdLife International (2012). "Egretta novaehollandiae". IUCN Red List of Threatened Species. Version 2013.2. International Union for Conservation of Nature. Retrieved 26 November 2013. 
  2. ^ a b c d e f g h i j k l m n o p q r s Kushlan, James Anthony; Hancock, James, Thelwell, David (2005). The Herons. Oxford University Press. p. 170. ISBN 0-19-854981-4. 
  3. ^ a b c d e f g h Pizzey, Graham; Knight, Frank (1997). Field Guide to the Birds of Australia. Sydney, Australia: HarperCollinsPublishers. p. 111. ISBN 0-207-18013-X. 
  4. ^ a b McKilligan, Neil (2005). Herons, Egrets and Bitterns. CSIRO Publishing. p. 104. ISBN 0-643-09133-5. 
  5. ^ a b nzbirds.com - White-faced heron
  6. ^ a b c d e f Birds in Backyards - White-faced Heron
  7. ^ Chen, Xiaolin; Chen, Zhihong a& Fang, Wenzhen (2000). "Short Communication: New Record of the White-faced Heron Egretta novaehollandiae in Xiamen (Amoy), China". Emu 100 (4): 340. doi:10.1071/MU004SC. 
  8. ^ "Species factsheet: Egretta novaehollandiae". BirdLife international. 2008. 
  9. ^ a b Australian Museum Online - White-faced Heron
  10. ^ a b Bimbimbie ornithological services - Notable behaviours of white-faced heron
  11. ^ birdphotos.com.au White Faced Heron
Creative Commons Attribution Share Alike 3.0 (CC BY-SA 3.0)

Source: Wikipedia

Unreviewed

Article rating from 0 people

Default rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!