Articles on this page are available in 1 other language: Spanish (1) (learn more)

Overview

Brief Summary

Oxyura jamaicensis

A small (15-16 inches), oddly-shaped duck, the male Ruddy Duck in summer is most easily identified by its chestnut-brown body, black cap, white cheeks, and blue bill. In winter, the male loses much of its color, becoming gray-brown above and mottled gray below with a gray bill while retaining its solid white cheeks. Females are similar to winter males, but have gray-brown cheeks. This species is one of several “stiff-tailed” ducks, all of which have short, stiff tails which are often held erect. The Ruddy Duck breeds widely in the western United States, southwestern Canada, and western Mexico. Smaller numbers breed further east in the Great Lakes region and along the St. Lawrence River. In winter, this species vacates northern portions of its range, and may be found at lower elevations across the U.S.and most of Mexico. Other non-migratory populations occur in Central America and in the West Indies, and an introduced population breeds in Britain. Ruddy Ducks breed in a variety of freshwater wetlands, primarily those surrounded by grassland or prairie. In the winter, this species may be found in freshwater wetlands as well as in brackish bays and estuaries. Ruddy Ducks primarily eat small invertebrates, including insects and crustaceans. One of many species of ducks which dive while foraging for food, Ruddy Ducks may be observed submerging themselves to feed on invertebrates in the water or on the bottom. Although Ruddy Ducks are quite agile while in the water, this species is among the least terrestrial ducks in its range, being almost entirely incapable of walking on land. Ruddy Ducks are primarily active during the day.

Threat Status: Least concern

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Unknown

Supplier: DC Birds

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Distribution

Ruddy ducks are native to North and South America. These stiff-tailed ducks nest in western and central Canada and much of the western United States as far east as the Great Lakes region and south to central Texas, throughout Baja California, and to the transvolcanic belt in Mexico. Wintering range extends throughout most of southern North America, from California through the Great Lakes region and the Atlantic coast south of southern Maine to as far south as western Guatemala and El Salvador. Ruddy ducks were introduced to England in 1960 in Gloucestershire. From there these ducks have colonized Ireland and Belgium. Ruddy ducks introduced in Europe are migratory birds from the eastern United States and Mexico. Two subspecies including Oxyura jamaicensis ferruginea and Oxura jamaicensis andina can be found in the West Indies, Columbia, and throughout the Andes Mountains.

Biogeographic Regions: nearctic (Native ); palearctic (Introduced ); neotropical (Native )

  • Gooders, J., T. Boyer. 1986. Ducks of North America and the Northern Hemisphere. New York: Facts On File, Inc..
  • Pough, R. 1951. All the Birds of Eastern and Central North America. Garden City, New York: Doubleday & Company Inc..
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 1 person

Average rating: 4.0 of 5

Global Range: (>2,500,000 square km (greater than 1,000,000 square miles)) BREEDING: In North America, the northern prairies are the most important breeding areas. Nesting occurs in east-central Alaska (casually), and from central and northeastern British Columbia, southwestern Mackenzie, northern Alberta, northern Saskatchewan, and central Manitoba east across southern Canada to Nova Scotia, south to southern California, central Arizona, southern New Mexico, western and southern Texas, southwestern Louisiana, and northern Florida, with scattered, sporatic, or former breeding in several other areas in U.S., Canada, and Mexico. Breeds also in El Salvador, the West Indies (Bahamas [New Providence], Greater Antilles, and the Lesser Antilles south to Grenada). NON-BREEDING: in North America, winters primarily on the Pacific coast (mainly California, especially the Salton Sea area), secondarily on the Atlantic coast, and with about 20% of the population in the interior of the continent (the majority in Texas and Louisiana, plus a concentration along the Mississippi River between Mississippi and Arkansas). Winters southward from southern British Columbia, Idaho, Colorado, Kansas, and the Great Lakes, and on the Atlantic coast mainly in Chesapeake Bay and south through Pamlico Sound, south throughout the southern U.S. and most of Mexico to Honduras (sight record for Nicaragua), and throughout the Bahamas. Areas in North America where migrants may concentrate include the Klamath Basin in northern California, Minidoka NWR in Idaho, marshes adjacent to the Great Salt Lake, Malheur NWR in Oregon, Carson Sink in Nevada, and the region extending from North Dakota across Minnesota, Wisconsin, and southeastern Michigan to Chesapeake Bay. RESIDENT: in the Antilles and South America. INTRODUCED: established in England. Casual in Hawaii, southeastern Alaska, southern Yukon, and Bermuda. (AOU 1983, Sibley and Monroe 1990). See Bellrose (1980) for further details on the breeding and winter distribution in North America.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 1 person

Average rating: 3.0 of 5

occurs (regularly, as a native taxon) in multiple nations

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

National Distribution

Canada

Origin: Native

Regularity: Regularly occurring

Currently: Present

Confidence: Confident

Type of Residency: Breeding

United States

Origin: Native

Regularity: Regularly occurring

Currently: Present

Confidence: Confident

Type of Residency: Year-round

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

North America; Nova Scotia and New Brunswick; winter range extends from Cape Cod to the Gulf of Mexico
  • North-West Atlantic Ocean species (NWARMS)
Creative Commons Attribution 3.0 (CC BY 3.0)

© WoRMS for SMEBD

Source: World Register of Marine Species

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Geographic Range

Ruddy ducks are native to North and South America. These Oxyura nest in western and central Canada as far east as the Great Lakes region and south to central Texas and southern Mexico. In the winter they are found throughout most of southern North America and central America, from California through the Great Lakes region to the Atlantic coast. Ruddy ducks were introduced to England in 1960 in Gloucestershire.

Biogeographic Regions: nearctic (Native ); palearctic (Introduced ); neotropical (Native )

  • Gooders, J., T. Boyer. 1986. Ducks of North America and the Northern Hemisphere. New York: Facts On File, Inc..
  • Pough, R. 1951. All the Birds of Eastern and Central North America. Garden City, New York: Doubleday & Company Inc..
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: BioKIDS Critter Catalog

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Physical Description

Morphology

The morphology of ruddy ducks varies between sexes as well as seasonally. During the summer male ruddy ducks have rich chestnut necks and bodies. The crown, nape, and tail, which are held erect or horizontal to the water, are dark brown. Males have pure white faces, whereas females have a dark line across the face. Females and juveniles have barred bodies that lack any chesnut coloring. During the winter, male ruddy ducks resemble females. Their pure white face remains the primary distinguishing characteristic. Ruddy ducks have large, spatulate, pale blue bills. Males tend to be larger than females in weight and wingspan. Males are 142 to 154 mm from wing tip to wing tip and weigh from 540 to 795 g. Females are 135 to 149 mm from wing tip to wing tip and weigh 310 to 650 g. Body length is from 35 to 43 cm.

Male ruddy ducks have two molts. The prenuptial molt occurs in the summer months and reveals a plumage that is similar to that of females. The postnuptial molt occurs from August to October and reveals their winter plumage of bright chestnut. During this time the bill becomes bright blue as well.

Range mass: 310 to 795 g.

Range length: 35 to 43 cm.

Range wingspan: 135 to 154 mm.

Other Physical Features: endothermic ; homoiothermic; bilateral symmetry

Sexual Dimorphism: male larger; sexes colored or patterned differently

  • Kortright, F. 1967. The Ducks, Geese, and Swans of North American. Harrisburg, Pennsylvania: The Stackpole Company.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Physical Description

Ruddy duck males and females are different in appearance, and males change appearance depending on the time of year. During the summer male ruddy ducks have rich chestnut necks and bodies. The crown, nape, and tail, which are held erect or horizontal to the water, are dark brown. Males have pure white faces. Females have a dark line across the face. Females and young ruddy ducks have barred bodies that lack any chestnut color. During the winter, male ruddy ducks resemble females except for their white face. Ruddy ducks have large, flat pale blue bills. Males tend to be larger than females in weight and wingspan.

In the summer male ruddy ducks look similar to females. In the winter male ruddy ducks have their breeding plumage, with rich, chestnut colored feathers. During this time their bill becomes bright blue as well.

Range mass: 310 to 795 g.

Range length: 35 to 43 cm.

Range wingspan: 135 to 154 mm.

Other Physical Features: endothermic ; homoiothermic; bilateral symmetry

Sexual Dimorphism: male larger; sexes colored or patterned differently

  • Kortright, F. 1967. The Ducks, Geese, and Swans of North American. Harrisburg, Pennsylvania: The Stackpole Company.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: BioKIDS Critter Catalog

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Size

Length: 38 cm

Weight: 590 grams

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Diagnostic Description

Differs from the masked duck in that males have white cheeks instead of black and females have a single dark cheek stripe rather than two cheek stripes on each side; ruddy duck lacks the conspicuous white wing patches (visible in flight) of the masked duck.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Ecology

Habitat

Ruddy ducks inhabit permanent freshwater marshes, lakes, and ponds during their breeding season. These pools contain a considerable amount of vegetation in which these ducks hide their nests. During the winter ruddy ducks prefer shallow marshes and coastal bays.

Habitat Regions: temperate ; saltwater or marine ; freshwater

Aquatic Biomes: lakes and ponds; coastal ; brackish water

Wetlands: marsh

Other Habitat Features: estuarine

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Habitat and Ecology

Habitat and Ecology
The species is partly migratory; North American breeders tend to depart from breeding grounds to winter further south or near the coast, whereas other populations are sedentary or make only short-distance movements. Freshwater swamps, lakes, pools, and marshes with emergent vegetation and open water are preferred breeding habitats, although outside the breeding season the species can also be found on larger lakes, brackish lagoons and estuaries (Carboneras 1992).

Systems
  • Terrestrial
  • Freshwater
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Comments: Marshes, lakes and coastal areas; when not breeding, on sheltered brackish and marine coastal areas as well as lakes and rivers (Temperate Zone) (AOU 1983). Nests on freshwater marshes, sloughs, lakes, and ponds, in areas where open water is bordered by dense aquatic vegetation. Nest is a floating structure of marsh plants hidden by growing plants. Often lays eggs in nests of other waterfowl species. May nest at potholes of less than an acre.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

marshes
  • North-West Atlantic Ocean species (NWARMS)
Creative Commons Attribution 3.0 (CC BY 3.0)

© WoRMS for SMEBD

Source: World Register of Marine Species

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Ruddy ducks inhabit permanent freshwater marshes, lakes, and ponds during their breeding season. These pools contain a considerable amount of vegetation in which these ducks hide their nests. During the winter ruddy ducks prefer shallow marshes and coastal bays.

Habitat Regions: temperate ; saltwater or marine ; freshwater

Aquatic Biomes: lakes and ponds; coastal ; brackish water

Wetlands: marsh

Other Habitat Features: estuarine

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: BioKIDS Critter Catalog

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Depth range based on 758 specimens in 1 taxon.

Environmental ranges
  Depth range (m): 0 - 0
 
Note: this information has not been validated. Check this *note*. Your feedback is most welcome.

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Migration

Non-Migrant: Yes. At least some populations of this species do not make significant seasonal migrations. Juvenile dispersal is not considered a migration.

Locally Migrant: Yes. At least some populations of this species make local extended movements (generally less than 200 km) at particular times of the year (e.g., to breeding or wintering grounds, to hibernation sites).

Locally Migrant: Yes. At least some populations of this species make annual migrations of over 200 km.

Migrates northward across the U.S. primarily March-April, southward late August-October. Generally resident within breeding range in Antilles and South America. Northern breeders winter south to Honduras (Hilty and Brown 1986). See Bellrose (1980) for further details on migration in North America.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Trophic Strategy

Ruddy ducks are omnivorous. Their diet consists primarily of aquatic invertebrates and vegetation. Their spatulate bill is used to sieve food material from mud taken in during diving. Primary plant material consumed includes angiosperm seeds and other green plants. Aquatic invertebrates constitute a fraction of the diet, depending on seasonal abundance, including mostly Crustacea and Chironomidae larvae and pupae.

Animal Foods: insects; mollusks; aquatic or marine worms; aquatic crustaceans

Plant Foods: leaves; seeds, grains, and nuts

Primary Diet: omnivore

  • Sanchez, M., A. Green, J. Dolz. 2000. The diets of the White-headed Duck Oxyura leucocephala, Ruddy Duck O. jamaicensis and their hybrids from Spain. Bird Study, 47: 275-284.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Comments: Diet varies with age, season, site (Bellrose 1976). Eats pondweeds, algae, wild celery; seeds of sedges, smartweeds, grasses; also eats insects and their larvae, shellfishes, crustaceans. During the breeding season in North Dakota, ate mainly invertebrates, primarily chironomid larvae and pupae (Woodin and Swanson 1989).

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Food Habits

Ruddy ducks are omnivorous. Their diet consists mainly of aquatic invertebrates and plants. Their wide bill is used to grab food when they dive and then sort out parts they want to eat. They mostly eat plant seeds, leaves of aquatic plants, Crustacea, and Chironomidae larvae and pupae.

Animal Foods: insects; mollusks; aquatic or marine worms; aquatic crustaceans

Plant Foods: leaves; seeds, grains, and nuts

  • Sanchez, M., A. Green, J. Dolz. 2000. The diets of the White-headed Duck Oxyura leucocephala, Ruddy Duck O. jamaicensis and their hybrids from Spain. Bird Study, 47: 275-284.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: BioKIDS Critter Catalog

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Associations

In the ecosystems in which they live, ruddy ducks act as predators on soft-bodied invertebrates such as chironomid midge larvae and crustaceans. They also eat aquatic vegetation. Ruddy ducks are preyed on by many organisms, including raccoons, mink, American crows, red-tailed hawks, and great horned owls.  Ruddy ducks are used as a host by parasites that reside in their intestinal tracts such as Polymorphus obtusus and Corynosoma constrictum. They also act as hosts to tapeworms such as Hymenolepis cyrtoides and Diorchis excentrica.

Since their introduction to Europe in the 1960s, ruddy ducks have also impacted ecosystems by threatening native white-headed ducks (Oxyura leucocephala). Their continuing spread throughout Europe threatens white-headed ducks through hybridization and competition for nesting sites and food. For this reason ruddy ducks are considered invasive and are hunted.

Commensal/Parasitic Species:

  • Munoz-Fuentes, V., A. Green, M. Sorenson, J. Negro. 2006. The ruddy duck Oxyura jamaicensis in Europe: natural colonization or human introduction?. Molecular Ecology, 15: 1441-1453.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Ruddy ducks have the ability to sink below the surface of the water. This adaptation allows them to elude predators. During breeding season they construct nests using surrounding vegetation. This provides shelter and camouflage to protect their eggs from known nest predators. Females may sometimes perform a display to distract predators away from nests. Females and nestlings are cryptically colored.

Eggs and nestlings are taken by predators such as racoons (Procyon lotor), mink (Neovison vison), American crows (Corvus brachyrhynchos), black-crowned night herons (Nycticorax nycticorax), ring-billed gulls (Larus delawarensis), and California gulls (Larus californicus). Adults are preyed on by red-tailed hawks (Buteo jamaicensis), great horned owls (Bubo virginianus), red foxes (Vulpes vulpes), mink (Neovison vison), and possibly Swainson's hawks (Buteo swainsoni). Ruddy ducks are also legally hunted in North America and Europe.

Known Predators:

Anti-predator Adaptations: cryptic

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Ecosystem Roles

In the ecosystems in which they live, ruddy ducks act as predators on soft-bodied invertebrates such as Chironomidae larvae and Crustacea. They also eat aquatic vegetation. Ruddy ducks are preyed on by many organisms, including raccoons, mink, American crows, red-tailed hawks, and great horned owls.  Ruddy ducks are used as a host by parasites that reside in their intestinal tracts.

Since their introduction to Europe in the 1960s, ruddy ducks have also impacted ecosystems by threatening native white-headed ducks (Oxyura_leucocephala).

Commensal/Parasitic Species:

  • Polymorphus_obtusus
  • Corynosoma_constrictum
  • Hymenolepis_cyrtoides
  • Diorchis_excentrica

  • Munoz-Fuentes, V., A. Green, M. Sorenson, J. Negro. 2006. The ruddy duck Oxyura_jamaicensis in Europe: natural colonization or human introduction?. Molecular Ecology, 15: 1441-1453.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: BioKIDS Critter Catalog

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Predation

Ruddy ducks have the ability to sink below the surface of the water to escape predators. During breeding season they make nests using vegetation, which camouflages nests and makes them more difficult for nest predators to find. Females and nestlings have drab feathers that help them blend in with their surroundings as well.

Eggs and nestlings are taken by predators such as Procyon lotor, Mustela vison, Corvus brachyrhynchos, Nycticorax nycticorax, Larus delawarensis, and Larus californicus. Adults are preyed on by Buteo jamaicensis, Bubo virginianus, Vulpes vulpes, Mustela vison, and possibly Buteo swainsoni. Ruddy ducks are also legally hunted in North America and Europe.

Known Predators:

  • racoons (Procyon_lotor)
  • mink (Mustela_vison)
  • American crows (Corvus_brachyrhynchos)
  • red-tailed hawks (Buteo_jamaicensis)
  • great horned owls (Bubo_virginianus)
  • humans (Homo_sapiens)
  • red foxes (Vulpes_vulpes)
  • black-crowned night herons (Nycticorax_nycticorax)
  • Swainson's hawks (Buteo_swainsoni)
  • ring-billed gulls (Larus_delawarensis)
  • California gulls (Larus_californicus)

Anti-predator Adaptations: cryptic

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: BioKIDS Critter Catalog

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Population Biology

Global Abundance

100,000 - 1,000,000 individuals

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Life History and Behavior

Behavior

Ruddy ducks usually don't make many calls or other sounds. During courtship, males perform an elaborate display accompanied by a call in order to attract a mate. The voice is as follows: chuck-chuck-chuck-chuck-chur-r-r; and ip-ip-ip-ip-u-cluck; and tick, tick, tick, tickety, quo-ack; as well as chica, chica, chica, chica, quak.

Communication Channels: visual ; acoustic

Perception Channels: visual ; tactile ; acoustic ; chemical

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Diet

aquatic plants, insects
  • North-West Atlantic Ocean species (NWARMS)
Creative Commons Attribution 3.0 (CC BY 3.0)

© WoRMS for SMEBD

Source: World Register of Marine Species

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Communication and Perception

Ruddy ducks usually don't make many calls or other sounds. During courtship, males perform an elaborate display accompanied by a call in order to attract a mate. Their calls sound like: chuck-chuck-chuck-chuck-chur-r-r; and ip-ip-ip-ip-u-cluck; and tick, tick, tick, tickety, quo-ack; as well as chica, chica, chica, chica, quak.

Communication Channels: visual ; acoustic

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: BioKIDS Critter Catalog

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Cyclicity

Comments: Basically diurnal but appears to migrate mostly at night.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Life Expectancy

The maximum lifespan of ruddy ducks in the wild is 13 years. However, in Great Britain, where the species is considered invasive, individuals rarely reach that age. According to the Global Invasive Species Database, those ducks banded and tracked in the wild rarely survive past 2 years. Those birds kept in captivity have an average lifespan of 2.4 years.

Range lifespan

Status: wild:
13 (high) years.

Average lifespan

Status: captivity:
2.4 years.

Average lifespan

Status: wild:
163 months.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Lifespan/Longevity

Althugh most ruddy ducks die when they are young, if they survive to adulthood they can live up to 13 years in the wild in their native range.

Range lifespan

Status: wild:
13 (high) years.

Average lifespan

Status: captivity:
2.4 years.

Average lifespan

Status: wild:
163 months.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: BioKIDS Critter Catalog

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Lifespan, longevity, and ageing

Maximum longevity: 13.6 years (wild)
Creative Commons Attribution 3.0 (CC BY 3.0)

© Joao Pedro de Magalhaes

Source: AnAge

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Reproduction

Ruddy ducks breed seasonally, migrating to breeding grounds in late winter. According to Gooders and Boyer (1986), they form pairs in late winter. However, it is unclear whether males are monogamous or polygamous. Following arrival at the breeding grounds, males perform a striking courtship display. To attract a female the male swims around her, his tail tilted forward and neck outstretched. He then slaps his chestnut-colored chest with his bright blue bill while making his courtship call. The male also uses his tail to stand and scoot across the surface of the water. When the female is satisfied with this performance, she stretches her neck with her bill open.

Mating System: monogamous ; polygynous

Ruddy ducks breed seasonally in spring and summer months, from May to August. Following arrival at the breeding grounds, females construct nests and platforms on which males and females can rest. The nest is typically constructed just above water level and among the previous year's vegetation. Females also use these materials to form a dome over the nest to protect it from being seen by predators.

Approximately 4 weeks after arriving at the breeding grounds, females are ready to nest. Siegfried (1976a) suggests that a female's readiness to lay eggs is sometimes poorly coordinated with the availability of suitable nesting sites. This may result in egg-dropping on the ground or in other birds' nests. This is observed frequently in Oxyura jamaicensis and is known as parasitic laying. Females lay 6 to 10 white eggs which are large, relative to the size of the bird. The incubation period lasts 23 to 26 days. Young are precocial, they are brooded in the nest for their first day after hatching, after which the parents lead them from the nest. At this point young ruddy ducks are capable of diving well and of aggressive behavior towards other birds. Parents abandon their brood 20 to 30 days following hatching. These young ducks do not reach the fledgling stage, however, until 50 to 55 days after hatching.

Breeding interval: Ruddy ducks breed once yearly.

Breeding season: Breeding is from May to August.

Range eggs per season: 6 to 10.

Range time to hatching: 23 to 26 days.

Range fledging age: 50 to 55 days.

Range time to independence: 20 to 30 days.

Average age at sexual or reproductive maturity (female): 1 years.

Average age at sexual or reproductive maturity (male): 1 years.

Key Reproductive Features: iteroparous ; seasonal breeding ; gonochoric/gonochoristic/dioecious (sexes separate); sexual ; oviparous

Average eggs per season: 8.

Female ruddy ducks invest heavily in young. This is evident in the care the female takes in constructing and covering the nest, the nutritional resources invested in each egg, and the time taken in incubation. Incubation lasts 23 to 26 days and is carried out solely by the female. From the time of hatching to 2 to 4 weeks of age the female is very attentive to the brood. She remains close during feeding and also exhibits aggressive behavior when ducks of other ages approach. Females also reduce the amount of time they spend diving while the young brood dives so as to watch over and protect them.

Male ruddy ducks show little or no parental investment. Males often abandon females during the incubation period. Males that remain with females through the incubation and hatchling period show no protective behavior toward their ducklings when they are harassed by other avian species.

Parental Investment: precocial ; pre-fertilization (Provisioning, Protecting: Female); pre-hatching/birth (Provisioning: Female, Protecting: Female); pre-weaning/fledging (Provisioning: Female, Protecting: Female)

  • Siegfried, W. 1976. Social Organization in Ruddy and Maccoa Ducks. Auk, 93: 560-570.
  • Joyner, D. 1977. Behavior of Ruddy Duck Broods in Utah. The Auk, 94: 343-349.
  • Gooders, J., T. Boyer. 1986. Ducks of North America and the Northern Hemisphere. New York: Facts On File, Inc..
  • Kortright, F. 1967. The Ducks, Geese, and Swans of North American. Harrisburg, Pennsylvania: The Stackpole Company.
  • Pough, R. 1951. All the Birds of Eastern and Central North America. Garden City, New York: Doubleday & Company Inc..
  • Hughes, B. 2006. "Global Invasive Species Database" (On-line). Accessed November 09, 2007 at http://www.invasivespecies.net/database/species/ecology.asp?si=152&fr=1&sts=.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

In much of the range, nest initiation extends from May through July. Clutch size averages about 8 in North America. Incubation, by female, lasts about 23-26 days. In some areas, male often accompanies female and brood. Young can fly at about 6-7 weeks (Manitoba). Probably not all yearling females breed. Generally has high nesting success (Bellrose 1980).

In Manitoba, 5 nests may occur on a 4-acre pothole. In Iowa, nesting density may range from 1 nest/5.5 acres to 1 nest/11 acres in different habitat types (see Bellrose 1980).

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Ruddy ducks breed seasonally. They migrate to breeding grounds in late winter. When they get to their breeding areas males begin to perform courtship displays. A male swims around a female with his tail tilted forward and neck outstretched. He then slaps his chestnut-colored chest with his bright blue bill while making a courtship call. The male also uses his tail to stand and scoot across the surface of the water. When the female is satisfied with this performance, she stretches her neck with her bill open.

Mating System: monogamous ; polygynous

Ruddy ducks breed in spring and summer months, from May to August. When they arrive on the breeding grounds, females construct nests of aquatic plants just above the water level. They often build a dome over the nest to hide it from predators. About 4 weeks after arriving at the breeding grounds, females are ready to nest. Sometimes, though, females are ready to lay eggs before they have finished their own nests and they may simply lay eggs in unprotected areas that hatch after 23 to 26 days. Young ruddy ducks are well developed when they hatch. They stay in the nest 1 day after hatching and then are led away from the nest and into the water. At this point young ruddy ducks can dive to find food and can defend themselves. Parents abandon their young 20 to 30 days after hatching, but it takes another 20 to 35 days after that for the young ruddy ducks to learn how to fly.

Breeding interval: Ruddy ducks breed once yearly.

Breeding season: Breeding is from May to August.

Range eggs per season: 6 to 10.

Range time to hatching: 23 to 26 days.

Range fledging age: 50 to 55 days.

Range time to independence: 20 to 30 days.

Average age at sexual or reproductive maturity (female): 1 years.

Average age at sexual or reproductive maturity (male): 1 years.

Key Reproductive Features: seasonal breeding ; gonochoric/gonochoristic/dioecious (sexes separate)

Average eggs per season: 8.

Female ruddy ducks construct and cover nests for their young, invest energy in making the eggs, and do all of the incubation of eggs. They also aggressively protect their young for several weeks after they hatch. Male ruddy ducks don't care for their young. They may remain near the female during incubation and after the young hatch, but they don't make any effort to protect or feed them.

Parental Investment: precocial ; pre-fertilization (Provisioning, Protecting: Female); pre-hatching/birth (Provisioning: Female, Protecting: Female); pre-weaning/fledging (Provisioning: Female, Protecting: Female)

  • Siegfried, W. 1976. Social Organization in Ruddy and Maccoa Ducks. Auk, 93: 560-570.
  • Joyner, D. 1977. Behavior of Ruddy Duck Broods in Utah. The Auk, 94: 343-349.
  • Gooders, J., T. Boyer. 1986. Ducks of North America and the Northern Hemisphere. New York: Facts On File, Inc..
  • Kortright, F. 1967. The Ducks, Geese, and Swans of North American. Harrisburg, Pennsylvania: The Stackpole Company.
  • Pough, R. 1951. All the Birds of Eastern and Central North America. Garden City, New York: Doubleday & Company Inc..
  • Hughes, B. 2006. "Global Invasive Species Database" (On-line). Accessed November 09, 2007 at http://www.invasivespecies.net/database/species/ecology.asp?si=152&fr=1&sts=.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: BioKIDS Critter Catalog

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Barcode data: Oxyura jamaicensis

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There are 6 barcode sequences available from BOLD and GenBank.

Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.

See the BOLD taxonomy browser for more complete information about this specimen and other sequences.

NNNCCTGTATANNNNNNNNGGGCATGANCAGNAATGATCGGCACCGCACTCAGCCTGCTAATTCGCGCAGAACTGGGTCAACCAGGAACTCTTCTAGGGGACGACCAGATCTACAACGTAATTGTCACCGCCCATGCCTTCGTAATGATCTTCTTCATGGTTATGCCAATCATAATCGGGGGATTCGGCAACTGACTAGTCCCTCTCATAATCGGCGCCCCTGATATGGCATTCCCTCGAATGAACAACATAAGCTTCTGACTCCTCCCACCTTCATTCCTCCTATTATTAGCCTCATCCACCGTAGAAGCCGGTGCCGGCACAGGGTGAACCGTCTATCCTCCCCTGGCAGGCAACCTAGCCCACGCCGGAGCCTCAGTGGACCTGGCCATCTTCTCCCTTCACCTAGCTGGTGTCTCGTCCATCCTCGGAGCCATCAATTTCATCACCACAGCCATCAACATAAAACCCCCCGCACTCTCACAATACCAAACACCCCTATTCGTCTGATCCGTCCTAATCACTGCCATCCTACTCCTCCTATCGCTCCCCGTACTAGCCGCCGGCATCACAATACTACTCACTGACCGAAACCTAAACACTACGTTCTTTGACCCTGCAGGAGGGGGAGACCCAATCCTGTATCAACACTTATTCTGATTCTTCGGACACCCAGAAGTCTACATCCTCATTCTG
-- end --

Download FASTA File

Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Statistics of barcoding coverage: Oxyura jamaicensis

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 3
Specimens with Barcodes: 5
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Conservation

Conservation Status

Ruddy duck populations are considered stable throughout their range, and are considered a species of "Least Concern" on the IUCN list.

US Migratory Bird Act: protected

US Federal List: no special status

CITES: no special status

State of Michigan List: no special status

IUCN Red List of Threatened Species: least concern

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

IUCN Red List Assessment


Red List Category
LC
Least Concern

Red List Criteria

Version
3.1

Year Assessed
2014

Assessor/s
BirdLife International

Reviewer/s
Butchart, S.

Contributor/s

Justification
This species has an extremely large range, and hence does not approach the thresholds for Vulnerable under the range size criterion (Extent of Occurrence <20,000 km2 combined with a declining or fluctuating range size, habitat extent/quality, or population size and a small number of locations or severe fragmentation). Despite the fact that the population trend appears to be decreasing, the decline is not believed to be sufficiently rapid to approach the thresholds for Vulnerable under the population trend criterion (>30% decline over ten years or three generations). The population size is very large, and hence does not approach the thresholds for Vulnerable under the population size criterion (<10,000 mature individuals with a continuing decline estimated to be >10% in ten years or three generations, or with a specified population structure). For these reasons the species is evaluated as Least Concern.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

National NatureServe Conservation Status

Canada

Rounded National Status Rank: N5B - Secure

United States

Rounded National Status Rank: N5B,N5N : N5B: Secure - Breeding, N5N: Secure - Nonbreeding

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

NatureServe Conservation Status

Rounded Global Status Rank: G5 - Secure

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Ruddy duck populations are considered stable throughout their range, and are considered a species of "Least Concern" on the IUCN list.

IUCN Red List of Threatened Species: least concern

US Migratory Bird Act: protected

US Federal List: no special status

CITES: no special status

State of Michigan List: no special status

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: BioKIDS Critter Catalog

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Population

Population Trend
Decreasing
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Threats

Comments: Past population declines are attributed to hunting, drought in the breeding range, and drainage of wetland breeding areas.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Relevance to Humans and Ecosystems

Benefits

There are no adverse effects of Oxyura jamaicensis on humans.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

In the past, ruddy ducks were hunted for the quality of their meat. There continues to be regulated sport hunting in the United States and Europe.

Positive Impacts: food

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Economic Importance for Humans: Negative

Ruddy ducks do not harm people.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: BioKIDS Critter Catalog

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Economic Importance for Humans: Positive

In the past, ruddy ducks were hunted for the quality of their meat. There continues to be regulated sport hunting in the United States and Europe.

Positive Impacts: food

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: BioKIDS Critter Catalog

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Wikipedia

Ruddy Duck

The ruddy duck (Oxyura jamaicensis) is a duck from North America and the Andes Mountains of South America, one of the stiff-tailed ducks.

Description[edit]

Adult males have a rust-red body, a blue bill, and a white face with a black cap. Adult females have a grey-brown body with a greyish face with a darker bill, cap and a cheek stripe. The southern subspecies ferruginea is occasionally considered a distinct species. It is separable by its all-black face and larger size. The subspecies andina has a varying amount of black coloration on its white face; it may in fact be nothing more than a hybrid population between the North American and the Andean ruddy duck. As the Colombian population is becoming scarce, it is necessary to clarify its taxonomic status, because it would be relevant for conservation purposes.[citation needed]

Breeding and habits[edit]

Their breeding habitat is marshy lakes and ponds. They nest in dense marsh vegetation near water. The female builds the nest out of grass, locating it in tall vegetation to hide it from predators. A typical brood contains 5 to 15 ducklings.[2] Pairs form each year.

They are migratory and winter in coastal bays and unfrozen lakes and ponds.

These birds dive and swim underwater. They mainly eat seeds and roots of aquatic plants, aquatic insects and crustaceans.

Male on the left, female on the right

As a result of escapes from wildfowl collections in the late 1950s, they became established in Great Britain, from where they spread into Europe. This duck's aggressive courting behaviour and willingness to interbreed with the endangered native white-headed duck (Oxyura leucocephala), of southern Europe, caused concern amongst Spanish conservationists. Due to this, a controversial scheme to extirpate the ruddy duck as a British breeding species started; there have also been culling attempts in other European countries.[3][4] By early 2014, the cull had reduced the British population to about 20–100, down from a peak of about 5500 in 2000.[5]

References[edit]

  1. ^ BirdLife International (2012). "Oxyura jamaicensis". IUCN Red List of Threatened Species. Version 2013.2. International Union for Conservation of Nature. Retrieved 26 November 2013. 
  2. ^ "Ruddy Duck Fact Sheet, Lincoln Park Zoo"
  3. ^ "R.I.P. Ruddy duck". BBC News. 3 March 2003. Retrieved 31 March 2014. 
  4. ^ Vidal, John (8 March 2012). "Final 100 ruddy ducks in the UK facing extermination". theguardian.com. Retrieved 31 March 2014. 
  5. ^ Langley, William (8 February 2014). "The ruddy ducks with nowhere left to hide". The Daily Telegraph. Retrieved 31 March 2014. 
Creative Commons Attribution Share Alike 3.0 (CC BY-SA 3.0)

Source: Wikipedia

Unreviewed

Article rating from 0 people

Default rating: 2.5 of 5

Names and Taxonomy

Taxonomy

Comments: O. FERRUGINEA (Andean Duck) formerly considered part of O. JAMAICENSIS (Sibley and Monroe 1990, AOU 1997). The population in the eastern Andes of Colombia is intermediate between JAMAICENSIS and FERRUGINEA and may be of hybrid origin, but Siegfried presented good evidence that it is a semispecies (treated as a race of O. JAMAICENSIS). The various species of OXYURA are sometimes regarded as a superspecies (O. LEUCOCEPHALA), but some forms are sympatric and relationships between species are uncertain (Sibley and Monroe 1990). See Livezey (1995) for a phylogeny of the Oxyurini based on morphology.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!