Articles on this page are available in 1 other language: Chinese (Simplified) (5) (learn more)

Overview

Brief Summary

Clangula hyemalis

Although not quite as large or as white as the eiders (genus Somateria), the winter Long-tailed Duck is nonetheless one of the Northern Hemisphere’s paler species of sea ducks. During that part of the year, male Long-tailed Ducks have a white head and body with black wings, black tail, and black cheek patch, while females are pale gray-brown overall. In summer, however, both sexes of Long-tailed Duck become much darker, with the male loosing much of the white on its head and body. At all seasons, the Long-tailed Duck may be separated from other ducks in its range and habitat by its slim body, small head, and (in the male) long tail. The Long-tailed Duck inhabits large areas of the Northern Hemisphere. In North America, this species breeds from the Aleutian Islands in Alaska east to eastern Quebec and from the high Arctic south to the Hudson Bay. In winter, Long-tailed Ducks may be found along the Pacific coast from southern Alaska to Washington, in the southern part of the Hudson Bay, along the Atlantic coast from Newfoundland to Virginia, and on the Great Lakes. In the Old World, this species breeds in Greenland, Iceland, Northern Europe, and Russia, wintering south to Britain and northern Japan. In summer, Long-tailed Ducks breed on small ponds in tundra wetlands. During winter and on migration, this species may be found in offshore waters and on large freshwater lakes. The diet of the Long-tailed Duck varies by season; in summer, this species eats insects, crustaceans, and plant matter, while fish and mollusks play a larger role in winter. Due to the relative inaccessibility of their breeding grounds, most birdwatchers never observe Long-tailed Ducks during the summer months. They are much more accessible in winter and during migration, when they may be observed in small flocks offshore with the help of a powerful spotting scope. This species is primarily active during the day.

Threat Status: Vulnerable

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Unknown

Supplier: DC Birds

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Distribution

European waters (ERMS scope), Gulf of Maine, Gulf of Mexico, Irish Exclusive economic Zone, North West Atlantic, Polish Exclusive Economic Zone, Portuguese Exclusive Economic Zone, Spanish Exclusive Economic Zone, Swedish Exclusive Economic Zone, United Kingdom Exclusive Economic Zone, Wimereux
Creative Commons Attribution 3.0 (CC BY 3.0)

© WoRMS for SMEBD

Source: World Register of Marine Species

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Range

Coasts of Holarctic region.
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

 

Partner Web Site: Cornell Laboratory of Ornithology

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

North America; Oceania; range extends from Labrador to northern Florida
Creative Commons Attribution 3.0 (CC BY 3.0)

© WoRMS for SMEBD

Source: World Register of Marine Species

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Range Description

The Long-tailed Duck is circumpolar, breeding on the Arctic coasts of North America (Canada, Alaska, USA and Greenland), Europe (Iceland and Norway), and Asia (Russia). It winters at sea further south, as far as the United Kingdom, South Carolina and Washington in the United States, Korea on the Asian Pacific coast, and other areas including the Black Sea and Caspian Sea1. According to monitoring data from the Baltic Sea, where the western Siberian and northern European populations winter, the population there decreased by up to 70% between 1995 and 200914,15,16.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Geographic Range

Long-tailed ducks have a fairly large range compared to other waterfowl. Its biogeographic range, including breeding and non-breeding seasons, has been estimated to include 10,800,000 km2. Long-tailed ducks are residents of the circumpolar region and are regularly found breeding on the Arctic coasts of Canada, Alaska, United States of America, Greenland, Iceland, Norway, and Russia. They winter further south in the United Kingdom, North America, Korea and on the Black and Caspian Seas.

Biogeographic Regions: nearctic (Native ); palearctic (Native ); oriental (Native ); arctic ocean (Native ); atlantic ocean (Native ); pacific ocean (Native )

Other Geographic Terms: holarctic

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

occurs (regularly, as a native taxon) in multiple nations

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

National Distribution

Canada

Origin: Native

Regularity: Regularly occurring

Currently: Present

Confidence: Confident

Type of Residency: Year-round

United States

Origin: Native

Regularity: Regularly occurring

Currently: Present

Confidence: Confident

Type of Residency: Year-round

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Global Range: (>2,500,000 square km (greater than 1,000,000 square miles)) BREEDING: in North America, from northern coast of Alaska east across Canada to Ellesmere and Baffin Islands and northern Labrador south to southern and central Alaska, northwestern British Columbia, eastern and south-central MacKenzie and Keewatin, and Hudson and James Bays. In Palearctic from Greenland, Iceland, Spitsbergen, and Scandinavia east across Russia to Chukotski Peninsula, Anadyrland, Kamchatka, and the Commander Islands. NON-BREEDING: in North America, mainly on coasts from Aleutians to Washington and from northern Greenland to South Carolina; in the interior, primarily on the Great Lakes (AOU 1983). In winter the highest densities occur along the Aleutian Islands and in the Gulf of Saint Lawrence; other areas of abundance include Lake Michigan, the coast of Maine, Lake Ontario, and south-coastal British Columbia (Root 1988). In the early 1990s, USFWS Winter Sea Duck Survey in eastern North America found the highest densities in New Brunswick, Nova Scotia, Maine, and Maryland (Kehoe 1994).

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

High Arctic, Atlantic and Pacific coasts of North America, and the Great Lakes.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Gulf of Maine - CoML

Source: Gulf of Maine Area Census of Marine Life

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Physical Description

Morphology

Physical Description

Long-tailed ducks are mid-sized birds with long, dark tails and gray legs and feet. The species received its common name from the two long and slender tail-feathers that extend behind adult males. Plumage coloration and general size vary between adult males and females. While adult drakes range in size from 48 to 58 cm long, adult hens are between 38 and 43 cm long. Adult males weigh approximately 0.91 to 1.13 kg and adult females weigh about 0.68 to 0.91 kg. Long-tailed ducks of both sexes shift between three distinct plumages and adult males display an additional alternate plumage in the winter.

In the winter, adult males are white on their crowns, necks and throats that extend down to the breast. The white throat contrasts sharply with a large, black breast-band. Males also feature a gray patch surrounding their eyes, and a black patch that extends from their ears. Bills are dark with a pinkish band across the middle. Their bellies and undertail coverts are white. They exhibit black tail-feathers, rumps and backs. Wings are black with white scapulars at the base. Winter females have white faces, necks, and throats with brown crowns and brown ear patches. They also feature a broad breast-band, but it is brown in color. Their backs, wings and tails are also brown, while their bellies and undertail coverts are white. Females' bills are a dark blueish gray.

During the spring and summer, adult males feature black crowns, necks and throats that extend through the breast. Their backs, tails and wings remain black, but their scapulars are buff and mottled with black. Their gray eye patches remain, but are accented with white. Their bills are dark, with a blueish band. Spring females are overall brown, with brown faces and a small white patch surrounding each eye. They also often feature a white crescent across their lower necks. Their brown breast band extends further into the belly, but the undertail coverts remain white.

In late summer, males begin to develop a third plumage that is an intermediate between the winter and spring plumages. Their throats and necks become white and their bills develop a pink band.

Young long-tailed ducks look like miniature adult females, but young males begin to resemble adult males by late fall.

Range mass: 0.68 to 1.13 kg.

Range length: 38.1 to 58.4 cm.

Average wingspan: 70 cm.

Other Physical Features: endothermic ; homoiothermic; bilateral symmetry

Sexual Dimorphism: male larger; sexes colored or patterned differently

  • Bent, A. 1987. Life histories of North American wild fowl, Volumes 1-2. Toronto, Ontario: General Publishing Company, Ltd..
  • Murphy, D., D. Oster, D. Maas, J. Anderson, S. Hauge. 2001. Hunting Divers and Paddle Ducks: A Comprehensive Guide to More Than 30 Species. Chanhassen, MN: Creative Publishing International, Inc.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Size

Length: 56 cm

Weight: 932 grams

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Length: 41.5 cm., Wingspan: 70 cm.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Gulf of Maine - CoML

Source: Gulf of Maine Area Census of Marine Life

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Ecology

Habitat

Habitat and Ecology

Habitat and Ecology
Behaviour This species is fully migratory1 although its movements are poorly understood5. It breeds from late-May onwards3 in single pairs or loose groups1, 2, the males leaving the females soon after the start of incubation3 (between late-June and early-September) to gather in small flocks for a flightless moulting period5. Some populations undergo extensive moult migrations of up to 1,000 km, while others moult on waters near the breeding grounds3. Females moult between early-August and early-October on the breeding grounds5, often abandoning their young at the start of the moult (the ducklings then gather into large parentless groups)4. The southward autumn migration occurs from September to October after the post-breeding moult5 and non-breeders may oversummer in the wintering areas3. Outside of the breeding season the species is highly gregarious4, in winter gathering into large aggregations of perhaps several tens of thousands of individuals to roost or to feed in inshore and offshore waters1. The species regularly dives to depths of 3-10 m when foraging (maximum depth 50-60 m)2 and is diurnal2. Habitat Breeding The species breeds on marshy grass tundra in the high Arctic1, 6, especially where habitat mosaics are formed by hummocks and ridges together with moist depressions7, freshwater lakes1, 2, bogs1, slow rivers1, 3 or pools of standing water7. It generally avoids wooded tundra4, 7 but is common among willows or dwarf birch in the arctic-alpine zone (Scandinavia)7. The species also breeds on small rocky islands off mainland Arctic coasts and on larger offshore islands, using promontories, deltas7, coastal inlets1, 3 and islets in fjords (Greenland)7. Non-breeding The species winters at sea, generally far offshore1 in waters 10-35 m deep5, as well as in saline, brackish or fresh estuarine waters4, brackish lagoons1, and inland (very rarely) on large, deep freshwater lakes1. Diet The species showing a preference for marine foods during both the breeding and non-breeding seasons4, its diet consisting predominantly of animal matter7 such as crustaceans1 (e.g. amphipods2 and cladocerans4), molluscs, other marine invertebrates (e.g. echinoderms, worms) and fish1. The species also takes freshwater insects and insect larvae1 as well as plant material such as algae, grasses, and the seeds and fruits of tundra plants1. Breeding site The nest is a natural depression on dry ground positioned in the open, amongst vegetation1, partially hidden by overhanging boulders3 or under low shrubs4 (e.g. willows or dwarf birch)6 usually close to water3. Although it is not a colonial species some pairs may nest in loose groups, and the species may also nest in association with Artic Terns2.

Systems
  • Terrestrial
  • Freshwater
  • Marine
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Long-tailed ducks reside in a variety of habitats. Generally, they winter in the open ocean or large lakes and summer in pools or lakes in the tundra. They prefer to breed in habitats that provide both an aquatic and terrestrial environment in close proximity, for example: marshy grass tundra in the Arctic, deltas, promontories, coastal inlets and offshore islands are all suitable. Habitat mosaics with damp depressions such as bogs and pools of standing water are also popular breeding sites. A study of summer distributions of long-tailed ducks as well as related species found that shallow water habitats are preferred when individuals are molting. This may be because molting individuals require protection from predation and environmental elements such as wind, waves and ice while still having a constant and abundant food source. Non-breeding long-tailed ducks reside far offshore in fresh estuarine, saline, or brackish waters. Though rare, they can be found wintering on large and deep freshwater lakes.

Habitat Regions: temperate ; polar ; terrestrial ; saltwater or marine ; freshwater

Terrestrial Biomes: tundra ; taiga

Aquatic Biomes: pelagic ; lakes and ponds; coastal ; brackish water

Wetlands: marsh ; bog

Other Habitat Features: estuarine

  • ITIS Catalogue of Life. 2005. "Clnagula hyemalis (Linnaeus, 1758)" (On-line). Encyclopedia of Life. Accessed February 21, 2011 at http://www.eol.org/pages/1048978.
  • Fischer, J., W. Larned. 2004. Summer distribution of marine birds in the Wester Beaufort Sea. Arctic, 57/2: 143-159.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Depth range based on 7102 specimens in 1 taxon.
Water temperature and chemistry ranges based on 3140 samples.

Environmental ranges
  Depth range (m): 0 - 0
  Temperature range (°C): -0.858 - 17.743
  Nitrate (umol/L): 1.003 - 9.166
  Salinity (PPS): 5.715 - 35.374
  Oxygen (ml/l): 5.571 - 9.061
  Phosphate (umol/l): 0.231 - 1.104
  Silicate (umol/l): 0.565 - 12.889

Graphical representation

Temperature range (°C): -0.858 - 17.743

Nitrate (umol/L): 1.003 - 9.166

Salinity (PPS): 5.715 - 35.374

Oxygen (ml/l): 5.571 - 9.061

Phosphate (umol/l): 0.231 - 1.104

Silicate (umol/l): 0.565 - 12.889
 
Note: this information has not been validated. Check this *note*. Your feedback is most welcome.
Public Domain

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Comments: NON-BREEDING: coastal waters (e.g., rough water of rocky coasts, deep but calm bays and coves), large inland lakes and (less commonly) rivers. BREEDING: on lake islands and by pools in open tundra and taiga. Nest usually concealed in vegetation. Nest site selection apparently influenced by predation pressure from foxes, gulls, ravens, and jaegers.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Summer: Tundra pools and lakes. Winter: Open ocean and large lakes.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Gulf of Maine - CoML

Source: Gulf of Maine Area Census of Marine Life

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Migration

Non-Migrant: No. All populations of this species make significant seasonal migrations.

Locally Migrant: No. No populations of this species make local extended movements (generally less than 200 km) at particular times of the year (e.g., to breeding or wintering grounds, to hibernation sites).

Locally Migrant: Yes. At least some populations of this species make annual migrations of over 200 km.

Migrates northward to breeding grounds in March-April. Moves southward in fall, October-November (Terres 1980). Some that summer in northwestern Alaska spend the winter in eastern Asia. Passes through Bering Strait in large numbers in late April. Large numbers fly eastward to Beaufort Sea area breeding areas from western Alaska, some probably arrive from interior Alaska, others migrate from coastal British Columbia and/or Great Lakes region and arrive via Mackenzie Valley. Arrives along Beaufort Sea coast mid-May (in west) to early June (eastern part). In Beaufort Sea area, males and some nonbreeding females migrate in early summer to large lakes and coastal lagoons and form large molting flocks; remain through July and August (Johnson and Herter 1989). Fall migration in Beaufort Sea area begins with males in late August; females with broods move to coastal lagoons with freeze-up in September, begin migration late September or early October (Johnson and Herter 1989).

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Large flocks.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Gulf of Maine - CoML

Source: Gulf of Maine Area Census of Marine Life

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Trophic Strategy

Food Habits

Long-tailed ducks are generalists that consume a large variety of prey. Animal foods that are commonly eaten by long-tailed ducks include: crustaceans, mollusks, marine invertebrates, small fish, fish eggs, freshwater insects and insect larvae. Some plant material that is also consumed includes: algae, grasses, seeds and fruits in the tundra biome. Studies show that mature adults prefer marine animals. Specifically, they tend to eat blue muscles, Idotea baltica (isopods), northern lacuanas, and Amphipoda crustaceans which yield higher energy per gram of live mass than other available prey.

Mature adults typically forage diurnally, about 80% of the day, during the winter months. Usually, individuals dive with submerged times ranging from 25 to 60 s and pick epibenthos within 100 m of the shore. Since long-tailed ducks are relatively small when compared to their marine Anatidae counterparts, they must maintain a particular diet for physiological and thermoregulatory purposes.

Long-tailed ducks have several physical characteristics that make them successful predators. First, they have chisel-shaped bills that curve at the tip which would help grab epibenthos prey from their substrates. Second, long-tailed ducks have smaller bills, allowing them to efficiently pick small, motile crustaceans. Finally, the body shape and structure of mature adults aids in diving and agility in water, giving individuals a powerful advantage over their primarily cursorial or sessile prey.

Animal Foods: fish; eggs; insects; mollusks; terrestrial worms; aquatic crustaceans; echinoderms; other marine invertebrates

Plant Foods: leaves; seeds, grains, and nuts; fruit; algae

Primary Diet: carnivore (Eats other marine invertebrates)

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Comments: Feeds mainly on animal food; eats crustaceans, fishes and their eggs, mollusks, and aquatic insects. Also eats a variety of aquatic plants (roots, leaves, buds, seeds). May dive very deep to obtain food (Bellrose 1976). Euphyllopods appear to be an especially important food source for ducklings. Individuals in summer molting flocks feed in nearshore waters on MYSIS, Onisimus, and bivalve mollusks (Johnson and Herter 1989).

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Mollusks, crustaceans, insects, some small fish, fish eggs, and some plant matter.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Gulf of Maine - CoML

Source: Gulf of Maine Area Census of Marine Life

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Associations

Ecosystem Roles

Long-tailed ducks are important predators of crustaceans, mollusks, marine invertebrates and small fish in holarctic regions. Long-tailed ducks are also a significant food source for avian predators, such as gulls and jaegers, and terrestrial predators, such as roving dogs and foxes. They are vulnerable to diseases including recorded cases of avian botulism, avian influenza and avian cholera. Few studies have investigated parasitic, commensal or mutualistic relationships of long-tailed ducks.

  • North, N., S. Lair. 2006. Movements of Long-tailed Ducks wintering on Lake Ontario to breeding areas in Nanavut, Canada. Wilson Journal of Ornithology, 118/4: 494-501.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Predation

Long-tailed ducks are most vulnerable to predation on land: newly hatched ducklings, freshly laid eggs and molted, flightless adults have the highest mortality rates. Females camouflage their nests and lay eggs close to the water so when ducklings hatch, the dangerous journey to the water is shortened. Males remain on breeding grounds while females lay eggs to help defend the nest from predation. Newly molted males and females stay in flocks in an attempt to lessen the chance mortality just as ducklings travel in large creches before their fall migration.

Avian predators of long-tailed ducks include mew gulls, glaucous gulls, and jaegers. In coastal breeding grounds, Arctic foxes are common predators. When long-tailed ducks mate further inland, near freshwater lakes, red foxes become serious predators.

Known Predators:

Anti-predator Adaptations: cryptic

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Known predators

Clangula hyemalis (northern eider, long-tailed duck, red-throated diver) is prey of:
Stercorarius
Larus hyperboreus
Alopex lagopus

Based on studies in:
Norway: Spitsbergen (Coastal)

This list may not be complete but is based on published studies.
  • V. S. Summerhayes and C. S. Elton, Contributions to the ecology of Spitsbergen and Bear Island, J. Ecol. 11:214-286, from p. 232 (1923).
Creative Commons Attribution 3.0 (CC BY 3.0)

© SPIRE project

Source: SPIRE

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Known prey organisms

Clangula hyemalis (northern eider, long-tailed duck, red-throated diver) preys on:
Animalia
Diptera
Entomostraca
Rotifera
Tardigrada
Nematoda
Oligochaeta

Based on studies in:
Norway: Spitsbergen (Coastal)

This list may not be complete but is based on published studies.
  • V. S. Summerhayes and C. S. Elton, Contributions to the ecology of Spitsbergen and Bear Island, J. Ecol. 11:214-286, from p. 232 (1923).
Creative Commons Attribution 3.0 (CC BY 3.0)

© SPIRE project

Source: SPIRE

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Population Biology

Global Abundance

10,000 to >1,000,000 individuals

Comments: Global population very large, perhaps over 10 million individuals (Madge and Burn 1988).

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

General Ecology

Nonbreeding: may form very large concentrations, but tends to occur in small offshore flocks (Atlantic Flyway, Kehoe 1994).

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Life History and Behavior

Behavior

Communication and Perception

Long-tailed ducks have an extensive variation of calls that are used primarily for intra-species communication. A fairly vocal species in the Anatidae family, long-tailed ducks can make a variety of growling, clucking, squawking, and yodeling sounds. The calls of individuals have been described as guttural or nasal and are audible across fairly large distances. When mother long-tailed ducks lead their progeny to the nearest water sources, they use specific calls as cues for the young to dive in unison. Calls are also an integral part of mating. Males use a series of four or five calls in deep notes to advertise availability for mating. Females emit single calls or growls to acknowledge potential mates or respond to initial calls from males.

During the breeding season, males confront competitors through calls, physical contact, chases and visual cues such as spreading wings and tilting heads upward. Females defend young by spreading wings and splashing water, possibly to draw attention away from the vulnerable young individuals. Like most ducks, long-tailed ducks perceive their environment through visual, auditory, tactile and chemical stimuli.

Communication Channels: visual ; tactile ; acoustic

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Life Expectancy

Lifespan/Longevity

The average lifespan of long-tailed ducks is 15.3 years. A single case of an adult male reaching the age of 22 years in the wild has been reported. No extensive studies on lifespan in captivity have been conducted. Several studies suggest that longevity is linked to food availability, stable environment, absence of disease and toxic materials such as lead and mercury.

Average nesting success is 30% in long-tailed ducks and on average, 10% of ducklings survive to 30 days old. Duckling survival, however, is highly variable to location of breeding and fluctuations in breeding environment. Average survival post-nesting for females is approximately 74%.

Range lifespan

Status: wild:
22.7 (high) years.

Average lifespan

Status: wild:
15.3 years.

  • Schamber, J., P. Flint, J. Grand, H. Wilson, J. Morse. 2009. Population dynamics of Long-tailed Ducks breeding on the Yukon-Kuskokwim Delta, Alaska. Arctic, 62/2: 190-200.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Lifespan, longevity, and ageing

Maximum longevity: 22.7 years (wild)
Creative Commons Attribution 3.0 (CC BY 3.0)

© Joao Pedro de Magalhaes

Source: AnAge

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Reproduction

Like most members of the Anatidae family, long-tailed ducks are socially monogamous. Long-tailed ducks may breed in single pairs or loose groups. Breeding pairs can form as early as individuals reach the breeding grounds. Pairs can re-form for several years or individuals may select new mates each mating season. Breeding may be initiated before spring breeding plumage develops, but in most cases, breeding occurs after.

Long-tailed ducks engage in an elaborate courtship process, though sexual selection has only been studied superficially. Males will approach available females with an upright tail and bill held outwards, a few inches from the surface of the water. When closer to his potential mate, the male will bow and then pull his head back with his bill held upward. As he is lowering his head, he will emit calls. A series of four or five calls with deep notes have been observed. These calls often attract other males and they often physically fight and chase each other for the available female. Females call in response to initial calls from the males and hold their head close to their body to indicate availability. Females will then lead males to a mating location.

Mating System: monogamous

Breeding can begin as early as May, but varies depending on the location of the breeding ground and the presence of mates. Long-tailed ducks can begin mating as early as their second year after birth. They mate near open water, either freshwater or marine, and try to nest on dry ground hidden among rocks or under plant growth. Nests are bowl-shaped and constructed by the female. They consist of nearby grasses and females pluck down from their own bodies to line the nest.

Females usually lay 6 to 8 eggs: on average, laying one egg per day. Clutch sizes of up to 17 have been recorded, but this is likely the result brood parasitism as some females will lay eggs in other's nests. Females will raise one brood per season, but can lay eggs several times if unsuccessful. Since fall migration occurs relatively late, long-tailed ducks have a long breeding season and can attempt raising a brood several times. Once eggs are laid, the incubation period lasts from 24 to 30 days. Young ducklings remain in the nest until they fledge after 35 to 40 days. The fledglings form groups of 3 to 4 broods that are tended by older females.

Breeding interval: Long-tailed ducks breed once yearly.

Breeding season: Breeding usually occurs between May and July.

Range eggs per season: 5 to 11.

Range time to hatching: 24 to 30 days.

Range fledging age: 35 to 40 days.

Range age at sexual or reproductive maturity (female): 2 (high) years.

Range age at sexual or reproductive maturity (male): 2 (high) years.

Key Reproductive Features: seasonal breeding ; gonochoric/gonochoristic/dioecious (sexes separate)

While eggs are being laid, the male will reside in the open water and help defend the nest. During the incubation period between late June and early September, the male will leave and begin molting. The newly laid eggs are then incubated and defended by the female for 24 to 30 days. Although newly hatched young can feed themselves, they are fed and closely tended by their mother. When the young begin walking, the mother leads her brood over to the water and teaches them to dive for food. First flight can occur anywhere between 35 to 40 days old. Anywhere between August and October, the mothers will leave their young to molt and ducklings will gather into large groups in and around the water. These groups are often tended by slightly older females.

According to a study of body mass dynamics in adult females during incubation, females lose proportionately less mass and rely less on endogenous reserves to lay and incubate eggs than other diving ducks. Specifically, females lose approximately 7% of their mass during incubation: average weight is 618 g at clutch completion and then drops down to 575 g at hatching. Because females are relatively smaller than other waterfowl breeding in the tundra and have access to high-quality nutrients, long-tailed ducks are able to maintain high nesting attendance rates and constant incubation without losing too much of their endogenous reserves.

Parental Investment: precocial ; female parental care ; pre-fertilization (Provisioning, Protecting: Female); pre-hatching/birth (Provisioning: Female, Protecting: Male, Female); pre-weaning/fledging (Provisioning: Female, Protecting: Female); pre-independence (Provisioning: Female, Protecting: Female)

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Breeding begins late May in south to June in north. Egg laying peaks late June-early July at Arctic Natl. Wildl. Ref. Clutch size often 5-11 (usually 6-8). Incubation 25-26 days, by female (male departs). Most eggs hatch in 2nd half of June in Beaufort Sea area. Nestlings precocial and downy. Young tended by female, independent in about 5 weeks (Harrison 1978). Does not breed until at least 2 years old. According to Bellrose (1980), nest success is around 70% and brood survival data are lacking. Frequently nests in clusters or colonies. Nests per sq km in northern Alaska: 0.6-1.8 in different areas (Johnson and Herter 1989).

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

First breeds at 2 years old. Breeds near open water, nest is on dry ground hidden under plant growth or among rocks. 6-8 eggs, incubated by the female for 24-29 days. Young can feed themselves, and are tended by the female. First flight at 35-40 days old.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Gulf of Maine - CoML

Source: Gulf of Maine Area Census of Marine Life

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Barcode data: Clangula hyemalis

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There are 15 barcode sequences available from BOLD and GenBank.  Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.  See the BOLD taxonomy browser for more complete information about this specimen and other sequences.

CCCACAAAGACATTGGCACCTTATACCTTATCTTCGGAGCATGAGCCGGAATAATCGGCACCGCACTCAGCCTGCTAATCCGCGCAGAACTGGGCCAACCAGGAACCCTCCTGGGTGATGACCAAATTTACAATGTAATCGTCACCGCCCACGCATTTGTAATAATCTTCTTCATAGTAATGCCTATCATAATCGGAGGATTTGGCAACTGATTAGTCCCCCTAATAATCGGCGCCCCTGACATGGCATTCCCACGAATAAACAACATGAGCTTTTGACTCCTCCCACCCTCCTTCCTCTTACTGCTCGCCTCATCTACCGTAGAAGCTGGCGCTGGCACAGGCTGAACCGTATATCCGCCCCTAGCAGGCAACCTAGCCCACGCCGGAGCCTCAGTAGACCTAGCCATCTTCTCACTCCATCTAGCCGGTGTTTCCTCCATCCTCGGGGCCATCAACTTCATCACCACAGCCATTAACATAAAACCTCCCGCACTCTCACAATACCAAACCCCCCTTTTCGTCTGATCCGTCCTAATCACCGCCATCCTACTCCTCCTATCACTCCCCGTCCTCGCTGCCGGTATCACAATACTACTTACCGACCGAAATCTAAACACCACATTCTTTGACCCCGCCGGAGGGGGAGACCCAATCCTGTACCAACACCTGTTCTGATTCTTCGGCCACCCAGAAGTCTATATCCTAATCCTCCCAGGATTTGGAATTATCTCCCACGTA
-- end --

Download FASTA File
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Statistics of barcoding coverage: Clangula hyemalis

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 14
Specimens with Barcodes: 23
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Conservation

Conservation Status

IUCN Red List Assessment


Red List Category
LC
Least Concern

Red List Criteria

Version
3.1

Year Assessed
2011

Assessor/s
BirdLife International

Reviewer/s
Symes, A., Butchart, S.

Contributor/s
Pihl, S.

Justification
This species has an extremely large range, and hence does not approach the thresholds for Vulnerable under the range size criterion (Extent of Occurrence <20,000 km2 combined with a declining or fluctuating range size, habitat extent/quality, or population size and a small number of locations or severe fragmentation). Despite the fact that the population trend appears to be decreasing, the decline is not believed to be sufficiently rapid to approach the thresholds for Vulnerable under the population trend criterion (>30% decline over ten years or three generations). The population size is extremely large, and hence does not approach the thresholds for Vulnerable under the population size criterion (<10,000 mature individuals with a continuing decline estimated to be >10% in ten years or three generations, or with a specified population structure). For these reasons the species is evaluated as Least Concern.

History
  • 2009
    Least Concern
  • 2008
    Least Concern
  • 2004
    Least Concern
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Clangula hyemalis is the sole species of its genus, and thus is an interesting organism to study and protect. Although multiple references claim long-tailed ducks are the most prolific species of sea duck, population estimates are often unreliable and cursory. Though long-tailed ducks are fairly abundant, have a large geographic distribution and consume various animal and plant matter, estimated populations levels have been decreasing slightly over the last decade. In North America, the long-tailed duck population has declined by almost half in the last three decades. Because of wetland habitat degradation through petroleum pollution, drainage and peat extraction, important breeding sites for mature adults are being destroyed. There have also been reported cases of mortality from lead, mercury and oil pollution as well as entanglement in fishing nets. Long-tailed duck populations recently suffered significant losses because of an outbreak of avian cholera. Individuals are also believed to be susceptible to avian influenza. Currently, it is estimated that 6,200,000 to 6,800,000 mature individuals populate the arctic region.

US Migratory Bird Act: protected

US Federal List: no special status

CITES: no special status

State of Michigan List: no special status

IUCN Red List of Threatened Species: least concern

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

National NatureServe Conservation Status

Canada

Rounded National Status Rank: N5B,N5N : N5B: Secure - Breeding, N5N: Secure - Nonbreeding

United States

Rounded National Status Rank: N5B,N5N : N5B: Secure - Breeding, N5N: Secure - Nonbreeding

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

NatureServe Conservation Status

Rounded Global Status Rank: G5 - Secure

Reasons: Large geographic range and population size; relative immunity of arctic breeding grounds from human intrusion; tendency for non-breeding congregations to be found off-shore.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Sometimes caught in fishing nets. No official conservation status.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Gulf of Maine - CoML

Source: Gulf of Maine Area Census of Marine Life

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Global Short Term Trend: Relatively stable (=10% change)

Comments: No significant trend for wintering birds of the Atlantic Flyway, 1954-1994 (Kehoe 1996). A reliable population estimate for North America is not available; evident downward trend in breeding population may be inaccurate due to data weaknesses (Kehoe 1994).

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Threats

Major Threats
The species is threatened by wetland habitat degradation and loss from petroleum pollution, wetland drainage and peat-extraction9. It is also threatened with direct mortality from oil pollution1, 12, 13, drowning through entanglement in fishing nets1, 12 and from hunting on migration routes over certain regions of the Arctic1. The species has previously suffered heavy losses from an outbreak of avian cholera10 and is susceptible to avian influenza11 so may be threatened by future outbreaks of these diseases. Utilisation The species is hunted for sport in Denmark8.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Degree of Threat: C : Not very threatened throughout its range, communities often provide natural resources that when exploited alter the composition and structure over the short-term, or communities are self-protecting because they are unsuitable for other uses

Comments: Potentially vulnerable to oil spills, especially when concentrated in large flocks in non-breeding season. Small numbers killed by hunting or entangelement in fishing nets (Madge and Burns 1988), though potentially less susceptible to harvest than other species (Kehoe 1996). In the Atlantic Flyway, winter habitat has been affected by urbanization and industrialization, but effect on populations is unknown (Kehoe 1994).

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Relevance to Humans and Ecosystems

Benefits

Economic Importance for Humans: Negative

There are no known direct adverse effects of long-tailed ducks on humans.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Economic Importance for Humans: Positive

Long-tailed ducks help regulate populations of prey species including insects, mollusks and crustaceans. The species is hunted for sport in Denmark. Eggs and adults are part of the traditional diet of some Inuit communities.

Positive Impacts: food

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Economic Uses

Comments: In recent decades, annual harvest in eastern North America averaged 25,730 (46% in eastern Canada); harvest has been increasing in the U.S.; regularly harvested south to Virginia (Kehoe 1994).

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Wikipedia

Long-tailed Duck

The Long-tailed Duck or Oldsquaw (Clangula hyemalis) is a medium-sized sea duck. It is the only living member of its genus, Clangula; this was formerly used for the goldeneyes, with the Long-tailed Duck being placed in Harelda. An undescribed congener is known from the Middle Miocene Sajóvölgyi Formation (Late Badenian, 13–12 Mya) of Mátraszõlõs, Hungary.[2]

Description [edit]

Female
Mother and six ducklings in Iceland

Adults have white underparts, though the rest of the plumage goes through a complex moulting process. The male has a long pointed tail (10 to 15 cm) and a dark grey bill crossed by a pink band. In winter, the male has a dark cheek patch on a mainly white head and neck, a dark breast and mostly white body. In summer, the male is dark on the head, neck and back with a white cheek patch. The female has a brown back and a relatively short pointed tail. In winter, the female's head and neck are white with a dark crown. In summer, the head is dark. Juveniles resemble adult females in autumn plumage, though with a lighter, less distinct cheek patch.

Their breeding habitat is in tundra pools and marshes, but also along sea coasts and in large mountain lakes in the North Atlantic region, Alaska, northern Canada, northern Europe and Russia. The nest is located on the ground near water; it is built using vegetation and lined with down. They are migratory and winter along the eastern and western coasts of North America, on the Great Lakes, coastal northern Europe and Asia, with stragglers to the Black Sea. The most important wintering area is the Baltic Sea, where a total of about 4.5 million gather.

The Long-tailed Duck is gregarious, forming large flocks in winter and during migration. They feed by diving for mollusks, crustaceans and some small fish. Although they usually feed close to the surface, they are capable of diving to depths of 60m (200 feet).

In North American English it is sometimes called Oldsquaw, though this name has fallen out of favour under influence of negative connotations of the word squaw in English usage. Some biologists have also feared that this name would be offensive to some Native American tribes involved in the conservation effort.[3] The American Ornithologists' Union stated that "political correctness" was not sufficient to change the name, but "to conform with English usage in other parts of the world", it officially adopted the name Long-tailed Duck.[4]

The males are vocal and have a musical yodelling call ow, ow, owal-ow.

The Long-tailed Duck is one of the species to which the Agreement on the Conservation of African-Eurasian Migratory Waterbirds (AEWA) applies.

References [edit]

  1. ^ BirdLife International (2012). "Clangula hyemalis". IUCN Red List of Threatened Species. Version 2012.1. International Union for Conservation of Nature. Retrieved June 20, 2012. 
  2. ^ Gál, Erika; Hír, János; Kessler, Eugén; & Kókay, József (1998–1999). "Középsõ-miocén õsmaradványok, a Mátraszõlõs, Rákóczi-kápolna alatti útbevágásból. I. A Mátraszõlõs 1. lelõhely" [Middle Miocene fossils from the sections at the Rákóczi chapel at Mátraszőlős. Locality Mátraszõlõs I.] (PDF). Folia Historico Naturalia Musei Matraensis (in Hungarian) 23: 33–78. 
  3. ^ Though squaw originated as a word simply meaning "young woman" in the Massachusett and related Algonquian languages, it is now considered offensive by many Native Americans and is so labelled in modern dictionaries.
  4. ^ American Ornithologists' Union (2000). "Forty-second supplement to the American Ornithologists' Union Check-list of North American Birds" (PDF). The Auk 117: 847–858. 
  • Svensson, Lars and Grant, Peter J. Collins Bird Guide. London: HarperCollins, 1999. 1st edition p. 64.
  • Kightley, Chris and Madge, Steve. Pocket Guide to the Birds of Britain and North-West Europe. Nr. Robertsbridge: Pica Press, 1998. p. 48.
Creative Commons Attribution Share Alike 3.0 (CC BY-SA 3.0)

 

Source: Wikipedia

Unreviewed

Article rating from 0 people

Average rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!