Articles on this page are available in 1 other language: Dutch (1) (learn more)

Overview

Brief Summary

Eiders are bulky ducks with a large wedge-shaped bill. In fact, it is their bill and their flattened head that make them easy to identify. Males are unmistakeable with their black-white plumage and characteristic 'ah-hoo' call. Downy feathers from eiders are the best in the world. Females line their nests with this material. In Iceland, people gather the feathers for making comforters and pillows.
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© Copyright Ecomare

Source: Ecomare

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Distribution

Common eider populations nest mainly in the coastal high arctic regions of Canada and Siberia. Along the eastern coast of North America, common eiders breed as far south as Maine, and along the western coast of North America they breed as far south as the Alaskan Peninsula. During the winter, common eiders move south, rarely as far as Florida on the east coast and sometimes as far south as Washington on the west coast. Most common eiders, however, move primarily to Newfoundland and Cape Cod in the east and to the Aleutian Islands in the west.

Biogeographic Regions: nearctic (Native ); palearctic (Native )

Other Geographic Terms: holarctic

  • Ehrlich, P., D. Dobkin, D. Wheye. 1988. The Birder's Handbook: A Field Guide to the Natural History of North American Birds. New York: Simon and Schuster Inc.
  • Nuttal, T. 1929. Birds of the United States and Canada. Boston: Little, Brown, and Company.
  • Peterson, R. 1980. A Field Guide to the Birds East of the Rockies. United Sates of America: Roger Tory Peterson.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 1 person

Average rating: 4.0 of 5

Global Range: (>2,500,000 square km (greater than 1,000,000 square miles)) Breeding range extends from Alaska across the Arctic to Labrador and Greenland and south to Maine and New Hampshire; from Iceland, the Faroe Islands, Spitsbergen, and Franz Josef Land south to northern British Isles, northern Europe, and southern Scandinavia; and from Wrangel Island, New Siberian Islands, and northeastern Siberia south to Kamchatka and Commander Islands. Winter range in western North America extends from the ice pack south to the Aleutian Islands and Cook inlet and on the Pacific coast south to Washington and Oregon. Winter range in in eastern North America is in Hudson and James bays and from Labrador south to Long Island (New York). Winter range in the western Palearctic extends from the breeding range south to central Europe; and in eastern Eurasia south to Kamchatka (AOU 1998). In North America, concentrations occur around Cape Cod and Penobscot Bay, Maine (Root 1988). In the early 1990s, USFWS Winter Sea Duck Survey found the highest densities in Maine and Massachusetts (Kehoe 1994).

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 1 person

Average rating: 3.0 of 5

Range Description

The species is distributed over the northern coasts of Europe, North America, eastern Siberia and southern Greenland. It breeds in the Arctic and northern temperate regions, but its range expands during winter to as far south as New Jersey, southern Alaska (U.S.A.), the western Mediterranean and the southern tip of the Kamchatka Peninsula (Russia) (del Hoyo et al. 1992). There are four subspecies in North America:Pacific (S. mollissima v-nigra), American (S. m. dresseri), Hudson Bay (S. m. sedentaria), and Northern (S. m. borealis) (Bowman et al. 2015).

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

North America; from Greenland to Virginia
translation missing: en.license_cc_by_4_0

© WoRMS for SMEBD

Source: World Register of Marine Species

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

occurs (regularly, as a native taxon) in multiple nations

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

National Distribution

Canada

Origin: Native

Regularity: Regularly occurring

Currently: Present

Confidence: Confident

Type of Residency: Year-round

United States

Origin: Native

Regularity: Regularly occurring

Currently: Present

Confidence: Confident

Type of Residency: Year-round

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Physical Description

Morphology

Measuring, on average, between 53 to 60 cm (21 to 24 inches) common eiders are the largest ducks in the northern hemisphere. Although the weight of common eiders differs depending upon the individual’s sex and the time of year, they average about 1800 grams, with reported measurements being between 850 and 3025 grams.

Adult male common eiders are recognizable by their dramatic arrangement of black and white plumage. They are black on their underside and white on their back and forewings. The male common eider also has a predominantly white head, but it is crowned with black and they have a touch of light emerald green on the back and sides of their head. The adult female common eider is almost exclusively brownish or reddish-brown and is closely barred. Immature males begin their life grayish-brown in color, then become dusky with a white collar and eventually end up like their mature counterparts. The white plumage in adult males develops in irregular patterns.

Female Common Eiders blend in well with their environment, which is the vegetation on the offshore islands. Adult plumage patterns are not fully complete until they reach about three years of age. In the period of a single year, dramatic differences in the appearance of plumage occur, which is why there is a great diversity in appearance among individuals in any given flock.

Range mass: 850 to 3025 g.

Average mass: 1800 g.

Range length: 53 to 60 cm.

Sexual Dimorphism: sexes colored or patterned differently

Other Physical Features: endothermic ; bilateral symmetry

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Size

Length: 61 cm

Weight: 2218 grams

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Length: 60 cm., Wingspan: 65 cm.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Gulf of Maine - CoML

Source: Gulf of Maine Area Census of Marine Life

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Ecology

Habitat

Habitat and Ecology

Habitat and Ecology
The species breeds on offshore islands and islets (Kear 2005) along low-lying rocky coasts (del Hoyo et al. 1992), on coastal shores and spits, on islets in brackish and freshwater lagoons (Kear 2005), lakes and rivers (Johnsgard 1978) close to the sea (Kear 2005) or on tundra pools, rivers (del Hoyo et al. 1992) and lakes (Madge and Burn 1988) up to 5 or 6 km inland (Kear 2005). It shows a preference for boulder-strewn or grassy islands (Johnsgard 1978) with sheltered approaches that are safe from nest predators, although in the high Arctic where such shelter is unavailable more open sites must be used (in which case the species often nests in closely packed groups for protection) (Snow and Perrins 1998). The species typically moults on shallow marine or sheltered coastal waters (Kear 2005), and winters on shallow seashores, bays and estuaries (del Hoyo et al. 1992), especially where there are high abundances of benthic molluscs (Camphuysen et al. 2002, Ens 2006). It may also occur inland on freshwater lakes when on passage and during the winter (rarely) (Madge and Burn 1988).The nest is a slight hollow in the ground that is usually positioned in the shelter of rocks or vegetation but may also be in the open(del Hoyoet al.1992). Its diet consists predominantly of benthic molluscs although crustaceans (del Hoyo et al. 1992) (e.g. amphipods and isopods (Johnsgard 1978)), echinoderms, other marine invertebrates and fish may also be taken (del Hoyo et al. 1992). During the breeding season incubating females frequently complement their diet with algae, berries and the seeds and leaves of surrounding tundra plants (del Hoyo et al. 1992).The majority of this species is migratory (Flintet al.1984)(although it does not travel great distances) (Madge and Burn 1988, Snow and Perrins 1998), with some populations e.g. in Europe being largely sedentary (Scott and Rose 1996).


Systems
  • Terrestrial
  • Marine
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Depth range based on 1913 specimens in 3 taxa.
Water temperature and chemistry ranges based on 524 samples.

Environmental ranges
  Depth range (m): 0 - 0
  Temperature range (°C): -0.830 - 12.982
  Nitrate (umol/L): 0.703 - 16.868
  Salinity (PPS): 6.428 - 35.258
  Oxygen (ml/l): 6.154 - 8.556
  Phosphate (umol/l): 0.231 - 1.104
  Silicate (umol/l): 0.565 - 12.889

Graphical representation

Temperature range (°C): -0.830 - 12.982

Nitrate (umol/L): 0.703 - 16.868

Salinity (PPS): 6.428 - 35.258

Oxygen (ml/l): 6.154 - 8.556

Phosphate (umol/l): 0.231 - 1.104

Silicate (umol/l): 0.565 - 12.889
 
Note: this information has not been validated. Check this *note*. Your feedback is most welcome.
All rights reserved

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Common eiders nest mainly among the rocks surrounding the coastlines and in tundra, particularly on small offshore islands that are free of mammalian predators. Nests are often hidden in tall grasses to avoid predation.

Habitat Regions: temperate ; polar ; terrestrial

Terrestrial Biomes: tundra

Aquatic Biomes: coastal

  • Guillemette, M., J. Himmelman, R. Ydenberg. 1992. The role of energy intake in prey and habitat selection of Common Eider (Somateria mollissima) in winter: A risk-sensitive interpretation. Journal of Animal Ecology, 61: 599-610.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Comments: Nonbreeding habitat includes rocky seacoasts, bays, and estuaries. Rocks, sandbars, and ice are used as resting sites. In winter in the Gulf of St. Lawrence, eiders concentrated in areas with shallow water reefs and high prey density (Guillemette et al. 1993). Most migration is coastal. Nests are on the ground in grass or brush, usually close to salt water, often on an island or rocky headland or along the shore of a pond or lagoon. Nests often but not always are concealed by plants (forest, shrub, or herbaceous), rocks, logs, driftwood. Often nests are in the same site in successive years. See Blumton et al. (1988) for habitat suitability index model.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Depth range based on 1913 specimens in 3 taxa.
Water temperature and chemistry ranges based on 524 samples.

Environmental ranges
  Depth range (m): 0 - 0
  Temperature range (°C): -0.830 - 12.982
  Nitrate (umol/L): 0.703 - 16.868
  Salinity (PPS): 6.428 - 35.258
  Oxygen (ml/l): 6.154 - 8.556
  Phosphate (umol/l): 0.231 - 1.104
  Silicate (umol/l): 0.565 - 12.889

Graphical representation

Temperature range (°C): -0.830 - 12.982

Nitrate (umol/L): 0.703 - 16.868

Salinity (PPS): 6.428 - 35.258

Oxygen (ml/l): 6.154 - 8.556

Phosphate (umol/l): 0.231 - 1.104

Silicate (umol/l): 0.565 - 12.889
 
Note: this information has not been validated. Check this *note*. Your feedback is most welcome.

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Rocky coastlines, shoals, islands and ocean. Rarely seen on freshwater.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Gulf of Maine - CoML

Source: Gulf of Maine Area Census of Marine Life

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Migration

Non-Migrant: Yes. At least some populations of this species do not make significant seasonal migrations. Juvenile dispersal is not considered a migration.

Locally Migrant: Yes. At least some populations of this species make local extended movements (generally less than 200 km) at particular times of the year (e.g., to breeding or wintering grounds, to hibernation sites).

Locally Migrant: Yes. At least some populations of this species make annual migrations of over 200 km.

Some populations do not migrate, and in other populations migration may be partially facultative, depending on conditions. A nonmigratory population occurs in Hudson Bay, Ontario and Quebec (Bellrose 1980). Part of the female population in Maine is migratory, part is resident on or near breeding area (see Blumton et al. 1988).

Spring migration generally begins in March and extends into April for early nesters and to mid-June in arctic nesters. During June and July, males depart from breeding areas to molt (immatures and nonbreeding females may also undertake such migrations). Fall migration varies regionally but occurs mainly in October and November, though females and young may begin moving toward wintering areas in late August-early September(Johnson and Herter 1989). By mid-December most wintering populations have peaked in numbers.

Populations that nest in different areas (e.g., St. Lawrence Estuary, Gulf of St. Lawrence, and Atlantic coast) share the same wintering range (Krohn et al. 1992).

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Distance of migration varies depending on northern location of breeding area.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Gulf of Maine - CoML

Source: Gulf of Maine Area Census of Marine Life

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Trophic Strategy

The diet of common eiders consists almost exclusively of mollusks, echinoderms, crustaceans, and a few fish. Common eiders swallow their prey whole and then crush them with their gizzard. During the winter months, daylight is short-lived and so common eiders spend more than half of the day feeding.

Common eiders feed by diving into the water to collect food. This behavior is done in a systematic fashion, with the leaders diving first and the rest following behind. Feeding usually only lasts 15 to 30 minutes per session and afterwards the common eiders move inland to rest and digest their food. After regaining strength, they repeat the behavior; this occurs throughout the day. When temperatures drop drastically during the winter, common eiders expend less energy and may stop feeding to conserve energy. Also during this time, common eiders improve their energy levels by becoming more effective hunters. It has been shown that during the cold months, common eiders dive and collect larger prey.

Foods eaten include: mussels, clams, scallops, sea urchins, starfish, crabs and fish.

Animal Foods: fish; mollusks; aquatic crustaceans; echinoderms

Primary Diet: carnivore (Piscivore , Eats non-insect arthropods, Molluscivore , Eats other marine invertebrates)

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Comments: Eats mainly mollusks and crustaceans. Often feeds in fairly shallow waters around submerged ledges and reefs of rocky shores. In winter in the Gulf of St. Lawrence, Quebec, feeds on small blue mussels in kelp beds, on green sea urchins over urchin barrens, and on spider crabs and urchins over AGARUM beds (Guillemette et al. 1992).

Females do not feed during incubation; during initial part of breeding period, uses nutritional reserves accumulated in winter and in staging areas.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Mollusks, mostly mussels and other bivalves. Also eats crabs, other crustaceans, echinoderms, aquatic insects, fish, and some plant matter.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Gulf of Maine - CoML

Source: Gulf of Maine Area Census of Marine Life

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Associations

Common eiders have an impact on the prey they eat; they are also an important food source for their predators.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

The primary predators of common eiders are Arctic foxes (Vulpes lagopus) and various gulls (family Laridae). The gulls are perhaps more of a threat than the foxes. This is because common eiders tend to nest on islands, which don’t have land predators, but gulls can fly out to the islands with no trouble. Gulls prey on the eggs and the young of common eiders, and are a major threat to the survival of the young. The threat posed by the gulls is alleviated somewhat by the creching behavior of common eiders. Gulls do, however, still prey on common eiders even during creching. Gulls will follow the flock in flight and make various swoops into the crowd to try and snag a young duckling. Similarly, while on the ground, gulls will work together. One gull will hover over a common eider who is concealing her young next to her body causing the female to jump up and attack the gull. In doing this, the female exposes her young, allowing a gull on the ground to snatch it away.

Known Predators:

  • Artic foxes (Vulpes lagopus)
  • gulls (Laridae)

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Known predators

Somateria mollissima (Somateria mollissima eider juv.) is prey of:
Larus argentatus
Profilicollis botulus
Amidostomum
Psilostomum brevicolle
Catatropis terrucosa

Based on studies in:
Scotland (Estuarine)

This list may not be complete but is based on published studies.
  • Hall SJ, Raffaelli D (1991) Food-web patterns: lessons from a species-rich web. J Anim Ecol 60:823–842
  • Huxham M, Beany S, Raffaelli D (1996) Do parasites reduce the chances of triangulation in a real food web? Oikos 76:284–300
Creative Commons Attribution 3.0 (CC BY 3.0)

© SPIRE project

Source: SPIRE

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Known prey organisms

Somateria mollissima (Somateria mollissima eider juv.) preys on:
Crangon crangon
Mytilus edulis
Nereis diversicolor
Corophium volutator
Gammarus
Hydrobia ulvae
Littorina littorea
Macoma balthica

Based on studies in:
Scotland (Estuarine)

This list may not be complete but is based on published studies.
  • Hall SJ, Raffaelli D (1991) Food-web patterns: lessons from a species-rich web. J Anim Ecol 60:823–842
  • Huxham M, Beany S, Raffaelli D (1996) Do parasites reduce the chances of triangulation in a real food web? Oikos 76:284–300
Creative Commons Attribution 3.0 (CC BY 3.0)

© SPIRE project

Source: SPIRE

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Population Biology

Global Abundance

>1,000,000 individuals

Comments: In mid-1970's, North American population estimated at 1.5 to 2 million and winter population of western Europe and west Siberia estimated at 2 million; no estimates available for large populations in eastern Asia (Madge and Burn 1988). In northeastern North America, average annual fall flight in the mid-1980s tentatively was estimated at 311,000-376,000 birds (Krohn et al. 1992, Kehoe 1994); the annual number of nesting pairs in the mid-1990s was estimated at 71,000, with approximately 60% nesting in eastern Canada and 40% in Maine (Krohn et al. 1992). Breeding population in Maine was estimated at about 25,000 pairs in the late 1980s (Blumton et al. 1988), 28,000 pairs in 1989 (Krohn et al. 1992).

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

General Ecology

Predation by herring gull and great black-backed gull causes most nesting failures on islands in Maine, but eider nesting success may be enhanced in nests close to a gull colony (gulls defend area against other avian pradators). Arctic fox is sometimes an important predator on nesters in Alaska. Ravens, raccoons, and mink sometimes destroy nests. Annual survivorship of adult generally is relatively high, with sport hunting likely the major cause of mortality in the Atlantic flyway (Kehoe 1994).

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Life History and Behavior

Behavior

When courting a female in the spring, male common eiders use a series of loud, eerie calls to attract a female. These calls resemble a sort of slurred moaning "ow-ee-urr" sound.

Communication Channels: acoustic

Perception Channels: visual ; tactile ; acoustic ; chemical

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Life Expectancy

Although common eiders are capable of flight about 60 days after hatching, few young ever survive that long. Young are killed by predators, starvation, or exposure. If one duckling per couple lives long enough to make the migration flight in the fall, it is a good year. Even though this survival rate seems low, adult common eiders living in the wild have long lives, often as long as 20 years. Estimated survival rates among adults per year average from 80-95 percent.

Range lifespan

Status: wild:
20 (high) years.

Average lifespan

Status: wild:
271 months.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Lifespan, longevity, and ageing

Maximum longevity: 37.8 years (wild)
Creative Commons Attribution 3.0 (CC BY 3.0)

© Joao Pedro de Magalhaes

Source: AnAge

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Reproduction

Common eiders are monogamous. During the spring, courtship becomes very intense and lasts even after two common eiders have paired. This ensures a strong bond between the male and the female. When courting a female in the spring, male common eiders use a series of loud, eerie calls to attract a female. These calls resemble a sort of slurred moaning "ow-ee-urr" sound. Although many common eiders are already paired with a mate by the time they reach the breeding grounds, some do not pair until they get to the islands. Pairs of common eiders do not mate for life.

Mating System: monogamous

Female common eiders reach sexual maturity earlier than males. A female may be capable of reproduction when she is around two years of age, whereas a male takes three years to sexually mature.

Nesting begins in early summer; common eiders return to breeding islands as soon as the ice begins to melt. It takes a couple of days for a pair to choose a nesting site and prepare it. The female common eider plucks down from her own body to line a nest, in which she lays four to five eggs, on average (range 2 to 8). After the second or third egg is laid, the female begins incubation. Incubation lasts for about 25 days and is only done by the female. About 50 percent of common eider eggs hatch successfully. Young fledge after 30 to 50 days.

Breeding season: summer

Range eggs per season: 2 to 8.

Average eggs per season: 4.

Average time to hatching: 25 days.

Range fledging age: 30 to 50 days.

Range age at sexual or reproductive maturity (female): 2 to 3 years.

Average age at sexual or reproductive maturity (female): 3 years.

Range age at sexual or reproductive maturity (male): 2 to 3 years.

Average age at sexual or reproductive maturity (male): 3 years.

Key Reproductive Features: iteroparous ; seasonal breeding ; gonochoric/gonochoristic/dioecious (sexes separate); sexual ; oviparous

Average time to hatching: 28 days.

Average eggs per season: 4.

The female common eider plucks down from her own body to line a nest, in which she lays four to five eggs. After the second or third egg is laid, the female begins incubation. Incubation lasts for about 25 days and is only done by the female. Unlike most other seabirds, male common eiders do very little in raising the young. In fact, male common eiders leave to join male flocks once the female has begun incubation. Young fledge in about 30 to 50 days.

After mating, protecting the young from predators becomes one of the major priorities among most individuals in a flock. One of the most noticeable behaviors to provide protection from predators is creching behavior. Common eiders gather into large groups which distract predators and may help ducklings by reducing the gull’s ability to hunt effectively. By pooling into these large groups, common eiders reduce the area exposed to the predators and thus reduce the risk of a gull picking out a single individual in the group.

Parental Investment: no parental involvement; precocial ; pre-hatching/birth (Protecting: Female); pre-weaning/fledging (Provisioning: Female)

  • AKNHP, 1998. "AKNHP" (On-line). Accessed 03/02/04 at http://www.uaa.alaska.edu/enri/aknhp_web/biodiversity/zoological/spp_of_concern/spp_status_reports/ceider/ceider.html.
  • Bedard, J., J. Munro. 1977. Gull predation and creching behavior in the Common Eider. Journal of Animal Ecology, 46: 799-810.
  • Ehrlich, P., D. Dobkin, D. Wheye. 1988. The Birder's Handbook: A Field Guide to the Natural History of North American Birds. New York: Simon and Schuster Inc.
  • National Audubon Society, Inc., 2000. "Project Puffin, Virtual Puffin: An Interactive Tour of Eastern Egg Rock" (On-line). Accessed 02/03/04 at http://www.audubon.org/bird/puffin/virtual/eider.html.
  • Nuttal, T. 1929. Birds of the United States and Canada. Boston: Little, Brown, and Company.
  • Peterson, R. 1980. A Field Guide to the Birds East of the Rockies. United Sates of America: Roger Tory Peterson.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Nesting in Maine occurs from late April to early July. Nesting in the Beaufort Sea region begins in mid- to late June (Johnson and Herter 1989). Clutch size averages 3-5. Incubation, by the female, lasts 24-30 days. The female relies on endogenous energy reserves during incubation. Eggs hatch mainly mid- to late July (sometimes into August) in the region arctic of Alaska and Canada. Young are led to water soon after hatching, are tended by the female, soon join young of other broods, and are independent at around 60-75 days). Female first breeds at 2-3 years, generally not until at least 3 years old. Females rarely renest if the clutch is lost, unless loss occurs during laying or early incubation.

Common eiders commonly nest in loose aggregations or colonies (usually a few dozen pairs, but up to several thousand pairs in some areas). Females commonly deposit eggs in the nests of other females.

Female common eiders that nested successfully lead their young to water and may be accompanied by nonbreeding females that participate in chick protection. Broods often join to form "crèches" of up to many dozens of young. Once formed, a crèche tends to stay together throughout the brood rearing period, although some of the adult females attending it may depart.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Nest is built on the ground among rocks and plants near the water. Nest in colonies, sometimes associated with Arctic Terns or other seabirds. 3-5 eggs, incubated by the female for 24-25 days. Female tends young, sometimes several females watch each other's broods in a "creche."
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Gulf of Maine - CoML

Source: Gulf of Maine Area Census of Marine Life

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Barcode data: Somateria mollissima

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There are 14 barcode sequences available from BOLD and GenBank.

Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.

See the BOLD taxonomy browser for more complete information about this specimen and other sequences.

CTCCAACCCACAAAGACATTGGCACCCTATACCTTATCTTCGGAGCATGAGCCGGAATAATTGGCACAGCACTCAGCCTGCTAATCCGCGCAGAACTAGGACAACCCGGAACCCTCCTAGGTGATGACCAAATTTACAACGTAATCGTTACCGCCCACGCCTTTGTAATAATCTTTTTCATGGTAATGCCTATTATAATCGGAGGATTCGGCAACTGACTAGTCCCCCTAATAATCGGCGCCCCAGACATAGCATTCCCACGAATAAACAACATAAGCTTCTGACTCCTCCCACCATCATTCCTCCTACTGCTCGCCTCATCTACCGTAGAAGCCGGCGCTGGCACAGGCTGAACTGTGTACCCACCCCTAGCAGGCAACCTAGCCCACGCCGGAGCCTCAGTAGACCTGGCTATCTTCTCACTCCATTTAGCCGGTGTTTCCTCCATCCTCGGAGCCATTAACTTCATCACCACAGCCATCAACATAAAACCCCCCGCACTCTCACAGTACCAAACCCCCCTCTTTGTCTGATCCGTCCTAATCACCGCCATCCTACTCCTCCTATCACTCCCCGTCCTCGCCGCTGGCATCACAATACTACTAACTGACCGAAACCTAAACACCACATTCTTTGACCCTGCCGGGGGAGGAGACCCGATCCTGTACCAGCACCTATTTTGATTCTTCGGCCACCCAGAAGTCTACATCTTAATCCTCCCAGGATTTGGAATTATCTCCCACGTA
-- end --

Download FASTA File

Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Statistics of barcoding coverage: Somateria mollissima

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 14
Specimens with Barcodes: 16
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Conservation

Conservation Status

IUCN Red List Assessment


Red List Category
NT
Near Threatened

Red List Criteria

Version
3.1

Year Assessed
2015

Assessor/s
BirdLife International

Reviewer/s
Symes, A.

Contributor/s
Drysdale, A., Gudmundsson, G., Larsson, K., Meltofte, H., Petersen, I., Pihl, S. & Waltho, C.

Justification
This species has been uplisted to Near Threatened. Within Europe it has experienced moderate declines and these have not been compensated for by increases elsewhere in the species's range. Declines are thought to be driven by a range of threats including overharvesting of aquatic resources, pollution, disturbance and hunting. Should the declines be found to be more severe, or new information reveal declines in the S. m. sedentaria and S. m. borealis populations then the species would warrant uplisting; it almost meets the requirements for listing as threatened under criterion A4abcde.

History
  • 2012
    Least Concern (LC)
  • Least Concern (LC)
  • Least Concern (LC)
  • Least Concern (LC)
  • Lower Risk/least concern (LR/lc)
  • Lower Risk/least concern (LR/lc)
  • Lower Risk/least concern (LR/lc)
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5