Articles on this page are available in 2 other languages: Chinese (Simplified) (6), Dutch (1) (learn more)

Overview

Brief Summary

The red-breasted merganser is a decorative bird, with its spiky head crest and contrasting red bill. It dives down to 4 meters to catch fish, using its eyes to find them. The bill with its serrated teeth is ideal for holding onto its slippery prey. It's not hard to understand that clear clean water is very important for the red-breasted merganser. It breeds primarily in lakes in Iceland, Scandinavia and Russia.The nest is well hidden in thick reed vegetation. Since the 1980s, red-breasted mergansers have also been breeding in the Netherlands.
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© Copyright Ecomare

Source: Ecomare

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Distribution

Range

N Palearctic and n N America; winters s Palearctic and Mexico.
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

 

Partner Web Site: Cornell Laboratory of Ornithology

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Belgian Exclusive Economic Zone, Gulf of Maine, Gulf of Mexico, North West Atlantic, Polish Exclusive Economic Zone, Portuguese Exclusive Economic Zone, Spanish Exclusive Economic Zone, Swedish Exclusive Economic Zone, United Kingdom Exclusive Economic Zone, Wimereux
Creative Commons Attribution 3.0 (CC BY 3.0)

© WoRMS for SMEBD

Source: World Register of Marine Species

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Geographic Range

Red-breasted mergansers are found throughout much of the northern hemisphere. They have separate breeding and wintering ranges, although they are found year-round in some northern, coastal areas. In the Americas they breed from Alaska throughout northern Canada to the Atlantic ocean and into the northern United States: Minnesota, Wisconsin, Michigan, and Maine. They breed in Greenland and Iceland and in Eurasia from the Faroe Islands, Ireland, and Scotland through Scandinavia, northern Russia and Asia to Siberia and the Kamchatka Peninsula. Red-breasted mergansers winter in coastal areas, including the Atlantic, Pacific, Gulf of Mexico, Great Lakes coasts, and other large, inland waterways as far south as northern Mexico in the Americas and the Baltic, North, Mediterranean, Black, Caspian, and Aral Seas in Eurasia.

Biogeographic Regions: nearctic (Native ); palearctic (Native ); arctic ocean (Native ); atlantic ocean (Native ); pacific ocean (Native ); mediterranean sea (Native )

Other Geographic Terms: holarctic

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

North America; Newfoundland to the Gulf of Mexico
Creative Commons Attribution 3.0 (CC BY 3.0)

© WoRMS for SMEBD

Source: World Register of Marine Species

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Range Description

The red-breasted Merganser breeds in most of the northern North America, south to the Great Lakes, in Greenland (to Denmark), Iceland, and much of northern Eurasia south to the United Kingdom, parts of Eastern Europe, north-east China and northern Japan. Its wintering grounds expand its range to include the Atlantic and Pacific coasts of North America, areas of central Europe and the Mediterranean basement, the Black Sea, the southern Caspian Sea, the southern coast of Iran and Pakistan, the eastern coast of China, and the coasts of Korea and Japan1.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Geographic Range

Red-breasted mergansers have a holarctic distribution; they are found throughout much of the northern hemisphere. Red-breasted mergansers have distinct breeding and wintering ranges, although they overlap somewhat in northern, coastal areas. In the Americas they breed from Alaska throughout northern, boreal Canada to the maritime provinces and into the northern United States: Minnesota, Wisconsin, Michigan, and Maine. They breed in Greenland and Iceland and in Eurasia from the Faroe Islands, Ireland, and Scotland through Scandinavia, northern Russia and Asia to Siberia and the Kamchatka Peninsula. They may also breed in northeastern China, northern Japan, and as far south as northern Germany, Lake Baikal, Manchuria, and the Sea of Okhotsk. Red-breasted mergansers winter in coastal areas, including the Atlantic, Pacific, Gulf of Mexico, Great Lakes coasts, and other large, inland waterways as far south as northern Mexico in the Americas and the Baltic, North, Mediterranean, Black, Caspian, and Aral Seas in Eurasia. They sometimes wander as far south as portions of the Red Sea and to the Hawaiian Islands in winter. They are found throughout the year in northern coastal areas, including Iceland, parts of the British Isles, southeastern Alaska and the Aleutian Islands, coastal areas of Maine and the Canadian maritime provinces, and the northernmost lower peninsula of Michigan and northern shore of Lake Michigan.

Biogeographic Regions: nearctic (Native ); palearctic (Native ); arctic ocean (Native ); atlantic ocean (Native ); pacific ocean (Native ); mediterranean sea (Native )

Other Geographic Terms: holarctic

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

occurs (regularly, as a native taxon) in multiple nations

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

National Distribution

Canada

Origin: Native

Regularity: Regularly occurring

Currently: Present

Confidence: Confident

Type of Residency: Year-round

United States

Origin: Native

Regularity: Regularly occurring

Currently: Present

Confidence: Confident

Type of Residency: Year-round

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Global Range: (>2,500,000 square km (greater than 1,000,000 square miles)) BREEDING: northern Alaska to Baffin Island and Newfoundland, south to Aleutians, southeastern Alaska, northern Alberta, Minnesota, Michigan, northern New York, northern Vermont, Maine, and Nova Scotia. NON-BREEDING: southern Alaska, Great Lakes, and Nova Scotia to Baja California, Gulf Coast, Florida; very rare in Hawaii. Winters primarily in coastal waters (especially the Atlantic coast from Maine to North Carolina, the Gulf coast along the Florida panhandle, and around Vancouver Island) but also in many inland areas (including especially southern Lake Huron and northern Utah) (Root 1988). Also breeds and winters in the Old World.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Canada north into tundra, Atlantic and Pacific coasts of North America.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Gulf of Maine - CoML

Source: Gulf of Maine Area Census of Marine Life

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Physical Description

Morphology

Physical Description

Red-breasted mergansers are large diving ducks with long, thin bills lined with serrated edges to help in capturing fish prey. Males are larger than females. Lengths range from 51 to 64 cm and weights from 800 to 1350 g. In their breeding plumage, males are more colorful, with dark greenish heads, a white collar, brown-speckled breasts, steel-gray flanks, and greenish-black backs that are bordered by a white patch. Both females and males have a double crest of plumes at the back of their heads. Females are grayish brown, with a small, white wing bar, a whitish breast with gray speckles, and the feathers on the head are reddish brown. The bill and legs are reddish-orange and the bill has a black tip. Females stays the same throughout the year and immature birds resemble females. Males in the non-breeding season resemble females but have wider, white wing bars.

Range mass: 800 to 1350 g.

Range length: 51 to 64 cm.

Other Physical Features: endothermic ; homoiothermic; bilateral symmetry

Sexual Dimorphism: male larger; male more colorful

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Physical Description

Red-breasted mergansers are relatively large diving ducks with long, thin bills lined with serrated edges to help in capturing fish prey. Males are larger than females. Lengths range from 51 to 64 cm and weights from 800 to 1350 g. In their breeding plumage, males are more colorful, with dark greenish heads, a white collar, brown-speckled breasts, steel-gray flanks, and greenish-black backs that are bordered by a white patch. Both females and males have an asymmetrical crest of plumes at the back of their heads. Females are grayish brown overall, with a small, white wing bar, a whitish breast with gray speckles, and the head is cinnamon brown. There is an inconspicuous white eye ring. The bill and legs are reddish-orange and the bill has a black tip. Female plumage stays the same throughout the year and immature birds resemble females. Males in the non-breeding season resemble females but have wider, white wing bars.

Range mass: 800 to 1350 g.

Range length: 51 to 64 cm.

Other Physical Features: endothermic ; homoiothermic; bilateral symmetry

Sexual Dimorphism: male larger; male more colorful

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Size

Length: 58 cm

Weight: 1135 grams

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Length: 57.5 cm., Wingspan: 75 cm.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Gulf of Maine - CoML

Source: Gulf of Maine Area Census of Marine Life

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Diagnostic Description

See Kaufman (1990) for information on identification.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Ecology

Habitat

Red-breasted mergansers are found on wetlands and open bodies of freshwater, brackish, or saltwater. In summer they are found in northern areas, usually coasts, lakes, and rivers near conifer forests or tundra. In winter and during migration they are found on protected waters along sea coasts and large, inland lakes and rivers. Red-breasted mergansers forage mainly in shallow waters with submergent vegetation and abundant fish prey.

Habitat Regions: temperate ; saltwater or marine ; freshwater

Terrestrial Biomes: tundra ; taiga ; forest

Aquatic Biomes: lakes and ponds; rivers and streams; coastal ; brackish water

Other Habitat Features: estuarine

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Habitat and Ecology

Habitat and Ecology
Behaviour This species is fully migratory1, 3 although in temperate regions it only undertakes short distance movements to nearby coasts5 or remains close to its breeding waters throughout the year3. It breeds from April or May (later in northern populations)2 in single pairs or colonies1 on islands or small islets, adults often assembling in groups on beaches when not at the nest (even when nesting solitarily)2. Males leave the breeding grounds in June to moult in small groups along the coast5, often considerable distances from the breeding areas6 (although there is no evidence for any major migrations to common moulting sites)4. The autumn migration begins in September5 and the species returns from the wintering grounds as early as February5. It is gregarious during the winter and on migration2, flocks of up to a hundred or more occurring in suitable sites during the autumn (although it travels in much smaller flocks during the spring)6. Habitat Breeding The species breeds along the wooded shorelines2 of deep lakes1, small rivers and streams1 with moderate currents6 in the tundra, boreal and temperate forest zones2, 6, as well as on more saline waters such as sheltered shallow bays, inlets, straits or estuaries with sandy rather than muddy substrates6. It shows a preference for narrow channels rather than open expanses of water, with islands or islets and spits, projecting rocks or grassy banks6. Non-breeding The majority of the species winters at sea1, frequenting both inshore and offshore waters, estuaries, bays and brackish lagoons1 but showing a preference for clear, shallow waters not affected by heavy wave action4. It will also utilise large freshwater lakes on passage3. Diet Its diet consists predominantly of small, shoaling marine or freshwater fish1, as well as small amounts of plant material1 and aquatic invertebrates1 such as crustaceans (e.g. shrimps and crayfish)4, worms and insects2. Breeding site The nest is constructed within 25 m of water2 in a variety of locations such as natural cavities on the ground1, 2, 4 , burrows1, 2, under boulders3, amongst tree or scrub roots6, in tree cavities, artificial nestboxes3, amongst reeds or on floating reed mats7. Where tree cavities or artificial nestboxes are utilised, the species shows a preference for those with entrances c.10 cm in diameter and with internal diameters of 30-40 cm4. Management information The breeding density of this species increased on islands in the outer archipelago of south-west Finland as a result of feral American mink Neovison vison removal11. The species will also nest in artificial nestboxes with entrances c.10 cm in diameter and with internal diameters of 30-40 cm4.

Systems
  • Terrestrial
  • Freshwater
  • Marine
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Red-breasted mergansers are found on wetlands and open bodies of freshwater, brackish, or saltwater in their breeding and wintering ranges. In the breeding range, they are found in the tundra and boreal zones. In winter and during migration they are found on protected waters along sea coasts and large, inland lakes and rivers, although they also use fast-flowing rivers. Red-breasted mergansers are found foraging mainly in shallow waters with submergent vegetation, although they also forage in deep waters, just as long as there is an abundance of their fish prey.

Habitat Regions: temperate ; saltwater or marine ; freshwater

Terrestrial Biomes: tundra ; taiga ; forest

Aquatic Biomes: lakes and ponds; rivers and streams; coastal ; brackish water

Other Habitat Features: estuarine

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Depth range based on 6154 specimens in 1 taxon.
Water temperature and chemistry ranges based on 43 samples.

Environmental ranges
  Depth range (m): 0 - 0
  Temperature range (°C): 0.811 - 17.743
  Nitrate (umol/L): 1.003 - 14.675
  Salinity (PPS): 5.715 - 35.235
  Oxygen (ml/l): 5.571 - 8.295
  Phosphate (umol/l): 0.231 - 0.809
  Silicate (umol/l): 1.258 - 12.889

Graphical representation

Temperature range (°C): 0.811 - 17.743

Nitrate (umol/L): 1.003 - 14.675

Salinity (PPS): 5.715 - 35.235

Oxygen (ml/l): 5.571 - 8.295

Phosphate (umol/l): 0.231 - 0.809

Silicate (umol/l): 1.258 - 12.889
 
Note: this information has not been validated. Check this *note*. Your feedback is most welcome.
Public Domain

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Comments: BREEDING: Rivers, ponds, lakes, and coastal areas (AOU 1983). Nests along inland waters, generally on ground on small islands with low vegetative cover, and also near seacoast and occasionally on shores of ocean or on coastal islands. NON-BREEDING: winters mainly in estuaries and sheltered bays, less frequently on large inland bodies of water (AOU 1983).

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Lakes, open water and coastal waters.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Gulf of Maine - CoML

Source: Gulf of Maine Area Census of Marine Life

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Migration

Non-Migrant: No. All populations of this species make significant seasonal migrations.

Locally Migrant: Yes. At least some populations of this species make local extended movements (generally less than 200 km) at particular times of the year (e.g., to breeding or wintering grounds, to hibernation sites).

Locally Migrant: Yes. At least some populations of this species make annual migrations of over 200 km.

Migrates north mostly March-May; arrives in northernmost breeding areas late May-early June. Southward migration mostly September-December. Some coastal breeding populations may stay in area all year? (Palmer 1976).

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Migrate to coastal areas in flocks. Fly in V-formation or in lines.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Gulf of Maine - CoML

Source: Gulf of Maine Area Census of Marine Life

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Trophic Strategy

Food Habits

Red-breasted mergansers eat mainly small Actinopterygii (10 to 15 cm long) and Crustacea. Their diet is usually made up of more than 75% small fish, with less than 25% made up of crustaceans and other aquatic animals, including insects, worms, and amphibians. They seem to prefer foraging in shallow water, but they will hunt wherever prey is abundant. Red-breasted mergansers forage in several different ways. They float at the surface, looking underwater as they go, they dive in deep or shallow water to search for prey, or they dive in formation with other red-breasted mergansers to herd schooling prey. Preferred fish prey include Fundulus, Gasterosteidae, Salmo salar, Cottus, Clupea pallasi and their eggs, Oncorhynchus, Menidia menidia, and Alosa aestevalis.

Animal Foods: amphibians; fish; eggs; aquatic or marine worms; aquatic crustaceans

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Food Habits

Red-breasted mergansers eat mainly small fishes (10 to 15 cm long) and crustaceans. Their diet is usually made up of over 75% small fish, with less than 25% made up of crustaceans and other aquatic animals, such as insects, worms, and amphibians. They seem to prefer foraging in shallow water, but they will hunt wherever prey is abundant. Red-breasted mergansers forage in several different ways. They float at the surface, looking underwater as they go, they dive in deep or shallow water to search for prey, or they dive in formation with other red-breasted mergansers to herd schooling prey. This cooperative foraging strategy can be very effective and has been observed when mergansers are hunting sheepshead minnows. Other preferred fish prey include killifishes, sticklebacks, Atlantic salmon, sculpins, herring and their eggs, salmon eggs, silversides, and blueback herring.

Animal Foods: amphibians; fish; eggs; aquatic or marine worms; aquatic crustaceans

Primary Diet: carnivore (Piscivore )

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Comments: Eats mostly fishes plus some crustaceans; insects are important to young (Palmer 1976). Dives underwater to forage.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Feeds mostly on fish. Also will eat crustaceans, aquatic insects, frogs, tadpoles, and worms.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Gulf of Maine - CoML

Source: Gulf of Maine Area Census of Marine Life

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Associations

Ecosystem Roles

Red-breasted mergansers are important predators of small fish in their wetland habitats. Egretta thula, Larus philadelphia, and Larus delawarensis will wait at the surface to grab fish scared by merganser foraging. Red-breasted mergansers are also attracted to areas where Larus are feeding on schooling fish.

Mutualist Species:

  • snowy egrets (Egretta_thula)
  • Bonaparte's gulls (Larus_philadelphia)
  • ring-billed gulls (Larus_delawarensis)

Commensal/Parasitic Species:

  • nematodes (Eustrongylides species)
  • lice (Anaticola_crassicornis)
  • lice (Anatoecus_dentatus)
  • lice (Anatoecus_icterodes)
  • lice (Holomenopon_loomisi)
  • lice (Pseudomenopon species)
  • lice (Trinoton_querquedulae)

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Predation

A wide variety of predators feed on eggs and nestlings of red-breasted mergansers, including Corvus corax, Larus marinus, Larus argentatus, Stercorarius parasiticus, and Neovison vison. Adults have been taken by Bubo virginianus and Falco rusticolis. They may also be taken by Vulpes vulpes and Nyctea scandiaca.

Known Predators:

  • common ravens (Corvus_corax)
  • great black-backed gulls (Larus_marinus)
  • herring gulls (Larus_argentatus)
  • parasitic jaegers (Stercorarius_parasiticus)
  • mink (Neovison_vison)
  • great horned owls (Bubo_virginianus)
  • gyrfalcons (Falco_rusticolis)
  • red foxes (Vulpes_vulpes)
  • snowy owls (Nyctea_scandiaca)

Anti-predator Adaptations: cryptic

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Ecosystem Roles

Red-breasted mergansers are important predators of small fish in their wetland habitats. Several bird species take advantage of the fact that red-breasted mergansers will herd fish prey to the water's surface when they are foraging. Snowy egrets, Bonaparte's, and ring-billed gulls will wait at the surface to grab fish scared by merganser foraging. Red-breasted mergansers are also attracted to areas where gulls are feeding on schooling fish.

Red-breasted mergansers are parasitized by at least 60 kinds of parasitic worms, including Eustrongylides species, which may cause die-offs. They are also parasitized by ectoparasites, such as lice (Anaticola crassicornis, Anatoecus dentatus, Anatoecus icterodes, Holomenopon loomisi, Pseudomenopon species, and Trinoton querquedulae).

Mutualist Species:

Commensal/Parasitic Species:

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Predation

A wide variety of predators feed on eggs and nestlings of red-breasted mergansers, including common ravens, great black-backed gulls, herring gulls, parasitic jaegers, and mink. Adults have been taken by great horned owls and gyrfalcons. They may also be taken by red foxes and snowy owls.

Known Predators:

Anti-predator Adaptations: cryptic

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Known prey organisms

Mergus serrator (Fish-eating birds) preys on:
Paralichthyes albigutta
Strongylura marina
Leiostomus xanthurus

Based on studies in:
USA: Florida (Estuarine)

This list may not be complete but is based on published studies.
  • Christian RR, Luczkovich JJ (1999) Organizing and understanding a winter’s seagrass foodweb network through effective trophic levels. Ecol Model 117:99–124
Creative Commons Attribution 3.0 (CC BY 3.0)

© SPIRE project

Source: SPIRE

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Life History and Behavior

Behavior

Communication and Perception

Red-breasted mergansers use visual displays and calls during the breeding season to attract mates. They also produce alarm calls that sound like "garr" or "grack."

Communication Channels: visual ; acoustic

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Communication and Perception

Red-breasted mergansers use visual displays and vocalizations in their courtship rituals. They also produce alarm calls that sound like "garr" or "grack." Males produce a drumming sound with their wings during copulation.

Communication Channels: visual ; acoustic

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Life Expectancy

Lifespan/Longevity

The oldest recorded red-breasted merganser was 9 years and 4 months old. Like many animals, most hatchlings do not survive through their first year. Up to 50% of hatchlings die because of exposure to cold weather, another 25% are preyed on.

Range lifespan

Status: wild:
9.33 (high) years.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Lifespan/Longevity

The oldest recorded red-breasted merganser was 9 years and 4 months old. A female was also recorded breeding when she was 8 years old. Like many animals, most red-breasted merganser hatchlings do not survive through their first year. Up to 50% of hatchlings die because of exposure to cold weather, another 25% are preyed on. It is thought that about 50% of red-breasted mergansers survive migration and winter to breed the following year.

Range lifespan

Status: wild:
9.33 (high) years.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Lifespan, longevity, and ageing

Maximum longevity: 21.2 years (wild)
Creative Commons Attribution 3.0 (CC BY 3.0)

© Joao Pedro de Magalhaes

Source: AnAge

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Reproduction

Red-breasted mergansers form mated pairs each season. Most pair bonds form during spring migration, starting in March. Males use a courtship display and call to attract females. Usually several males display around a single female in an attempt to win her favor.

Mating System: monogamous ; polygynandrous (promiscuous)

Red-breasted mergansers breed relatively late in the season. Mated pairs arrive on the breeding grounds in May and lay eggs in early June. Young hatch in July and can fly by September or October. Females choose nests on land close to water, usually in dense vegetation or under objects. Nests are usually within 23 m of the water. Females start the nest as a scrape, but gradually add grass and feathers throughout incubation. They lay from 5 to 24 beige to gray eggs. Incubation is generally for 30 to 31 days, young hatch synchronously. Young fledge at 60 to 65 days after hatching. Because they breed relatively late, second clutches are unlikely. Most red-breasted mergansers mate first in their third year, although they are mature in their second year.

Breeding interval: Red-breasted mergansers breed once yearly.

Breeding season: Red-breasted mergansers breed in May and June.

Range eggs per season: 5 to 24.

Average eggs per season: 9.5.

Range time to hatching: 30 to 31 days.

Range fledging age: 60 to 65 days.

Range time to independence: 7 (high) weeks.

Range age at sexual or reproductive maturity (female): 2 to 3 years.

Average age at sexual or reproductive maturity (female): 3 years.

Range age at sexual or reproductive maturity (male): 2 to 3 years.

Key Reproductive Features: seasonal breeding ; gonochoric/gonochoristic/dioecious (sexes separate)

Females incubate the eggs and brood and care for the young until they abandon them within a few weeks after hatching. Males abandon females on the nest soon after she begins incubating the eggs.

Parental Investment: precocial ; pre-fertilization (Provisioning, Protecting: Female); pre-hatching/birth (Provisioning: Female, Protecting: Female); pre-weaning/fledging (Protecting: Female)

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Red-breasted mergansers are seasonally monogamous, but there is good evidence that extra-pair copulations may be frequent. Pairs may form as early as November, but most pair bonds form during spring migration, starting in March. Males use a courtship display and call to attract females. Usually several males display around a single female in an attempt to win her favor. Males hold their heads close to their body with the crest raised and their bill pointing up, they then do 1 of 2 alternate displays: the "head shake" and the "salute curtsy." The head shakes involves flicking the head from side to side. In the salute curtsy the male drops the bill forward, then rapidly flicks it up while straightening his neck and raising the chest above the water, the chest is then dropped back into the water, this may also be accompanied by kicking. A "yeow" call is used during the salute portion of the curtsy salute display. Females use a display that incites male courtship behavior, making a bobbing motion through the water as she holds her bill downwards.

Mating System: monogamous ; polygynandrous (promiscuous)

Red-breasted mergansers are relatively late breeders. Mated pairs arrive on the breeding grounds in May, egg-laying occurs in early June in the northernmost portions of the breeding range, with hatching in July and fledging in September to October. Females choose nests on land close to water, usually in dense vegetation or under objects, such as driftwood or boulders. Either an object or dense tree branches or grass forms a roof over the nest. Nests are usually within 23 m of the water, never more than 70 m. Females start the nest as a scrape, but gradually add grass and feathers as incubation progresses. They lay from 5 to 24 beige to gray eggs (mean 9.5), laying 1 egg every other day. They begin to incubate the eggs when the last egg is laid. Incubation is generally for 30 to 31 days, young hatch synchronously. Young fledge at 60 to 65 days after hatching. Because they breed relatively late, second clutches are unlikely. Most red-breasted mergansers mate first in their third year, although they are mature in their second year.

Breeding interval: Red-breasted mergansers breed once yearly.

Breeding season: Red-breasted mergansers breed in May and June.

Range eggs per season: 5 to 24.

Average eggs per season: 9.5.

Range time to hatching: 30 to 31 days.

Range fledging age: 60 to 65 days.

Range time to independence: 7 (high) weeks.

Range age at sexual or reproductive maturity (female): 2 to 3 years.

Average age at sexual or reproductive maturity (female): 3 years.

Range age at sexual or reproductive maturity (male): 2 to 3 years.

Key Reproductive Features: seasonal breeding ; gonochoric/gonochoristic/dioecious (sexes separate)

Females incubate the eggs and brood and care for the young until they abandon them within a few weeks after hatching. Males abandon females on the nest soon after she begins incubating the eggs.

Parental Investment: precocial ; pre-fertilization (Provisioning, Protecting: Female); pre-hatching/birth (Provisioning: Female, Protecting: Female); pre-weaning/fledging (Protecting: Female)

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Clutch size: 6-16 (often 8-10); incubation: 29-35 days, by female; young first fly at estimated age of 59 days; first breeds at almost 2 years (Terres 1980, Palmer 1976).

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Nest built in sheltered site near water. 7-10 eggs, sometimes laid in other ducks? nests. Female incubates eggs for 29-35 days. Young can feed themselves, and are left on their own after several weeks.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Gulf of Maine - CoML

Source: Gulf of Maine Area Census of Marine Life

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Barcode data: Mergus serrator

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There are 11 barcode sequences available from BOLD and GenBank.  Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.  See the BOLD taxonomy browser for more complete information about this specimen and other sequences.

TCCAACCACAAAGACATTGGCACCCTATATCTTATCTTCGGAGCATGGGCTGGAATAATTGGCACAGCACTCAGCCTGCTAATCCGCGCAGAACTCGGCCAACCAGGGACCCTCCTGGGTGACGACCAAATTTATAATGTAATCGTCACCGCCCATGCTTTTGTAATAATCTTCTTCATGGTAATACCCATCATAATCGGAGGGTTCGGCAACTGACTAGTCCCCCTGATAATCGGCGCCCCCGACATAGCATTCCCACGAATAAACAACATAAGCTTCTGACTCCTCCCACCATCATTTCTTCTACTACTCGCCTCATCTACCGTAGAAGCTGGCGCTGGCACAGGTTGAACCGTGTACCCACCCCTAGCAGGAAACCTAGCCCATGCCGGAGCCTCGGTGGACCTGGCTATCTTCTCACTCCACTTAGCTGGCGTTTCCTCCATCCTCGGAGCTATTAACTTCATCACCACGGCCATCAACATAAAACCCCCCGCACTCTCACAATACCAGACCCCACTTTTCGTCTGATCCGTCCTAATTACTGCCATCCTACTCCTCCTGTCACTCCCTGTCCTCGCCGCTGGCATTACAATGCTACTAACCGACCGAAACCTAAACACCACGTTCTTCGACCCCGCCGGAGGAGGAGACCCGATTCTGTACCAACACCTGTTCTGATTCTTCGGCCACCCAGAAGTCTACATCTTAATCCTCCCAGGATTTGGAATTATCTCCCACGTAA
-- end --

Download FASTA File
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Statistics of barcoding coverage: Mergus serrator

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 9
Specimens with Barcodes: 11
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Conservation

Conservation Status

Red-breasted mergansers have a wide distribution and large populations, they are not considered currently threatened. Some populations may be threatened by wetland destruction and contamination by pesticides and lead. They are also captured in fishing nets sometimes.

US Migratory Bird Act: protected

US Federal List: no special status

CITES: no special status

State of Michigan List: no special status

IUCN Red List of Threatened Species: least concern

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

IUCN Red List Assessment


Red List Category
LC
Least Concern

Red List Criteria

Version
3.1

Year Assessed
2009

Assessor/s
BirdLife International

Reviewer/s
Bird, J., Butchart, S.

Contributor/s
Pihl, S.

Justification
This species has an extremely large range, and hence does not approach the thresholds for Vulnerable under the range size criterion (Extent of Occurrence <20,000 km2 combined with a declining or fluctuating range size, habitat extent/quality, or population size and a small number of locations or severe fragmentation). The population trend appears to be stable, and hence the species does not approach the thresholds for Vulnerable under the population trend criterion (>30% decline over ten years or three generations). The population size is very large, and hence does not approach the thresholds for Vulnerable under the population size criterion (<10,000 mature individuals with a continuing decline estimated to be >10% in ten years or three generations, or with a specified population structure). For these reasons the species is evaluated as Least Concern.

History
  • 2008
    Least Concern
  • 2004
    Least Concern
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Red-breasted mergansers have a wide distribution and large populations, they are not considered currently threatened. However, some populations may be threatened by wetland destruction and contamination by pesticides and lead. They are also captured in fishing nets fairly frequently.

US Migratory Bird Act: protected

US Federal List: no special status

CITES: no special status

State of Michigan List: no special status

IUCN Red List of Threatened Species: least concern

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Status in Egypt

Winter visitor.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Bibliotheca Alexandrina

Source: Bibliotheca Alexandrina - EOL Ar

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

National NatureServe Conservation Status

Canada

Rounded National Status Rank: N5B,N5N : N5B: Secure - Breeding, N5N: Secure - Nonbreeding

United States

Rounded National Status Rank: N5B,N5N : N5B: Secure - Breeding, N5N: Secure - Nonbreeding

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

NatureServe Conservation Status

Rounded Global Status Rank: G5 - Secure

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

No official conservation status.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Gulf of Maine - CoML

Source: Gulf of Maine Area Census of Marine Life

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Population

Population
Total regarded as a minimum by Wetlands International (2006).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Threats

Major Threats
The species is subject to persecution and may be shot2 by anglers and fish-farmers who accuse it of depleting fish stocks1, 2. It is also threatened by accidental entanglement and drowning in fishing nets2. Alterations to its breeding habitats by dam construction and deforestation, and habitat degradation from water pollution are other major threats to the species1. It is also susceptible to avian influenza so may the threatened by future outbreaks of the virus8. Utilisation The species is hunted in North America2 and Denmark9, although it may not be a popular game species2. The eggs of the species also used to be (and possibly still are) harvested in Iceland10.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Relevance to Humans and Ecosystems

Benefits

Economic Importance for Humans: Negative

Red-breasted mergansers are sometimes attracted to fish hatcheries and important salmon spawning streams. They are sometimes persecuted because of their predation on young salmon.

Negative Impacts: crop pest

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Economic Importance for Humans: Positive

Red-breasted mergansers are occasionally hunted, but they are not a common game bird.

Positive Impacts: food

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Economic Importance for Humans: Negative

Red-breasted mergansers are sometimes attracted to fish hatcheries and other commercial fish raising programs, as well as important salmon spawning streams. They are sometimes persecuted because of their predation on salmon parr (young salmon).

Negative Impacts: crop pest

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Economic Importance for Humans: Positive

Red-breasted mergansers are occasionally hunted, but they are not a common game bird.

Positive Impacts: food

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Wikipedia

Red-breasted Merganser

The Red-breasted Merganser (Mergus serrator) is a diving duck, one of the sawbills.

Contents

Taxonomy [edit]

The Red-breasted Merganser was originally described under its current scientific name by Linnaeus in his 18th-century work, Systema Naturae.[2]

Juvenile, Florida

Description [edit]

The adult Red-breasted Merganser is 51–62 cm (20–24 in) long with a 70–86 cm (28–34 in) wingspan.[3] It has a spiky crest and long thin red bill with serrated edges. The male has a dark head with a green sheen, a white neck with a rusty breast, a black back, and white underparts. Adult females have a rusty head and a greyish body. The juvenile is like the female, but lacks the white collar and has a smaller white wing patch.

Voice [edit]

The call of the female is a rasping prrak prrak, while the male gives a feeble hiccup-and-sneeze display call.

Behaviour [edit]

Food and feeding [edit]

Red-breasted Mergansers dive and swim underwater. They mainly eat small fish, but also aquatic insects, crustaceans, and frogs.

Breeding [edit]

Its breeding habitat is freshwater lakes and rivers across northern North America, Greenland, Europe, and Asia. It nests in sheltered locations on the ground near water. It is migratory and many northern breeders winter in coastal waters further south.

Conservation [edit]

The Red-breasted Merganser is one of the species to which the Agreement on the Conservation of African-Eurasian Migratory Waterbirds (AEWA) applies.

References [edit]

  1. ^ BirdLife International (2008). Mergus serrator. In: IUCN 2008. IUCN Red List of Threatened Species. Retrieved 9 December 2010.
  2. ^ Linnaeus, Carl (1758). Systema naturae per regna tria naturae, secundum classes, ordines, genera, species, cum characteribus, differentiis, synonymis, locis. Tomus I. Editio decima, reformata (in Latin). Holmiae. (Laurentii Salvii). p. 62. 
  3. ^ Jonsson, Lars (1992). Birds of Europe with North Africa and the MIddle East. Princeton University Press. p. 118. ISBN 0-691-03326-9. 
Creative Commons Attribution Share Alike 3.0 (CC BY-SA 3.0)

 

Source: Wikipedia

Unreviewed

Article rating from 0 people

Average rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!