Articles on this page are available in 1 other language: Chinese (Simplified) (6) (learn more)

Overview

Brief Summary

Melanitta fusca

A medium-sized duck (21 inches), the male White-winged Scoter is most easily identified by its black body, white wing patches, and white eye-stripes. The female is dark brown rather than black, but retains this species’ characteristic white wing patches. Duck hunters often refer to scoters as “coots,” although their resemblance to “real” coots is limited to their shared dark body pattern and is entirely superficial. The White-winged Scoter inhabits a large part of the Northern Hemisphere. In the New World, this species breeds in western Canada and Alaska, wintering along the Pacific coast from Alaska south to Baja California, on the Atlantic coast from Newfoundland south to northern Florida, and along the Gulf coast from Florida to Texas. In the Old World (where it is known as the Velvet Scoter), this species breeds in northern Europe and Siberia, wintering along the coast of Western Europe and East Asia. White-winged Scoters breed in ponds and lakes in northern forest near the tree line at the edge of the tundra. In winter, this species may be found in saltwater estuaries, bays, and near-shore waters along the coast. White-winged Scoters primarily eat bottom-dwelling mollusks and crustaceans, but also eat fish and, in summer, insects as well. Due to the relative inaccessibility of this species’ breeding grounds, most birdwatchers are more familiar with White-winged Scoters during the winter. At this time of year, White-winged Scoters are most easily observed out at sea through binoculars or spotting scopes, and may be seen floating in large flocks on the water, diving below the surface in pursuit of prey, or flying in lines over the tops of the waves. This species is primarily active during the day.

Threat Status: Endangered

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Unknown

Supplier: DC Birds

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Distribution

occurs (regularly, as a native taxon) in multiple nations

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

National Distribution

Canada

Origin: Native

Regularity: Regularly occurring

Currently: Present

Confidence: Confident

Type of Residency: Year-round

United States

Origin: Native

Regularity: Regularly occurring

Currently: Present

Confidence: Confident

Type of Residency: Year-round

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Global Range: (>2,500,000 square km (greater than 1,000,000 square miles)) BREEDING: northern Eurasia; North America, from northern Alaska, northern Yukon, northwestern and southern Mackenzie, southern Keewatin, northern Manitoba, and northern Ontarion south through Alaska and most of western and central Canada; formerly nested in some western states adjacent to Canada; occurs in summer in areas farther east, possibly breeding (AOU 1983). NON-BREEDING: Eurasia; North America, along Pacific coast from Aleutians to northern Baja California, along Atlantic coast from Gulf of St. Lawrence to South Carolina, Great Lakes, casual in interior U.S. In the early 1990s, USFWS Winter Sea Duck Survey in eastern North America found the highest densities of scoters (all species) in Virginia, New York, Maine, and Massachusetts (descending order of abundance, Kehoe 1994).

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

North America; from Newfoundland to the Gulf of Mexico; rare migrant and winter visitor throughout the interior and south to Gulf Coast
  • North-West Atlantic Ocean species (NWARMS)
Creative Commons Attribution 3.0 (CC BY 3.0)

© WoRMS for SMEBD

Source: World Register of Marine Species

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Range Description

Melanitta fusca breeds in Scandinavia, from Norway and Sweden, into Finland and Estonia, and western Siberian Russia to the River Yenisey, and winters mostly in the Baltic Sea and along the coasts of Western Europe, including Estonia, Poland, Norway, Sweden, Denmark, Germany, United Kingdom, Ireland, France, Spain and Portugal (Kear 2005), accounting for the vast majority of the global population (Delany and Scott 2006). An estimated 1,500 birds winter in the Black Sea and Caucasus (Delany and Scott 2006), and are thought to be from breeding populations in Turkey, Armenia, Georgia and Turkmenistan (Kear 2005). Since surveys in 1992-1993, when the estimate of the north-west European wintering population was updated to c.1 million birds, an apparent decline of c.60% (3.7% annually) has been detected in the Baltic Sea, with counts in 2007-2009 putting the wintering population at c.373,000 individuals, down from c.933,000 in 1992-1993 (Skov et al. 2011). This is believed to represent a real decline in the species's population, rather than a shift in its geographic distribution, as other data sets corroborate this negative trend. The breeding population in Finland is in decline (at a rate of c.30% over 10 years [per M. Ellermaa in litt. 2012]), with the breeding population along the Baltic coast having decreased by c.50% between 1986 and 2010 (Aleksi Lehikoinen et al. in litt. 2012). A long term decline has been noted in numbers passing Hanko Bird Observatory in autumn (at a rate of c.50% over 30 years), but this decline stopped in 1995 (M. Ellermaa in litt. 2012). Similarly, numbers passing Vyborg (eastern Gulf of Finland) decreased from an average of 130 birds/hour in 1988-1994, to 55 birds/hour in 1995-1999, and 53 birds/hour in 2000-2008, although error margins may be considerable (J. Kontiokorpi in litt. 2012, A. Lehikoinen et al. in litt. 2012). Numbers recorded at Söderskär Bird Observatory have also been decreasing since the 1980s (A. Lehikoinen et al. in litt. 2012). The breeding population in Estonia is also noted to have declined between 1970 and 1990 (M. Ellermaa in litt. 2012). Numbers breeding and moulting in Kandalaksha State Nature Reserve, north-western Russia, have declined four-fold since c.2002 (V. V. Bianki and I. A. Kharitonova in litt. 2012).

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Physical Description

Size

Length: 53 cm

Weight: 1500 grams

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Ecology

Habitat

Comments: Nonbreeding: coastal salt and brackish waters, less commonly on inland fresh waters. Nests on islands or shores inland ponds, lakes or slow-moving streams in wooded, bushy, or overgrown sites, or, less commonly, in concealed or bare sites in open tundra or prairie. Strongly philopatric to nesting areas (Kehoe 1994).

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Habitat and Ecology

Habitat and Ecology
Behaviour This species is highly migratory (del Hoyo et al. 1992, Madge and Burn 1988) and breeds from mid-May onwards (Madge and Burn 1988) in solitary pairs or loose groups (del Hoyo et al. 1992, Kear 2005), occasionally nesting in association with gull or tern colonies (Kear 2005). Non-breeding birds spend the breeding season in flocks on open water (Flint et al. 1984). After breeding (from June onwards [Scott and Rose 1996]) the adults migrate to moulting sites(males travelling and moulting before the females) (Madge and Burn 1988), where they become flightless for 3-4 weeks (Scott and Rose 1996). When moulting and overwintering the species is highly sociable and can occur in large flocks (Madge and Burn 1988, Scott and Rose 1996) of several thousands of individuals (Scott and Rose 1996), although it is more common in small scattered groups of c.100 individuals (Snow and Perrins 1998). The species mainly forages by diving and may feed at depths of 30-40 m during the winter (del Hoyo et al. 1992). Habitat Breeding The species breeds on woodedcoastlines (Johnsgard 1978, Kear 2005), small freshwater lakes (del Hoyo et al. 1992, Snow and Perrins 1998, Kear 2005), pools and rivers (Snow and Perrins 1998) in northern coniferous forests (Johnsgard 1978, del Hoyo et al. 1992, Snow and Perrins 1998, Kear 2005), wooded Arctic tundra (del Hoyo et al. 1992, Snow and Perrins 1998) and alpine zones (Snow and Perrins 1998, Kear 2005), especially where there are boulder-covered or small rocky islands available for nesting with extensive herbaceous vegetation, shrubs and low trees (Johnsgard 1978, Kear 2005). Non-breeding The majority winter at sea on shallow inshore coastal waters (Madge and Burn 1988, del Hoyo et al. 1992), especially in estuaries or inlets where there are large mussel-beds (Snow and Perrins 1998). The species may also occur on freshwater lakes and estuaries during migration (Madge and Burn 1988, Kear 2005). Diet Its diet consists predominantly of molluscs, as well as crustaceans, worms, echinoderms (del Hoyo et al. 1992), amphipods, isopods (Kear 2005), small fish, and (in freshwater habitats) adult and larval insects (del Hoyo et al. 1992). The species may also consume plant material on its breeding grounds (del Hoyo et al. 1992) (e.g. leaves and shoots) (Flint et al. 1984). Breeding site The nest is a shallow depression positioned on the ground (del Hoyo et al. 1992) in tall grass, among hummocks or under bushes (Flint et al. 1984), usually within 100 m of open water (occasionally up to 2-3 km away) (Kear 2005). The species usually nests in solitary pairs (del Hoyo et al. 1992, Kear 2005), but it may form loose congregations (del Hoyo et al. 1992) (e.g. on islands [Kear 2005]) with neighbouring nests as close as 3 m apart (Snow and Perrins 1998), and will also nest in association with gull or tern colonies (Kear 2005).


Systems
  • Terrestrial
  • Freshwater
  • Marine
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Habitat and Ecology

Habitat and Ecology
Behaviour This species is highly migratory (del Hoyo et al. 1992, Madge and Burn 1988) and breeds from mid-May onwards (Madge and Burn 1988) in solitary pairs or loose groups (del Hoyo et al. 1992, Kear 2005), occasionally nesting in association with gull or tern colonies (Kear 2005). Non-breeding birds spend the breeding season in flocks on open water (Flint et al. 1984). After breeding (from June onwards [Scott and Rose 1996]) the adults migrate to moulting sites(males travelling and moulting before the females) (Madge and Burn 1988), where they become flightless for 3-4 weeks (Scott and Rose 1996). When moulting and overwintering the species is highly sociable and can occur in large flocks (Madge and Burn 1988, Scott and Rose 1996) of several thousands of individuals (Scott and Rose 1996), although it is more common in small scattered groups of c.100 individuals (Snow and Perrins 1998). The species mainly forages by diving and may feed at depths of 30-40 m during the winter (del Hoyo et al. 1992). Habitat Breeding The species breeds on woodedcoastlines (Johnsgard 1978, Kear 2005), small freshwater lakes (del Hoyo et al. 1992, Snow and Perrins 1998, Kear 2005), pools and rivers (Snow and Perrins 1998) in northern coniferous forests (Johnsgard 1978, del Hoyo et al. 1992, Snow and Perrins 1998, Kear 2005), wooded Arctic tundra (del Hoyo et al. 1992, Snow and Perrins 1998) and alpine zones (Snow and Perrins 1998, Kear 2005), especially where there are boulder-covered or small rocky islands available for nesting with extensive herbaceous vegetation, shrubs and low trees (Johnsgard 1978, Kear 2005). Non-breeding The majority winter at sea on shallow inshore coastal waters (Madge and Burn 1988, del Hoyo et al. 1992), especially in estuaries or inlets where there are large mussel-beds (Snow and Perrins 1998). The species may also occur on freshwater lakes and estuaries during migration (Madge and Burn 1988, Kear 2005). Diet Its diet consists predominantly of molluscs, as well as crustaceans, worms, echinoderms (del Hoyo et al. 1992), amphipods, isopods (Kear 2005), small fish, and (in freshwater habitats) adult and larval insects (del Hoyo et al. 1992). The species may also consume plant material on its breeding grounds (del Hoyo et al. 1992) (e.g. leaves and shoots) (Flint et al. 1984). Breeding site The nest is a shallow depression positioned on the ground (del Hoyo et al. 1992) in tall grass, among hummocks or under bushes (Flint et al. 1984), usually within 100 m of open water (occasionally up to 2-3 km away) (Kear 2005). The species usually nests in solitary pairs (del Hoyo et al. 1992, Kear 2005), but it may form loose congregations (del Hoyo et al. 1992) (e.g. on islands [Kear 2005]) with neighbouring nests as close as 3 m apart (Snow and Perrins 1998), and will also nest in association with gull or tern colonies (Kear 2005). It has been known to use artificial nestboxes (Madge and Burn 1988). Management information Experimental removal (extermination) of the nest predator American mink Neovison vison in the outer archipelago of south-west Finland resulted in an increase in the breeding density of this species (Nordstrom et al. 2002).


Systems
  • Terrestrial
  • Freshwater
  • Marine
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Depth range based on 12361 specimens in 2 taxa.
Water temperature and chemistry ranges based on 2245 samples.

Environmental ranges
  Depth range (m): 0 - 0
  Temperature range (°C): 0.733 - 21.498
  Nitrate (umol/L): 0.240 - 14.675
  Salinity (PPS): 5.715 - 35.018
  Oxygen (ml/l): 5.180 - 8.325
  Phosphate (umol/l): 0.231 - 0.763
  Silicate (umol/l): 1.318 - 16.169

Graphical representation

Temperature range (°C): 0.733 - 21.498

Nitrate (umol/L): 0.240 - 14.675

Salinity (PPS): 5.715 - 35.018

Oxygen (ml/l): 5.180 - 8.325

Phosphate (umol/l): 0.231 - 0.763

Silicate (umol/l): 1.318 - 16.169
 
Note: this information has not been validated. Check this *note*. Your feedback is most welcome.

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Migration

Non-Migrant: No. All populations of this species make significant seasonal migrations.

Locally Migrant: No. No populations of this species make local extended movements (generally less than 200 km) at particular times of the year (e.g., to breeding or wintering grounds, to hibernation sites).

Locally Migrant: Yes. At least some populations of this species make annual migrations of over 200 km.

Migrates northward from wintering grounds March-May; most arrive in breeding areas in Saskatchewan in early May. Begins migrating southward from breeding grounds August-November. Birds banded in summer in Saskatchewan were recovered on U.S. west coast, east coast, Gulf Coast, and Great Lakes. Males migrate to molting areas in early summer; these migrations poorly known.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Trophic Strategy

Comments: About 90% of adult diet is animal food; eats mollusks (especially blue mussel), crustaceans, some aquatic insects and fishes (Terres 1980). During summer also eats some plant food; pondweeds, bur reeds, etc. May forage to 12 m deep.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Population Biology

Global Abundance

100,000 to >1,000,000 individuals

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Life History and Behavior

Life Expectancy

Lifespan, longevity, and ageing

Maximum longevity: 21.4 years (wild)
Creative Commons Attribution 3.0 (CC BY 3.0)

© Joao Pedro de Magalhaes

Source: AnAge

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Reproduction

Nests relatively late. In Saskatchewan (53 degrees north lat.), nest initiation peaks in early June; mean hatch date in late July (Brown and Fredrickson 1989). Clutch size is 5-17 (average about 10). Takes up to 18 days to lay clutch of 10 eggs. Incubation, by female (male departs), lasts 25-31 days. Precocial young are tended by female, fledge in 8-10 weeks. In southern breeding range in Canada, most young do not fledge until mid-September. Takes at least 2 years to mature (Kehoe 1994). Available information indicates a relatively high nest success rate but low rate of duckling survival (Kehoe 1994).

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Statistics of barcoding coverage: Melanitta fusca

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 9
Specimens with Barcodes: 10
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Barcode data: Melanitta fusca

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There are 9 barcode sequences available from BOLD and GenBank.  Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.  See the BOLD taxonomy browser for more complete information about this specimen and other sequences.

TTATCTTCGGGGCATGAGCCGGAATGATTGGCACAGCACTCAGCCTGNTAATCCGCGCAGAACTCGGCCAACCAGGAACCCTCCTAGGCGATGACCAAATTTACAACGTAATCGTCACCGCCCACGCCTTTGTAATAATCTTCTTCATAGTAATGCCCATCATAATCGGGGGGTTTGGCAACTGATTAGTCCCCCTAATAATCGGCGCCCCTGACATAGCATTCCCGCGAATAAACAACATAAGCTTCTGGCTCCTCCCACCCTCATTCCTCCTACTACTCGCATCATCTACCGTAGAAGCTGGCGCCGGCACAGGCTGAACCGTATACCCACCCCTAGCAGGTAACCTAGCCCACGCCGGGGCCTCGGTAGACCTGGCTATCTTCTCACTCCACTTAGCTGGTATTTCCTCCATCCTCGGGGCCATCAACTTCATCACCACAGCTATCAACATAAAACCCCCCGCACTCTCACAGTACCAGACCCCACTTTTCGTCTGATCCGTCCTAATCACCGCTATCCTGCTCCTCCTATCACTCCCCGTCCTTGCCGCCGGCATCACAATGCTGCTAACCGACCGGAACCTGAACACCACATTCTTCGACCCCGCCGGAGGAGGAGACCCAATCCTGTACCAGCATCTATTCTGATTCTTCGGCCACCCAGAAGTCTACATCTTAATCCTCCCAGGATTTGGAAT
-- end --

Download FASTA File
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Conservation

Conservation Status

National NatureServe Conservation Status

Canada

Rounded National Status Rank: N5B,N5N : N5B: Secure - Breeding, N5N: Secure - Nonbreeding

United States

Rounded National Status Rank: N5B,N5N : N5B: Secure - Breeding, N5N: Secure - Nonbreeding

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

NatureServe Conservation Status

Rounded Global Status Rank: G5 - Secure

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

IUCN Red List Assessment


Red List Category
LC
Least Concern

Red List Criteria

Version
3.1

Year Assessed
2013

Assessor/s
BirdLife International

Reviewer/s
Butchart, S.

Contributor/s
Moores, N. & Pihl, S.

Justification
This species has an extremely large range, and hence does not approach the thresholds for Vulnerable under the range size criterion (Extent of Occurrence <20,000 km2 combined with a declining or fluctuating range size, habitat extent/quality, or population size and a small number of locations or severe fragmentation). Despite the fact that the population trend appears to be decreasing, the decline is not believed to be sufficiently rapid to approach the thresholds for Vulnerable under the population trend criterion (>30% decline over ten years or three generations). The population size is extremely large, and hence does not approach the thresholds for Vulnerable under the population size criterion (<10,000 mature individuals with a continuing decline estimated to be >10% in ten years or three generations, or with a specified population structure). For these reasons the species is evaluated as Least Concern.

History
  • 2012
    Least Concern
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

IUCN Red List Assessment


Red List Category
EN
Endangered

Red List Criteria
A2bcde+3cde+4bcde

Version
3.1

Year Assessed
2013

Assessor/s
BirdLife International

Reviewer/s
Butchart, S.

Contributor/s
Below, A., Bianki, V., Burfield, I., Ellermaa, M., Grishanov, G., Hario, M., Kharitonov, S., Kharitonova, I., Kondratyev, A., Kontiokorpi, J., Lehikoinen, A., Lehikoinen, E., Lehtiniemi, T., Mikkola-Roos, M., Pessa, J., Pihl, S., Rajasarkka, A., Tiainen, J. & Valkama, J.

Justification
This newly split species qualifies as Endangered because it is estimated to be undergoing a very rapid population decline. The causes of this decline, however, are not fully understood, and further research is needed to inform conservation actions.

History
  • 2012
    Endangered
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Status in Egypt

Accidental visitor.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Bibliotheca Alexandrina

Source: Bibliotheca Alexandrina - EOL Ar

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Population

Population
The global population has been estimated at 600,000-1,000,000 individuals (Delany and Scott 2006), probably including c.400,000-700,000 mature individuals, on the basis that they account for around 2/3 of the population.

Population Trend
Decreasing
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Population

Population
Surveys in 2007-2009 put the wintering population in the Baltic Sea at c.373,000 individuals (Skov et al. 2011), with perhaps a few thousand wintering along coasts elsewhere in Europe, and another c.1,500 wintering in the Black Sea and Caucasus (Delany and Scott 2006). On this basis, the total number of mature individuals (probably around 2/3 of the total population) is estimated at c.250,000.

Population Trend
Decreasing
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Threats

Degree of Threat: Low

Comments: Hydroelectric projects in Quebec and Labrador have had localized impacts on breeding habitat, but effects on the continental population probably have been small; urbanization and industrialization of many coastal bays and estuaries have degraded some winter habitat; chemical contamination and heavy metal accumulation of winter food supplies possibly may be affecting reproductive success of some populations (Kehoe 1994). Vulnerable to overharvest through hunting (Kehoe 1994).

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Major Threats
Moulting and wintering concentrations of this species are very susceptible to oil spills and other marine pollutants (del Hoyo et al. 1992, Kear 2005) (an oil spill could destroy a large proportion of the global population if it occurred in a key moulting or wintering area [Madge and Burn 1988]). The species is also susceptible to the effects of commercial exploitation of marine benthic organisms and shellfish (Kear 2005), and is threatened by drowning in fishing nets (del Hoyo et al. 1992, Kear 2005). It is threatened by habitat degradation as a result of the human exploitation of natural resources in the taiga and lower tundra regions of its breeding range (Kear 2005). It is susceptible to disturbance from tourism in remote coastal and freshwater habitats in its breeding range (Kear 2005), as well as disturbance from wind farms (wind turbines) (Garthe and Huppop 2004). The species is susceptible to avian influenza, so may be threatened by future outbreaks of the virus (Melville and Shortridge 2006).

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Major Threats
Moulting and wintering concentrations of this species are very susceptible to oil spills and other marine pollutants (Gorski et al. 1977, del Hoyo et al. 1992, Kear 2005, UICN France 2011) (an oil spill could destroy a large proportion of the global population if it occurred in a key moulting or wintering area [Madge and Burn 1988]). The species is also susceptible to the effects of commercial exploitation of marine benthic organisms and shellfish (Kear 2005), and is threatened by drowning in fishing nets (del Hoyo et al. 1992, Kear 2005). It is threatened by habitat degradation as a result of the human exploitation of natural resources in the taiga and lower tundra regions of its breeding range (Kear 2005), and by lake drainage for irrigation and hydroelectric power production (Armenia) (Balian et al. 2002). It is susceptible to disturbance from tourism in remote coastal and freshwater habitats in its breeding range (Kear 2005), as well as disturbance from wind farms (wind turbines) (Garthe and Huppop 2004). The species suffers predation from American mink Neovison vison on islands (Nordstrom et al. 2002) and is also susceptible to avian influenza, so may be threatened by future outbreaks of the virus (Melville and Shortridge 2006). Utilisation The species is a target of hunters in some areas (e.g. Bregnballe et al. 2006).

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Management

Conservation Actions

Conservation Actions
Conservation Actions Underway
No targeted conservation actions are known for this species, although numbers in some parts of its range (accounting for most of the population) have received monitoring in recent decades, and it occurs in some protected areas.

Conservation Actions Proposed
Continue to monitor numbers in both its breeding and wintering range. Carry out research into the causes of the recently detected decline. Increase the area of breeding habitat that is protected. Tackle potential causes of mortality in wintering birds, such as drowning in fishing nets.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Relevance to Humans and Ecosystems

Benefits

Economic Uses

Comments: In recent decades, annual harvest in eastern North America averaged 26,125 (39% in eastern Canada) (Kehoe 1994).

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Wikipedia

Velvet Scoter

The velvet scoter (Melanitta fusca), also called a velvet duck[2] or whitewing[citation needed] (not to be confused with the white-winged scoter), is a large sea duck, which breeds over the far north of Europe and Asia west of the Yenisey basin. A small, isolated population nests in eastern Turkey. The East Siberian and North American white-winged scoter is sometimes considered conspecific with the velvet scoter, and its two constituent subspecies are then known as M. f. stejnegeri and M. f. deglandi. Velvet and white-winged scoter, along with the surf scoter, are placed in the subgenus Melanitta, distinct from the subgenus Oidemia, black and common scoters.

It winters farther south in temperate zones, Europe as far south as Great Britain, and on the Black and Caspian Sea. Small numbers reach France and northern Spain. It forms large flocks on suitable coastal waters. These are tightly packed, and the birds tend to take off together.

The lined nest is built on the ground close to the sea, lakes or rivers, in woodland or tundra, and typically contains 7–9 eggs. This duck dives for crustaceans and molluscs.

It is characterised by its bulky shape and large bill. It is the largest scoter at 51–58 cm. The male is all black, except for white around the eye and a white speculum. It has a bulbous yellow bill with a black base. The females are brown birds with two pale patches on each side of the head and white wing patches.

The velvet scoter is one of the species to which the Agreement on the Conservation of African-Eurasian Migratory Waterbirds (AEWA) applies.

References[edit]

  1. ^ BirdLife International (2013). "Melanitta fusca". IUCN Red List of Threatened Species. Version 2013.2. International Union for Conservation of Nature. Retrieved 26 November 2013. 
  2. ^ Buczacki, Stefan (2005) Fauna Britannica, Hamlyn, London.
Creative Commons Attribution Share Alike 3.0 (CC BY-SA 3.0)

Source: Wikipedia

Unreviewed

Article rating from 0 people

Default rating: 2.5 of 5

Names and Taxonomy

Taxonomy

Comments: Regarded as two separate species by some authors: M. FUSCA, velvet scoter, and M. DEGLANDI, white-winged scoter, the latter also including the eastern Asiatic form M. STEJNEGERI (AOU 1998).

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!