Articles on this page are available in 1 other language: Dutch (1) (learn more)

Overview

Brief Summary

Eiders are bulky ducks with a large wedge-shaped bill. In fact, it is their bill and their flattened head that make them easy to identify. Males are unmistakeable with their black-white plumage and characteristic 'ah-hoo' call. Downy feathers from eiders are the best in the world. Females line their nests with this material. In Iceland, people gather the feathers for making comforters and pillows.
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© Copyright Ecomare

Source: Ecomare

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Distribution

Geographic Range

Common eider populations nest mainly in the coastal high arctic regions of Canada and Siberia. Along the eastern coast of North America, common eiders breed as far south as Maine, and along the western coast of North America they breed as far south as the Alaskan Peninsula. During the winter, common eiders move south, rarely as far as Florida on the east coast and sometimes as far south as Washington on the west coast. Most common eiders, however, move primarily to Newfoundland and Cape Cod in the east and to the Aleutian Islands in the west.

Biogeographic Regions: nearctic (Native ); palearctic (Native )

Other Geographic Terms: holarctic

  • Ehrlich, P., D. Dobkin, D. Wheye. 1988. The Birder's Handbook: A Field Guide to the Natural History of North American Birds. New York: Simon and Schuster Inc.
  • Nuttal, T. 1929. Birds of the United States and Canada. Boston: Little, Brown, and Company.
  • Peterson, R. 1980. A Field Guide to the Birds East of the Rockies. United Sates of America: Roger Tory Peterson.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 1 person

Average rating: 4.0 of 5

Global Range: (>2,500,000 square km (greater than 1,000,000 square miles)) Breeding range extends from Alaska across the Arctic to Labrador and Greenland and south to Maine and New Hampshire; from Iceland, the Faroe Islands, Spitsbergen, and Franz Josef Land south to northern British Isles, northern Europe, and southern Scandinavia; and from Wrangel Island, New Siberian Islands, and northeastern Siberia south to Kamchatka and Commander Islands. Winter range in western North America extends from the ice pack south to the Aleutian Islands and Cook inlet and on the Pacific coast south to Washington and Oregon. Winter range in in eastern North America is in Hudson and James bays and from Labrador south to Long Island (New York). Winter range in the western Palearctic extends from the breeding range south to central Europe; and in eastern Eurasia south to Kamchatka (AOU 1998). In North America, concentrations occur around Cape Cod and Penobscot Bay, Maine (Root 1988). In the early 1990s, USFWS Winter Sea Duck Survey found the highest densities in Maine and Massachusetts (Kehoe 1994).

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 1 person

Average rating: 3.0 of 5

Belgian Exclusive Economic Zone, European waters (ERMS scope), Gulf of Maine, Gulf of Mexico, Iceland, Irish Exclusive economic Zone, North West Atlantic, Polish Exclusive Economic Zone, Portuguese Exclusive Economic Zone, Spanish Exclusive Economic Zone, Swedish Exclusive Economic Zone, United Kingdom Exclusive Economic Zone, Wimereux
Creative Commons Attribution 3.0 (CC BY 3.0)

© WoRMS for SMEBD

Source: World Register of Marine Species

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

North America; from Greenland to Virginia
Creative Commons Attribution 3.0 (CC BY 3.0)

© WoRMS for SMEBD

Source: World Register of Marine Species

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Range Description

The Common Eider is distributed over the northern coasts of Europe, North America, eastern Siberia and southern Greenland. It breeds in the Arctic and northern temperate regions, but its range expands during winter to as far south as New Jersey, southern Alaska (USA), the western Mediterranean and the southern tip of the Kamchatka Peninsula (Russia)1.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

occurs (regularly, as a native taxon) in multiple nations

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

National Distribution

Canada

Origin: Native

Regularity: Regularly occurring

Currently: Present

Confidence: Confident

Type of Residency: Year-round

United States

Origin: Native

Regularity: Regularly occurring

Currently: Present

Confidence: Confident

Type of Residency: Year-round

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Physical Description

Morphology

Physical Description

Measuring, on average, between 53 to 60 cm (21 to 24 inches) common eiders are the largest ducks in the northern hemisphere. Although the weight of common eiders differs depending upon the individual’s sex and the time of year, they average about 1800 grams, with reported measurements being between 850 and 3025 grams.

Adult male common eiders are recognizable by their dramatic arrangement of black and white plumage. They are black on their underside and white on their back and forewings. The male common eider also has a predominantly white head, but it is crowned with black and they have a touch of light emerald green on the back and sides of their head. The adult female common eider is almost exclusively brownish or reddish-brown and is closely barred. Immature males begin their life grayish-brown in color, then become dusky with a white collar and eventually end up like their mature counterparts. The white plumage in adult males develops in irregular patterns.

Female Common Eiders blend in well with their environment, which is the vegetation on the offshore islands. Adult plumage patterns are not fully complete until they reach about three years of age. In the period of a single year, dramatic differences in the appearance of plumage occur, which is why there is a great diversity in appearance among individuals in any given flock.

Range mass: 850 to 3025 g.

Average mass: 1800 g.

Range length: 53 to 60 cm.

Sexual Dimorphism: sexes colored or patterned differently

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Size

Length: 61 cm

Weight: 2218 grams

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Length: 60 cm., Wingspan: 65 cm.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Gulf of Maine - CoML

Source: Gulf of Maine Area Census of Marine Life

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Ecology

Habitat

Habitat and Ecology

Habitat and Ecology
Behaviour The majority of this species is migratory6 (although it does not travel great distances)3, 7, with some populations e.g. in Europe being largely sedentary5. The species breeds from early-April (although the most northerly populations may not breed until mid-June)3, and generally nests in colonies1 of up to or occasionally more than 3,000 pairs7. The species may also nest within colonies of Arctic tern Sterna paradisaea7. The males and immature non-breeders of some populations may make extensive moult migrations to favoured areas where they form large moulting flocks7 while the females remain on the breeding grounds3, 7. The species passes the winter (from October to March) at sea, congregating in flocks6 that may be as large as many thousands of individuals2, 7. Habitat Breeding The species breeds on offshore islands and islets2 along low-lying rocky coasts1, on coastal shores and spits, on islets in brackish and freshwater lagoons2, lakes and rivers4 close to the sea2 or on tundra pools, rivers1 and lakes3 up to 5 or 6 km inland2. It shows a preference for boulder-strewn or grassy islands4 with sheltered approaches7 that are safe from nest predators7, although in the high Arctic where such shelter is unavailable more open sites must be used (in which case the species often nests in closely packed groups for protection)7. Non-breeding The species typically moults on shallow marine or sheltered coastal waters2, and winters on shallow seashores, bays and estuaries1, especially where there are high abundances of benthic molluscs9, 12. It may also occur inland on freshwater lakes when on passage and during the winter (rarely)3. Diet Its diet consists predominantly of benthic molluscs although crustaceans1 (e.g. amphipods and isopods)4, echinoderms, other marine invertebrates and fish may also be taken1. During the breeding season incubating females frequently complement their diet with algae, berries and the seeds and leaves of surrounding tundra plants1. Breeding site The nest is a slight hollow in the ground that is usually positioned in the shelter of rocks or vegetation but may also in the open1. The species is a colonial nester, often nesting at densities of up to 250 pairs per hectare, and there may be over 3,000 nests in some colonies7. The species may also nest in colonies of Arctic tern Sterna paradisaea for protection against predation7. Management information A study carried out in Canada found that in order to prevent reductions in nesting success as a result of disturbing and displacing incubating adults (thus increasing the likelihood of nest predation) researchers and wildlife managers should visit eider colonies as late as possible in the incubation period and avoid visiting colonies associated with high densities of eider egg predators13.

Systems
  • Terrestrial
  • Marine
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Common eiders nest mainly among the rocks surrounding the coastlines and in tundra, particularly on small offshore islands that are free of mammalian predators. Nests are often hidden in tall grasses to avoid predation.

Habitat Regions: temperate ; polar ; terrestrial

Terrestrial Biomes: tundra

Aquatic Biomes: coastal

  • Guillemette, M., J. Himmelman, R. Ydenberg. 1992. The role of energy intake in prey and habitat selection of Common Eider (Somateria mollissima) in winter: A risk-sensitive interpretation. Journal of Animal Ecology, 61: 599-610.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Depth range based on 1913 specimens in 3 taxa.
Water temperature and chemistry ranges based on 524 samples.

Environmental ranges
  Depth range (m): 0 - 0
  Temperature range (°C): -0.830 - 12.982
  Nitrate (umol/L): 0.703 - 16.868
  Salinity (PPS): 6.428 - 35.258
  Oxygen (ml/l): 6.154 - 8.556
  Phosphate (umol/l): 0.231 - 1.104
  Silicate (umol/l): 0.565 - 12.889

Graphical representation

Temperature range (°C): -0.830 - 12.982

Nitrate (umol/L): 0.703 - 16.868

Salinity (PPS): 6.428 - 35.258

Oxygen (ml/l): 6.154 - 8.556

Phosphate (umol/l): 0.231 - 1.104

Silicate (umol/l): 0.565 - 12.889
 
Note: this information has not been validated. Check this *note*. Your feedback is most welcome.
Public Domain

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Comments: Nonbreeding habitat includes rocky seacoasts, bays, and estuaries. Rocks, sandbars, and ice are used as resting sites. In winter in the Gulf of St. Lawrence, eiders concentrated in areas with shallow water reefs and high prey density (Guillemette et al. 1993). Most migration is coastal. Nests are on the ground in grass or brush, usually close to salt water, often on an island or rocky headland or along the shore of a pond or lagoon. Nests often but not always are concealed by plants (forest, shrub, or herbaceous), rocks, logs, driftwood. Often nests are in the same site in successive years. See Blumton et al. (1988) for habitat suitability index model.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Rocky coastlines, shoals, islands and ocean. Rarely seen on freshwater.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Gulf of Maine - CoML

Source: Gulf of Maine Area Census of Marine Life

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Stellwagen Bank Pelagic Community

 

The species associated with this page are major players in the pelagic ecosystem of the Stellwagen Bank National Marine Sanctuary. Stellwagen Bank is an undersea gravel and sand deposit stretching between Cape Cod and Cape Ann off the coast of Massachussets. Protected since 1993 as the region’s first National Marine Sanctuary, the bank is known primarily for whale-watching and commercial fishing of cod, lobster, hake, and other species (Eldredge 1993). 

Massachusetts Bay, and Stellwagen Bank in particular, show a marked concentration of biodiversity in comparison to the broader coastal North Atlantic. This diversity is supported from the bottom of the food chain. The pattern of currents and bathymetry in the area support high levels of phytoplankton productivity, which in turn support dense populations of schooling fish such as sand lance, herring, and mackerel, all important prey for larger fish, mammals, and seabirds (NOAA 2010). Sightings of many species of whales and seabirds are best predicted by spatial and temporal distribution of prey species (Jiang et al 2007; NOAA 2010), providing support for the theory that the region’s diversity is productivity-driven.

Stellwagen Bank is utilized as a significant migration stopover point for many species of shorebird. Summer visitors include Wilson’s storm-petrel, shearwaters, Arctic terns, and red phalaropes, while winter visitors include black-legged kittiwakes, great cormorants, Atlantic puffins, and razorbills. Various cormorants and gulls, the common murre, and the common eider all form significant breeding colonies in the sanctuary as well (NOAA 2010). The community of locally-breeding birds in particular is adversely affected by human activity. As land use along the shore changes and fishing activity increases, the prevalence of garbage and detritus favors gulls, especially herring and black-backed gulls. As gull survivorship increases, gulls begin to dominate competition for nesting sites, to the detriment of other species (NOAA 2010). 

In addition to various other cetaceans and pinnipeds, the world’s only remaining population of North Atlantic right whales summers in the Stellwagen Bank sanctuary. Right whales and other baleen whales feed on the abundant copepods and phytoplankton of the region, while toothed whales, pinnipeds, and belugas feed on fish and cephalopods (NOAA 2010). The greatest direct threats to cetaceans in the sanctuary are entanglement with fishing gear and death by vessel strikes (NOAA 2010), but a growing body of evidence suggests that noise pollution harms marine mammals by masking their acoustic communication and damaging their hearing (Clark et al 2009).

General threats to the ecosystem as a whole include overfishing and environmental contaminants. Fishing pressure in the Gulf of Maine area has three negative effects. First and most obviously, it reduces the abundance of fish species, harming both the fish and all organisms dependent on the fish as food sources. Secondly, human preference for large fish disproportionately damages the resilience of fish populations, as large females produce more abundant, higher quality eggs than small females. Third, by preferentially catching large fish, humans have exerted an intense selective pressure on food fish species for smaller body size. This extreme selective pressure has caused a selective sweep, diminishing the variation in gene pools of many commercial fisheries (NOAA 2010). While the waters of the SBNMS are significantly cleaner than Massachusetts Bay as a whole, elevated levels of PCBs have been measured in cetaceans and seabird eggs (NOAA 2010). Additionally, iron and copper leaching from the contaminated sediments of Boston Harbor occasionally reach the preserve (Li et al 2010). 


  • Clark CW, Ellison WT, Southall BL, Hatch L, Van Parijs SM, Frankel A, Ponirakis D. 2009. Acoustic masking in marine ecosystems: intuitions, analysis and implication. Inter-Research Marine Ecology Progress Series 395:201-222.
  • Eldredge, Maureen. 1993. Stellwagen Bank: New England’s first sanctuary. Oceanus 36:72.
  • Jiang M, Brown MW, Turner JT, Kenney RD, Mayo CA, Zhang Z, Zhou M. Springtime transport and retention of Calanus finmarchicus in Massachusetts and Cape Cod Bays, USA, and implications for right whale foraging. Marine Ecology 349:183-197.
  • Li L, Pala F, Mingshun J, Krahforst C, Wallace G. 2010. Three-dimensional modeling of Cu and Pb distributions in Boston Harbor, Massachusetts and Cape Cod Bays. Estuarine Coastal & Shelf Science. 88:450-463.
  • National Oceanographic & Atmospheric Administration. 2010. Stellwagen Bank National Marine Sanctary Final Management Plan and Environmental Assessment. “Section IV: Resource States” pp. 51-143. http://stellwagen.noaa.gov/management/fmp/pdfs/sbnms_fmp2010_lo.pdf
Creative Commons Attribution 3.0 (CC BY 3.0)

© Peter Everill

Supplier: Peter Everill

Unreviewed

Article rating from 0 people

Average rating: 2.5 of 5

Migration

Non-Migrant: Yes. At least some populations of this species do not make significant seasonal migrations. Juvenile dispersal is not considered a migration.

Locally Migrant: Yes. At least some populations of this species make local extended movements (generally less than 200 km) at particular times of the year (e.g., to breeding or wintering grounds, to hibernation sites).

Locally Migrant: Yes. At least some populations of this species make annual migrations of over 200 km.

Some populations do not migrate, and in other populations migration may be partially facultative, depending on conditions. A nonmigratory population occurs in Hudson Bay, Ontario and Quebec (Bellrose 1980). Part of the female population in Maine is migratory, part is resident on or near breeding area (see Blumton et al. 1988).

Spring migration generally begins in March and extends into April for early nesters and to mid-June in arctic nesters. During June and July, males depart from breeding areas to molt (immatures and nonbreeding females may also undertake such migrations). Fall migration varies regionally but occurs mainly in October and November, though females and young may begin moving toward wintering areas in late August-early September(Johnson and Herter 1989). By mid-December most wintering populations have peaked in numbers.

Populations that nest in different areas (e.g., St. Lawrence Estuary, Gulf of St. Lawrence, and Atlantic coast) share the same wintering range (Krohn et al. 1992).

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Distance of migration varies depending on northern location of breeding area.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Gulf of Maine - CoML

Source: Gulf of Maine Area Census of Marine Life

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Trophic Strategy

Food Habits

The diet of common eiders consists almost exclusively of mollusks, echinoderms, crustaceans, and a few fish. Common eiders swallow their prey whole and then crush them with their gizzard. During the winter months, daylight is short-lived and so common eiders spend more than half of the day feeding.

Common eiders feed by diving into the water to collect food. This behavior is done in a systematic fashion, with the leaders diving first and the rest following behind. Feeding usually only lasts 15 to 30 minutes per session and afterwards the common eiders move inland to rest and digest their food. After regaining strength, they repeat the behavior; this occurs throughout the day. When temperatures drop drastically during the winter, common eiders expend less energy and may stop feeding to conserve energy. Also during this time, common eiders improve their energy levels by becoming more effective hunters. It has been shown that during the cold months, common eiders dive and collect larger prey.

Foods eaten include: mussels, clams, scallops, sea urchins, starfish, crabs and fish.

Animal Foods: fish; mollusks; aquatic crustaceans; echinoderms

Primary Diet: carnivore (Piscivore , Eats non-insect arthropods, Molluscivore , Eats other marine invertebrates)

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Comments: Eats mainly mollusks and crustaceans. Often feeds in fairly shallow waters around submerged ledges and reefs of rocky shores. In winter in the Gulf of St. Lawrence, Quebec, feeds on small blue mussels in kelp beds, on green sea urchins over urchin barrens, and on spider crabs and urchins over Agarum beds (Guillemette et al. 1992).

Females do not feed during incubation; during initial part of breeding period, uses nutritional reserves accumulated in winter and in staging areas.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Mollusks, mostly mussels and other bivalves. Also eats crabs, other crustaceans, echinoderms, aquatic insects, fish, and some plant matter.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Gulf of Maine - CoML

Source: Gulf of Maine Area Census of Marine Life

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Associations

Ecosystem Roles

Common eiders have an impact on the prey they eat; they are also an important food source for their predators.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Predation

The primary predators of common eiders are Arctic foxes (Vulpes lagopus) and various gulls (family Laridae). The gulls are perhaps more of a threat than the foxes. This is because common eiders tend to nest on islands, which don’t have land predators, but gulls can fly out to the islands with no trouble. Gulls prey on the eggs and the young of common eiders, and are a major threat to the survival of the young. The threat posed by the gulls is alleviated somewhat by the creching behavior of common eiders. Gulls do, however, still prey on common eiders even during creching. Gulls will follow the flock in flight and make various swoops into the crowd to try and snag a young duckling. Similarly, while on the ground, gulls will work together. One gull will hover over a common eider who is concealing her young next to her body causing the female to jump up and attack the gull. In doing this, the female exposes her young, allowing a gull on the ground to snatch it away.

Known Predators:

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Known predators

Somateria mollissima (Somateria mollissima eider juv.) is prey of:
Larus argentatus
Profilicollis botulus
Amidostomum
Psilostomum brevicolle
Catatropis terrucosa

Based on studies in:
Scotland (Estuarine)

This list may not be complete but is based on published studies.
  • Hall SJ, Raffaelli D (1991) Food-web patterns: lessons from a species-rich web. J Anim Ecol 60:823–842
  • Huxham M, Beany S, Raffaelli D (1996) Do parasites reduce the chances of triangulation in a real food web? Oikos 76:284–300
Creative Commons Attribution 3.0 (CC BY 3.0)

© SPIRE project

Source: SPIRE

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Known prey organisms

Somateria mollissima (Somateria mollissima eider juv.) preys on:
Crangon crangon
Mytilus edulis
Nereis diversicolor
Corophium volutator
Gammarus
Hydrobia ulvae
Littorina littorea
Macoma balthica

Based on studies in:
Scotland (Estuarine)

This list may not be complete but is based on published studies.
  • Hall SJ, Raffaelli D (1991) Food-web patterns: lessons from a species-rich web. J Anim Ecol 60:823–842
  • Huxham M, Beany S, Raffaelli D (1996) Do parasites reduce the chances of triangulation in a real food web? Oikos 76:284–300
Creative Commons Attribution 3.0 (CC BY 3.0)

© SPIRE project

Source: SPIRE

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Population Biology

Global Abundance

>1,000,000 individuals

Comments: In mid-1970's, North American population estimated at 1.5 to 2 million and winter population of western Europe and west Siberia estimated at 2 million; no estimates available for large populations in eastern Asia (Madge and Burn 1988). In northeastern North America, average annual fall flight in the mid-1980s tentatively was estimated at 311,000-376,000 birds (Krohn et al. 1992, Kehoe 1994); the annual number of nesting pairs in the mid-1990s was estimated at 71,000, with approximately 60% nesting in eastern Canada and 40% in Maine (Krohn et al. 1992). Breeding population in Maine was estimated at about 25,000 pairs in the late 1980s (Blumton et al. 1988), 28,000 pairs in 1989 (Krohn et al. 1992).

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

General Ecology

Predation by herring gull and great black-backed gull causes most nesting failures on islands in Maine, but eider nesting success may be enhanced in nests close to a gull colony (gulls defend area against other avian pradators). Arctic fox is sometimes an important predator on nesters in Alaska. Ravens, raccoons, and mink sometimes destroy nests. Annual survivorship of adult generally is relatively high, with sport hunting likely the major cause of mortality in the Atlantic flyway (Kehoe 1994).

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Life History and Behavior

Behavior

Communication and Perception

When courting a female in the spring, male common eiders use a series of loud, eerie calls to attract a female. These calls resemble a sort of slurred moaning "ow-ee-urr" sound.

Communication Channels: acoustic

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Life Expectancy

Lifespan/Longevity

Although common eiders are capable of flight about 60 days after hatching, few young ever survive that long. Young are killed by predators, starvation, or exposure. If one duckling per couple lives long enough to make the migration flight in the fall, it is a good year. Even though this survival rate seems low, adult common eiders living in the wild have long lives, often as long as 20 years. Estimated survival rates among adults per year average from 80-95 percent.

Range lifespan

Status: wild:
20 (high) years.

Average lifespan

Status: wild:
271 months.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Lifespan, longevity, and ageing

Maximum longevity: 37.8 years (wild)
Creative Commons Attribution 3.0 (CC BY 3.0)

© Joao Pedro de Magalhaes

Source: AnAge

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Reproduction

Common eiders are monogamous. During the spring, courtship becomes very intense and lasts even after two common eiders have paired. This ensures a strong bond between the male and the female. When courting a female in the spring, male common eiders use a series of loud, eerie calls to attract a female. These calls resemble a sort of slurred moaning "ow-ee-urr" sound. Although many common eiders are already paired with a mate by the time they reach the breeding grounds, some do not pair until they get to the islands. Pairs of common eiders do not mate for life.

Mating System: monogamous

Female common eiders reach sexual maturity earlier than males. A female may be capable of reproduction when she is around two years of age, whereas a male takes three years to sexually mature.

Nesting begins in early summer; common eiders return to breeding islands as soon as the ice begins to melt. It takes a couple of days for a pair to choose a nesting site and prepare it. The female common eider plucks down from her own body to line a nest, in which she lays four to five eggs, on average (range 2 to 8). After the second or third egg is laid, the female begins incubation. Incubation lasts for about 25 days and is only done by the female. About 50 percent of common eider eggs hatch successfully. Young fledge after 30 to 50 days.

Breeding season: summer

Range eggs per season: 2 to 8.

Average eggs per season: 4.

Average time to hatching: 25 days.

Range fledging age: 30 to 50 days.

Range age at sexual or reproductive maturity (female): 2 to 3 years.

Average age at sexual or reproductive maturity (female): 3 years.

Range age at sexual or reproductive maturity (male): 2 to 3 years.

Average age at sexual or reproductive maturity (male): 3 years.

Key Reproductive Features: seasonal breeding ; gonochoric/gonochoristic/dioecious (sexes separate)

Average time to hatching: 28 days.

Average eggs per season: 4.

The female common eider plucks down from her own body to line a nest, in which she lays four to five eggs. After the second or third egg is laid, the female begins incubation. Incubation lasts for about 25 days and is only done by the female. Unlike most other seabirds, male common eiders do very little in raising the young. In fact, male common eiders leave to join male flocks once the female has begun incubation. Young fledge in about 30 to 50 days.

After mating, protecting the young from predators becomes one of the major priorities among most individuals in a flock. One of the most noticeable behaviors to provide protection from predators is creching behavior. Common eiders gather into large groups which distract predators and may help ducklings by reducing the gull’s ability to hunt effectively. By pooling into these large groups, common eiders reduce the area exposed to the predators and thus reduce the risk of a gull picking out a single individual in the group.

Parental Investment: no parental involvement; precocial ; pre-hatching/birth (Protecting: Female); pre-weaning/fledging (Provisioning: Female)

  • Bedard, J., J. Munro. 1977. Gull predation and creching behavior in the Common Eider. Journal of Animal Ecology, 46: 799-810.
  • Ehrlich, P., D. Dobkin, D. Wheye. 1988. The Birder's Handbook: A Field Guide to the Natural History of North American Birds. New York: Simon and Schuster Inc.
  • Nuttal, T. 1929. Birds of the United States and Canada. Boston: Little, Brown, and Company.
  • Peterson, R. 1980. A Field Guide to the Birds East of the Rockies. United Sates of America: Roger Tory Peterson.
  • AKNHP, 1998. "AKNHP" (On-line). Accessed 03/02/04 at http://www.uaa.alaska.edu/enri/aknhp_web/biodiversity/zoological/spp_of_concern/spp_status_reports/ceider/ceider.html.
  • National Audubon Society, Inc., 2000. "Project Puffin, Virtual Puffin: An Interactive Tour of Eastern Egg Rock" (On-line). Accessed 02/03/04 at http://www.audubon.org/bird/puffin/virtual/eider.html.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Nesting in Maine occurs from late April to early July. Nesting in the Beaufort Sea region begins in mid- to late June (Johnson and Herter 1989). Clutch size averages 3-5. Incubation, by the female, lasts 24-30 days. The female relies on endogenous energy reserves during incubation. Eggs hatch mainly mid- to late July (sometimes into August) in the region arctic of Alaska and Canada. Young are led to water soon after hatching, are tended by the female, soon join young of other broods, and are independent at around 60-75 days). Female first breeds at 2-3 years, generally not until at least 3 years old. Females rarely renest if the clutch is lost, unless loss occurs during laying or early incubation.

Common eiders commonly nest in loose aggregations or colonies (usually a few dozen pairs, but up to several thousand pairs in some areas). Females commonly deposit eggs in the nests of other females.

Female common eiders that nested successfully lead their young to water and may be accompanied by nonbreeding females that participate in chick protection. Broods often join to form "crèches" of up to many dozens of young. Once formed, a crèche tends to stay together throughout the brood rearing period, although some of the adult females attending it may depart.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Nest is built on the ground among rocks and plants near the water. Nest in colonies, sometimes associated with Arctic Terns or other seabirds. 3-5 eggs, incubated by the female for 24-25 days. Female tends young, sometimes several females watch each other's broods in a "creche."
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Gulf of Maine - CoML

Source: Gulf of Maine Area Census of Marine Life

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Barcode data: Somateria mollissima

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There are 14 barcode sequences available from BOLD and GenBank.  Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.  See the BOLD taxonomy browser for more complete information about this specimen and other sequences.

CTCCAACCCACAAAGACATTGGCACCCTATACCTTATCTTCGGAGCATGAGCCGGAATAATTGGCACAGCACTCAGCCTGCTAATCCGCGCAGAACTAGGACAACCCGGAACCCTCCTAGGTGATGACCAAATTTACAACGTAATCGTTACCGCCCACGCCTTTGTAATAATCTTTTTCATGGTAATGCCTATTATAATCGGAGGATTCGGCAACTGACTAGTCCCCCTAATAATCGGCGCCCCAGACATAGCATTCCCACGAATAAACAACATAAGCTTCTGACTCCTCCCACCATCATTCCTCCTACTGCTCGCCTCATCTACCGTAGAAGCCGGCGCTGGCACAGGCTGAACTGTGTACCCACCCCTAGCAGGCAACCTAGCCCACGCCGGAGCCTCAGTAGACCTGGCTATCTTCTCACTCCATTTAGCCGGTGTTTCCTCCATCCTCGGAGCCATTAACTTCATCACCACAGCCATCAACATAAAACCCCCCGCACTCTCACAGTACCAAACCCCCCTCTTTGTCTGATCCGTCCTAATCACCGCCATCCTACTCCTCCTATCACTCCCCGTCCTCGCCGCTGGCATCACAATACTACTAACTGACCGAAACCTAAACACCACATTCTTTGACCCTGCCGGGGGAGGAGACCCGATCCTGTACCAGCACCTATTTTGATTCTTCGGCCACCCAGAAGTCTACATCTTAATCCTCCCAGGATTTGGAATTATCTCCCACGTA
-- end --

Download FASTA File
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Statistics of barcoding coverage: Somateria mollissima

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 12
Specimens with Barcodes: 16
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Conservation

Conservation Status

IUCN Red List Assessment


Red List Category
LC
Least Concern

Red List Criteria

Version
3.1

Year Assessed
2009

Assessor/s
BirdLife International

Reviewer/s
Bird, J., Butchart, S.

Contributor/s
Pihl, S.

Justification
This species has an extremely large range, and hence does not approach the thresholds for Vulnerable under the range size criterion (Extent of Occurrence <20,000 km2 combined with a declining or fluctuating range size, habitat extent/quality, or population size and a small number of locations or severe fragmentation). The population trend is not known, but the population is not believed to be decreasing sufficiently rapidly to approach the thresholds under the population trend criterion (>30% decline over ten years or three generations). The population size is extremely large, and hence does not approach the thresholds for Vulnerable under the population size criterion (<10,000 mature individuals with a continuing decline estimated to be >10% in ten years or three generations, or with a specified population structure). For these reasons the species is evaluated as Least Concern.

History
  • 2008
    Least Concern
  • 2004
    Least Concern
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Common eider populations were dramatically reduced prior to hunting regulations in North America. Some places in Canada and the arctic north even saw local extinctions of common eiders. Since the hunting laws were enacted, these areas have been recolonized by common eiders; they have even extended their breeding ranges. Common eiders are protected under the US Migratory Bird Treaty Act.

US Migratory Bird Act: protected

US Federal List: no special status

CITES: no special status

State of Michigan List: no special status

IUCN Red List of Threatened Species: least concern

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

National NatureServe Conservation Status

Canada

Rounded National Status Rank: N5B,N5N : N5B: Secure - Breeding, N5N: Secure - Nonbreeding

United States

Rounded National Status Rank: N5B,N5N : N5B: Secure - Breeding, N5N: Secure - Nonbreeding

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

NatureServe Conservation Status

Rounded Global Status Rank: G5 - Secure

Reasons: Large geographic range, with many well-separated large sub-populations, and legal restrictions in most countries on perceived threats, suggest little immediate threat to species. Apparently declining in western Canadian Arctic.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

No official conservation status.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Gulf of Maine - CoML

Source: Gulf of Maine Area Census of Marine Life

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Global Short Term Trend: Relatively stable (=10% change)

Comments: Apparently significant declines in northern Alaska and the western Canadian Arctic, where standardized migration counts show a decline of 53% between 1976 and 1996 (Suydam et al. 2000). Possibly declining in eastern Siberia (Madge and Burn 1988). Increasing in St. Lawrence River estuary and gulf region (Hyslop and Kennedy 1992, Chapdelaine and Brousseau 1992). Periodic surveys in Maine suggest a population increase during 1960-1980; the number wintering in the eastern U.S. increased from about 59,000 in the 1960s to more than 126,000 in the 1980s; the population now appears to be stabilizing (Krohn et al. 1992). Data from the mid-winter inventory show a statistically significant increase from 1961 to 1994 for the DRESSERI race in coastal waters of the Atlantic Flyway (Kehoe 1996). European populations generally increasing (Madge and Burn 1988).

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Threats

Major Threats
The species is vulnerable to chronic coastal oil pollution8, especially oil spills1, 2, 8, in areas where large moulting and wintering concentrations occur1. It also comes into conflict with the shellfish aquaculture industry which depletes the species's food resources2, 8, 9 and has previously lead to mass starvation events due to the over-fishing of benthic molluscs (e.g. in the Dutch Wadden Sea)9, 12. On the breeding grounds disturbance from the development of mineral resources along the coast8 and from local shore-based activities (e.g. angling, dog-walking11 and scientific research13) increases the likelihood of predation on young11. Unregulated tourism and shipping also cause disturbance to the species on its wintering grounds8. The species commonly becomes entangled and drowned in monofilament nets2 (e.g. gillnets)15, and it is hunted unsustainably8 (e.g. in Denmark10 and Greenland15). Utilisation Populations of this species in the high Arctic are subject to shooting, especially in spring, by indigenous peoples for food2, 14. This subsistence hunting is likely to be sustainable at current levels14. The species is also shot for sport in North America (this harvest may exceed sustainable levels in some areas)2.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Degree of Threat: C : Not very threatened throughout its range, communities often provide natural resources that when exploited alter the composition and structure over the short-term, or communities are self-protecting because they are unsuitable for other uses

Comments: In the 19th century, nearly extirpated south of the Gulf of St. Lawrence due to egging and overharvest (Kehoe 1994). In northeastern North America, potential threats include increased hunting, coastal development, and commercial harvesting of eider foods (Krohn et al. 1992, Kehoe 1994, Kehoe 1996). At Cape Cod, Massachusetts, large numbers drowned after becoming entangled in nets surrounding clam culture floats (Hoopes 1992). Potential exists for mortality due to oil spills, particularly when birds concentrated in winter (Madge and Burn 1988).

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Management

Management Requirements: Krohn et al. (1992) recommended that the western Atlantic population be managed as one unit.

A major management concern in Maine is reducing human disturbance on nesting islands (disturbance results in increased loss of eggs to predators (see Blumton et al. 1988, Kehoe 1994).

In Atlantic Canada and Quebec, artificial nesting platforms are being used to minimize nest predation on certain nesting islands; effectiveness of platforms is unknown (Kehoe 1994).

Management Research Needs: More reliable and uniform rangewide population data are needed to establish useful management goals for the western Atlantic population (Krohn et al. 1992).

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Relevance to Humans and Ecosystems

Benefits

Economic Importance for Humans: Negative

There are no known adverse affects of common eiders on humans.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Economic Importance for Humans: Positive

Common eiders are widely known for their down feathers. Although they are also valued as a sport duck and for culinary purposes, their feathers have produced a multi-million dollar industry in some parts of the world. Common eider down can be collected from nests without disturbing the eggs or the well-being of the duck.

Positive Impacts: food ; body parts are source of valuable material

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Economic Uses

Comments: Predation of mussels by eiders on Maine coast has become a concern of growing aquaculture industry. Nest down is excellent insulator, has high market value; current production totals about 60,000 nests (Wildbird, February 1994, p. 35). In recent decades, annual harvest in eastern North America averaged 48,600 (46% in eastern Canada); in the U.S., harvest levels have been increasing steadily and may be nearing the maximum for sustainable populations (Kehoe 1994).

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Wikipedia

Common Eider

The Common Eider[pronunciation?] (Somateria mollissima) is a large (50–71 cm body length) sea-duck that is distributed over the northern coasts of Europe, North America and eastern Siberia. It breeds in Arctic and some northern temperate regions, but winters somewhat farther south in temperate zones, when it can form large flocks on coastal waters. It can fly at speeds up to 113 km/h (70 mph).[2]

The eider's nest is built close to the sea and is lined with the celebrated eiderdown, plucked from the female's breast. This soft and warm lining has long been harvested for filling pillows and quilts, but in more recent years has been largely replaced by down from domestic farm-geese and synthetic alternatives. Although eiderdown pillows or quilts are now a rarity, eiderdown harvesting continues and is sustainable, as it can be done after the ducklings leave the nest with no harm to the birds.

Contents

Description

The Common Eider is both the largest of the four eider species and the largest duck found in Europe and in North America (except for the Muscovy Duck which only reaches North America in a wild state in southernmost Texas). It measures 50 to 71 cm (20 to 28 in) in length, weighs 0.81 to 3.04 kg (1.8 to 6.7 lb) and spans 80–110 cm (31–43 in) across the wings.[3][4] It is characterized by its bulky shape and large, wedge-shaped bill. The male is unmistakable, with its black and white plumage and green nape. The female is a brown bird, but can still be readily distinguished from all ducks, except other eider species, on the basis of size and head shape. This duck's call is "ah-ooo". The species is often readily approachable.

Drakes of the European, eastern North American and Asia/western North American races can be distinguished by minor differences in plumage and bill colour. Some authorities place the subspecies v-nigra as a separate species.

This species dives for crustaceans and molluscs, with mussels being a favoured food. The eider will eat mussels by swallowing them whole; the shells are then crushed in their gizzard and excreted. When eating a crab, the Eider will remove all of its claws and legs, and then eat the body in a similar fashion.

It is abundant, with populations of about 1.5-2 million birds in both North America and Europe, and also large but unknown numbers in eastern Siberia (HBW).

A particularly famous colony of eiders lives on the Farne Islands in Northumberland, England. These birds were the subject of one of the first ever bird protection laws, established by Saint Cuthbert in the year 676. About 1,000 pairs still nest there every year. Because St. Cuthbert is the patron saint of Northumberland, it was natural that the eider should be chosen as the county's emblem bird; the birds are still often called Cuddy's ducks in the area, "Cuddy" being the familiar form of "Cuthbert".

In Canada's Hudson Bay, important eider die-offs were observed in the 1990s by local populations due to quickly changing ice flow patterns. The Canadian Wildlife Service has spent several years gathering up-to-date information on their populations, and preliminary results seem to show a population recovery.[5][6][7] The Common Eider is the object of a 2011 feature length documentary, People of a Feather, which studies the historical relationship between the Sanikiluaq community and eiders, as well as various aspects of their ecology. The director/cinematographer/biologist Joel Heath spent seven years on the project and writing biological articles on the Common Eider.[8][9]

The Common Eider is one of the species to which the Agreement on the Conservation of African-Eurasian Migratory Waterbirds (AEWA) applies.

Social behaviour

Small Eider Creche: three adult females over six ducklings at Biddeford Pool, ME

Eiders are colonial breeders. They nest on coastal islands in colonies ranging in size of less than 100 to upwards of 10,000-15,000 individuals.[10] Female eiders frequently exhibit a high degree of natal philopatry, where they return to breed on the same island where they were hatched. This can lead to a high degree of relatedness between individuals nesting on the same island, as well as the development of kin-based female social structures.[11] This relatedness has likely played a role in the evolution of co-operative breeding behaviours amongst eiders. Examples of these behaviours include laying eggs in the nests of related individuals [12] and crèching, where female eiders team up and share the work of rearing ducklings.[13]

Gallery

References

  1. ^ BirdLife International (2012). "Somateria mollissima". IUCN Red List of Threatened Species. Version 2012.1. International Union for Conservation of Nature. Retrieved 16 July 2012. 
  2. ^ http://www.thetravelalmanac.com/lists/birds-speed.htm
  3. ^ [1] (2011).
  4. ^ Ogilvie & Young, Wildfowl of the World. New Holland Publishers (2004), ISBN 978-1-84330-328-2
  5. ^ "Common Eider (Somateria mollissima)". Sea Duck Information Series. Retrieved 8 February 2012. 
  6. ^ D. Henri, H. G. Gilchrist and E. Peacock (2010). "Understanding and Managing Wildlife in Hudson Bay Under a Changing Climate: Some Recent Contributions From Inuit and Cree Ecological Knowledge". Earth and Environmental Sciences. Retrieved 8 February 2012. 
  7. ^ K.G. Chaulk,a G.J. Robertson,b, W.A. Montevecchic, (november 10). "Extinction, colonization, and distribution patterns of common eider populations nesting in a naturally fragmented landscape". Canadian Journal of Zoology. Retrieved 8 February 2012. 
  8. ^ "http://www.imdb.com/title/tt1929346/". Retrieved 8 February 2012. 
  9. ^ "http://www.peopleofafeather.com/". Retrieved 8 February 2012. 
  10. ^ Chapdelaine, G., P. Dupuis and A. Reed. 1986a. Distribution, abondance at fluctuation des populations d’eider à duvet dans l’estuaire et le golfe du Saint-Laurent. Pp. 6–19 in Eider ducks in Canada (A. Reed, ed.). Canadian Wildlife Service Report Series no. 47, Ottawa, ON.
  11. ^ McKinnon, L., H. G. Gilchrist, and K. T. Scribner. 2006. Genetic evidence for kin-based female social structure in common eiders (Somateria mollissima). Behavioral Ecology 17:614-621.
  12. ^ Andersson, M. and P. Waldeck. 2007. Host-parasite kinship in a female-philopatric bird population: evidence from relatedness trend analysis. Molecular Ecology 16:2797-2806.
  13. ^ Öst, Markus, Colin W. Clark, Mikael Kilpi, and Ron Ydenberg, "Parental effort and reproductive skew in coalitions of brood-rearing female common eiders." The American Naturalist: January 2007
  • Scientific discussion about recent hunting regulations on Greenland
Creative Commons Attribution Share Alike 3.0 (CC BY-SA 3.0)

 

Source: Wikipedia

Unreviewed

Article rating from 0 people

Average rating: 2.5 of 5

Names and Taxonomy

Taxonomy

Comments: Contains two groups: S. MOLLISSIMA of north Atlantic and western Europe and S. V-NIGRUM of the north Pacific (AOU 1998).

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!