Articles on this page are available in 1 other language: Chinese (Simplified) (5) (learn more)

Overview

Brief Summary

Clangula hyemalis

Although not quite as large or as white as the eiders (genus Somateria), the winter Long-tailed Duck (16 1/2 inches, females; 21 inches, males) is nonetheless one of the Northern Hemisphere’s paler species of sea ducks. During that part of the year, male Long-tailed Ducks have a white head and body with black wings, black tail, and black cheek patch, while females are pale gray-brown overall. In summer, however, both sexes of Long-tailed Duck become much darker, with the male loosing much of the white on its head and body. At all seasons, the Long-tailed Duck may be separated from other ducks in its range and habitat by its slim body, small head, and (in the male) long tail. The Long-tailed Duck inhabits large areas of the Northern Hemisphere. In North America, this species breeds from the Aleutian Islands in Alaska east to eastern Quebec and from the high Arctic south to the Hudson Bay. In winter, Long-tailed Ducks may be found along the Pacific coast from southern Alaska to Washington, in the southern part of the Hudson Bay, along the Atlantic coast from Newfoundland to Virginia, and on the Great Lakes. In the Old World, this species breeds in Greenland, Iceland, Northern Europe, and Russia, wintering south to Britain and northern Japan. In summer, Long-tailed Ducks breed on small ponds in tundra wetlands. During winter and on migration, this species may be found in offshore waters and on large freshwater lakes. The diet of the Long-tailed Duck varies by season; in summer, this species eats insects, crustaceans, and plant matter, while fish and mollusks play a larger role in winter. Due to the relative inaccessibility of their breeding grounds, most birdwatchers never observe Long-tailed Ducks during the summer months. They are much more accessible in winter and during migration, when they may be observed in small flocks offshore with the help of a powerful spotting scope. This species is primarily active during the day.

Threat Status: Vulnerable

  • Clangula hyemalis. Xeno-canto. Xeno-canto Foundation, n.d. Web. 20 July 2012. .
  • Long-tailed Duck (Clangula hyemalis). The Internet Bird Collection. Lynx Edicions, n.d. Web. 20 July 2012. .
  • Peterson, Roger Tory. Birds of Eastern and Central North America. Boston: Houghton Mifflin, 1980. Print.
  • Robertson, Gregory J. and Jean-Pierre L. Savard. 2002. Long-tailed Duck (Clangula hyemalis), The Birds of North America Online (A. Poole, Ed.). Ithaca: Cornell Lab of Ornithology; Retrieved from the Birds of North America Online: http://bna.birds.cornell.edu/bna/species/651
  • Sibley, Daid Allen. The Sibley Guide to Birds, 2nd Edition. New York: Alfred A, Knopf, 2014. Print.
  • eBird Range Map - Long-tailed Duck. eBird. Cornell Lab of Ornithology, N.d. Web. 20 July 2012. .
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Smithsonian Institution

Supplier: DC Birds

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Distribution

Range Description

Clangula hyemalis is circumpolar, breeding on the Arctic coasts of North America (Canada, Alaska, USA and Greenland), Europe (Iceland and Norway), and Asia (Russia). It winters at sea further south, as far as the United Kingdom, South Carolina and Washington in the United States, Korea on the Asian Pacific coast, and other areas including the Black Sea and Caspian Sea (del Hoyo et al. 1992). According to monitoring data from the Baltic Sea, where the western Siberian and northern European populations winter, the population there has declined significantly since the early 1990s at least (Hario et al. 2009, Ellermaa et al. 2010, Nilsson and Mnsson 2010, Skov et al. 2011). An estimated total of c.4,272,000 individuals was counted there in 1992-1993, falling to c.1,486,000 individuals in 2007-2009, which suggests that a decline of c.65% has occurred over a period of 16 years (Skov et al. 2011). There is no evidence to suggest that the geographical distribution of this population has shifted (Skov et al. 2011, L. Nilsson in litt. 2011, J. Bellebaum in litt. 2012, M. Ellermaa in litt. 2012). The estimation of a real and severe decline is supported by data from the Gulf of Finland flyway, where the numbers observed on migration have fallen dramatically since the early 1990s at least (A. Lehikoinen et al. in litt. 2012). North America holds the second largest population (c.1 million birds [Delany and Scott 2006]). Although Christmas Bird Count (CBC) data indicate an annual population change of -1.9% between 1965 and 2005, across c.70% of the speciess range in North America (Butcher and Niven 2007); however, the reliability of CBC data for monitoring this species has been questioned owing to the species's tendency to winter off-shore (T. Bowman in litt. 2012). There are conflicting results from regional surveys. Indices of abundance obtained during the North American Breeding Waterfowl Survey indicate a steady long-term downward trend between the 1970s and early 1990s, and a stable population since. However, this species is especially poorly monitored because its breeding distribution is largely outside the area covered by breeding waterfowl surveys, and because of its offshore distribution during winter and the lack of comprehensive winter surveys (T. Bowman in litt. 2012). No trend data are available for the third largest population (c.500,0001,000,000 birds [Delany and Scott 2006]), which breeds in eastern Siberia and winters off eastern Asia. The fourth and smallest population (c.100,000150,000 birds [Delany and Scott 2006]), which breeds in Greenland and Iceland and winters in the north Atlantic, is poorly monitored and trends are uncertain, although it may have been stable until the 1990s (Delany and Scott 2006). Research on the tundra of eastern European Russia since 1973 suggests that a steep decline may have occurred there (Y. and O. Mineev in litt. 2012).

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

North America; Oceania; range extends from Labrador to northern Florida
translation missing: en.license_cc_by_4_0

© WoRMS for SMEBD

Source: World Register of Marine Species

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Long-tailed ducks have a fairly large range compared to other waterfowl. Its biogeographic range, including breeding and non-breeding seasons, has been estimated to include 10,800,000 km2. Long-tailed ducks are residents of the circumpolar region and are regularly found breeding on the Arctic coasts of Canada, Alaska, United States of America, Greenland, Iceland, Norway, and Russia. They winter further south in the United Kingdom, North America, Korea and on the Black and Caspian Seas.

Biogeographic Regions: nearctic (Native ); palearctic (Native ); oriental (Native ); arctic ocean (Native ); atlantic ocean (Native ); pacific ocean (Native )

Other Geographic Terms: holarctic

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

occurs (regularly, as a native taxon) in multiple nations

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

National Distribution

Canada

Origin: Native

Regularity: Regularly occurring

Currently: Present

Confidence: Confident

Type of Residency: Year-round

United States

Origin: Native

Regularity: Regularly occurring

Currently: Present

Confidence: Confident

Type of Residency: Year-round

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Global Range: (>2,500,000 square km (greater than 1,000,000 square miles)) BREEDING: in North America, from northern coast of Alaska east across Canada to Ellesmere and Baffin Islands and northern Labrador south to southern and central Alaska, northwestern British Columbia, eastern and south-central MacKenzie and Keewatin, and Hudson and James Bays. In Palearctic from Greenland, Iceland, Spitsbergen, and Scandinavia east across Russia to Chukotski Peninsula, Anadyrland, Kamchatka, and the Commander Islands. NON-BREEDING: in North America, mainly on coasts from Aleutians to Washington and from northern Greenland to South Carolina; in the interior, primarily on the Great Lakes (AOU 1983). In winter the highest densities occur along the Aleutian Islands and in the Gulf of Saint Lawrence; other areas of abundance include Lake Michigan, the coast of Maine, Lake Ontario, and south-coastal British Columbia (Root 1988). In the early 1990s, USFWS Winter Sea Duck Survey in eastern North America found the highest densities in New Brunswick, Nova Scotia, Maine, and Maryland (Kehoe 1994).

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Range

Coasts of Holarctic region.
  • Clements, J. F., T. S. Schulenberg, M. J. Iliff, D. Roberson, T. A. Fredericks, B. L. Sullivan, and C. L. Wood. 2014. The eBird/Clements checklist of birds of the world: Version 6.9. Downloaded from http://www.birds.cornell.edu/clementschecklist/download/

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

High Arctic, Atlantic and Pacific coasts of North America, and the Great Lakes.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Gulf of Maine - CoML

Source: Gulf of Maine Area Census of Marine Life

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Physical Description

Morphology

Long-tailed ducks are mid-sized birds with long, dark tails and gray legs and feet. The species received its common name from the two long and slender tail-feathers that extend behind adult males. Plumage coloration and general size vary between adult males and females. While adult drakes range in size from 48 to 58 cm long, adult hens are between 38 and 43 cm long. Adult males weigh approximately 0.91 to 1.13 kg and adult females weigh about 0.68 to 0.91 kg. Long-tailed ducks of both sexes shift between three distinct plumages and adult males display an additional alternate plumage in the winter.

In the winter, adult males are white on their crowns, necks and throats that extend down to the breast. The white throat contrasts sharply with a large, black breast-band. Males also feature a gray patch surrounding their eyes, and a black patch that extends from their ears. Bills are dark with a pinkish band across the middle. Their bellies and undertail coverts are white. They exhibit black tail-feathers, rumps and backs. Wings are black with white scapulars at the base. Winter females have white faces, necks, and throats with brown crowns and brown ear patches. They also feature a broad breast-band, but it is brown in color. Their backs, wings and tails are also brown, while their bellies and undertail coverts are white. Females' bills are a dark blueish gray.

Range mass: 0.68 to 1.13 kg.

Range length: 38.1 to 58.4 cm.

Average wingspan: 70 cm.

Other Physical Features: endothermic ; homoiothermic; bilateral symmetry

Sexual Dimorphism: male larger; sexes colored or patterned differently

  • Bent, A. 1987. Life histories of North American wild fowl, Volumes 1-2. Toronto, Ontario: General Publishing Company, Ltd..
  • Murphy, D., D. Oster, D. Maas, J. Anderson, S. Hauge. 2001. Hunting Divers and Paddle Ducks: A Comprehensive Guide to More Than 30 Species. Chanhassen, MN: Creative Publishing International, Inc.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Size

Length: 56 cm

Weight: 932 grams

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Length: 41.5 cm., Wingspan: 70 cm.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Gulf of Maine - CoML

Source: Gulf of Maine Area Census of Marine Life

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Ecology

Habitat

Habitat and Ecology

Habitat and Ecology
Behaviour This species is fully migratory (del Hoyo et al. 1992) although its movements are poorly understood (Scott and Rose 1996). It breeds from late-May onwards (Madge and Burn 1988) in single pairs or loose groups (del Hoyo et al. 1992, Kear 2005b), the males leaving the females soon after the start of incubation (Madge and Burn 1988) (between late-June and early-September) to gather in small flocks for a flightless moulting period (Scott and Rose 1996). Some populations undergo extensive moult migrations of up to 1,000 km, while others moult on waters near the breeding grounds (Madge and Burn 1988). Females moult between early-August and early-October on the breeding grounds (Scott and Rose 1996), often abandoning their young at the start of the moult (the ducklings then gather into large parentless groups) (Johnsgard 1978). The southward autumn migration occurs from September to October after the post-breeding moult (Scott and Rose 1996) and non-breeders may oversummer in the wintering areas (Madge and Burn 1988). Outside of the breeding season the species is highly gregarious (Johnsgard 1978), in winter gathering into large aggregations of perhaps several tens of thousands of individuals to roost or to feed in inshore and offshore waters (del Hoyo et al. 1992). The species regularly dives to depths of 3-10 m when foraging (maximum depth 50-60 m) (Kear 2005b) and is diurnal (Kear 2005b). Habitat Breeding The species breeds on marshy grass tundra in the high Arctic (Flint et al. 1984, del Hoyo et al. 1992), especially where habitat mosaics are formed by hummocks and ridges together with moist depressions (Snow and Perrins 1998), freshwater lakes (del Hoyo et al. 1992, Kear 2005b), bogs (del Hoyo et al. 1992), slow rivers (Madge and Burn 1988, del Hoyo et al. 1992) or pools of standing water (Snow and Perrins 1998). It generally avoids wooded tundra (Johnsgard 1978, Snow and Perrins 1998) but is common among willows or dwarf birch in the arctic-alpine zone (Scandinavia) (Snow and Perrins 1998). The species also breeds on small rocky islands off mainland Arctic coasts and on larger offshore islands, using promontories, deltas (Snow and Perrins 1998), coastal inlets (Madge and Burn 1988, del Hoyo et al. 1992) and islets in fjords (Greenland) (Snow and Perrins 1998). Non-breeding The species winters at sea, generally far offshore (del Hoyo et al. 1992) in waters 10-35 m deep (Scott and Rose 1996), as well as in saline, brackish or fresh estuarine waters (Johnsgard 1978), brackish lagoons (del Hoyo et al. 1992), and inland (very rarely) on large, deep freshwater lakes (del Hoyo et al. 1992). Diet The species showing a preference for marine foods during both the breeding and non-breeding seasons (Johnsgard 1978), its diet consisting predominantly of animal matter (Snow and Perrins 1998) such as crustaceans (del Hoyo et al. 1992) (e.g. amphipods [Kear 2005b] and cladocerans [Johnsgard 1978]), molluscs, other marine invertebrates (e.g. echinoderms, worms) and fish (del Hoyo et al. 1992). The species also takes freshwater insects and insect larvae (del Hoyo et al. 1992) as well as plant material such as algae, grasses, and the seeds and fruits of tundra plants (del Hoyo et al. 1992). Breeding site The nest is a natural depression on dry ground positioned in the open, amongst vegetation (del Hoyo et al. 1992), partially hidden by overhanging boulders (Madge and Burn 1988) or under low shrubs (Johnsgard 1978) (e.g. willows or dwarf birch) (Flint et al. 1984) usually close to water (Madge and Burn 1988). Although it is not a colonial species some pairs may nest in loose groups, and the species may also nest in association with Arctic Terns (Kear 2005b).


Systems
  • Terrestrial
  • Freshwater
  • Marine
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Depth range based on 7102 specimens in 1 taxon.
Water temperature and chemistry ranges based on 3140 samples.

Environmental ranges
  Depth range (m): 0 - 0
  Temperature range (°C): -0.858 - 17.743
  Nitrate (umol/L): 1.003 - 9.166
  Salinity (PPS): 5.715 - 35.374
  Oxygen (ml/l): 5.571 - 9.061
  Phosphate (umol/l): 0.231 - 1.104
  Silicate (umol/l): 0.565 - 12.889

Graphical representation

Temperature range (°C): -0.858 - 17.743

Nitrate (umol/L): 1.003 - 9.166

Salinity (PPS): 5.715 - 35.374

Oxygen (ml/l): 5.571 - 9.061

Phosphate (umol/l): 0.231 - 1.104

Silicate (umol/l): 0.565 - 12.889
 
Note: this information has not been validated. Check this *note*. Your feedback is most welcome.
All rights reserved

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Long-tailed ducks reside in a variety of habitats. Generally, they winter in the open ocean or large lakes and summer in pools or lakes in the tundra. They prefer to breed in habitats that provide both an aquatic and terrestrial environment in close proximity, for example: marshy grass tundra in the Arctic, deltas, promontories, coastal inlets and offshore islands are all suitable. Habitat mosaics with damp depressions such as bogs and pools of standing water are also popular breeding sites. A study of summer distributions of long-tailed ducks as well as related species found that shallow water habitats are preferred when individuals are molting. This may be because molting individuals require protection from predation and environmental elements such as wind, waves and ice while still having a constant and abundant food source. Non-breeding long-tailed ducks reside far offshore in fresh estuarine, saline, or brackish waters. Though rare, they can be found wintering on large and deep freshwater lakes.

Habitat Regions: temperate ; polar ; terrestrial ; saltwater or marine ; freshwater

Terrestrial Biomes: tundra ; taiga

Aquatic Biomes: pelagic ; lakes and ponds; coastal ; brackish water

Wetlands: marsh ; bog

Other Habitat Features: estuarine

  • Fischer, J., W. Larned. 2004. Summer distribution of marine birds in the Wester Beaufort Sea. Arctic, 57/2: 143-159.
  • ITIS Catalogue of Life. 2005. "Clnagula hyemalis (Linnaeus, 1758)" (On-line). Encyclopedia of Life. Accessed February 21, 2011 at http://www.eol.org/pages/1048978.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Comments: NON-BREEDING: coastal waters (e.g., rough water of rocky coasts, deep but calm bays and coves), large inland lakes and (less commonly) rivers. BREEDING: on lake islands and by pools in open tundra and taiga. Nest usually concealed in vegetation. Nest site selection apparently influenced by predation pressure from foxes, gulls, ravens, and jaegers.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Depth range based on 7102 specimens in 1 taxon.
Water temperature and chemistry ranges based on 3140 samples.

Environmental ranges
  Depth range (m): 0 - 0
  Temperature range (°C): -0.858 - 17.743
  Nitrate (umol/L): 1.003 - 9.166
  Salinity (PPS): 5.715 - 35.374
  Oxygen (ml/l): 5.571 - 9.061
  Phosphate (umol/l): 0.231 - 1.104
  Silicate (umol/l): 0.565 - 12.889

Graphical representation

Temperature range (°C): -0.858 - 17.743

Nitrate (umol/L): 1.003 - 9.166

Salinity (PPS): 5.715 - 35.374

Oxygen (ml/l): 5.571 - 9.061

Phosphate (umol/l): 0.231 - 1.104

Silicate (umol/l): 0.565 - 12.889
 
Note: this information has not been validated. Check this *note*. Your feedback is most welcome.

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Summer: Tundra pools and lakes. Winter: Open ocean and large lakes.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Gulf of Maine - CoML

Source: Gulf of Maine Area Census of Marine Life

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Migration

Non-Migrant: No. All populations of this species make significant seasonal migrations.

Locally Migrant: No. No populations of this species make local extended movements (generally less than 200 km) at particular times of the year (e.g., to breeding or wintering grounds, to hibernation sites).

Locally Migrant: Yes. At least some populations of this species make annual migrations of over 200 km.

Migrates northward to breeding grounds in March-April. Moves southward in fall, October-November (Terres 1980). Some that summer in northwestern Alaska spend the winter in eastern Asia. Passes through Bering Strait in large numbers in late April. Large numbers fly eastward to Beaufort Sea area breeding areas from western Alaska, some probably arrive from interior Alaska, others migrate from coastal British Columbia and/or Great Lakes region and arrive via Mackenzie Valley. Arrives along Beaufort Sea coast mid-May (in west) to early June (eastern part). In Beaufort Sea area, males and some nonbreeding females migrate in early summer to large lakes and coastal lagoons and form large molting flocks; remain through July and August (Johnson and Herter 1989). Fall migration in Beaufort Sea area begins with males in late August; females with broods move to coastal lagoons with freeze-up in September, begin migration late September or early October (Johnson and Herter 1989).

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Large flocks.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Gulf of Maine - CoML

Source: Gulf of Maine Area Census of Marine Life

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Trophic Strategy

Long-tailed ducks are generalists that consume a large variety of prey. Animal foods that are commonly eaten by long-tailed ducks include: crustaceans, mollusks, marine invertebrates, small fish, fish eggs, freshwater insects and insect larvae. Some plant material that is also consumed includes: algae, grasses, seeds and fruits in the tundra biome. Studies show that mature adults prefer marine animals. Specifically, they tend to eat blue muscles, Idotea baltica (isopods), northern lacuanas, and Amphipoda crustaceans which yield higher energy per gram of live mass than other available prey.

Mature adults typically forage diurnally, about 80% of the day, during the winter months. Usually, individuals dive with submerged times ranging from 25 to 60 s and pick epibenthos within 100 m of the shore. Since long-tailed ducks are relatively small when compared to their marine Anatidae counterparts, they must maintain a particular diet for physiological and thermoregulatory purposes.

Long-tailed ducks have several physical characteristics that make them successful predators. First, they have chisel-shaped bills that curve at the tip which would help grab epibenthos prey from their substrates. Second, long-tailed ducks have smaller bills, allowing them to efficiently pick small, motile crustaceans. Finally, the body shape and structure of mature adults aids in diving and agility in water, giving individuals a powerful advantage over their primarily cursorial or sessile prey.

Animal Foods: fish; eggs; insects; mollusks; terrestrial worms; aquatic crustaceans; echinoderms; other marine invertebrates

Plant Foods: leaves; seeds, grains, and nuts; fruit; algae

Primary Diet: carnivore (Eats other marine invertebrates)

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Comments: Feeds mainly on animal food; eats crustaceans, fishes and their eggs, mollusks, and aquatic insects. Also eats a variety of aquatic plants (roots, leaves, buds, seeds). May dive very deep to obtain food (Bellrose 1976). Euphyllopods appear to be an especially important food source for ducklings. Individuals in summer molting flocks feed in nearshore waters on MYSIS, ONISIMUS, and bivalve mollusks (Johnson and Herter 1989).

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Mollusks, crustaceans, insects, some small fish, fish eggs, and some plant matter.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Gulf of Maine - CoML

Source: Gulf of Maine Area Census of Marine Life

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Associations

Long-tailed ducks are important predators of crustaceans, mollusks, marine invertebrates and small fish in holarctic regions. Long-tailed ducks are also a significant food source for avian predators, such as gulls and jaegers, and terrestrial predators, such as roving dogs and foxes. They are vulnerable to diseases including recorded cases of avian botulism, avian influenza and avian cholera. Few studies have investigated parasitic, commensal or mutualistic relationships of long-tailed ducks.

  • North, N., S. Lair. 2006. Movements of Long-tailed Ducks wintering on Lake Ontario to breeding areas in Nanavut, Canada. Wilson Journal of Ornithology, 118/4: 494-501.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Long-tailed ducks are most vulnerable to predation on land: newly hatched ducklings, freshly laid eggs and molted, flightless adults have the highest mortality rates. Females camouflage their nests and lay eggs close to the water so when ducklings hatch, the dangerous journey to the water is shortened. Males remain on breeding grounds while females lay eggs to help defend the nest from predation. Newly molted males and females stay in flocks in an attempt to lessen the chance of mortality just as ducklings travel in large creches before their fall migration.

Avian predators of long-tailed ducks include mew gulls, glaucous gulls, and jaegers. In coastal breeding grounds, Arctic foxes are common predators. When long-tailed ducks mate further inland, near freshwater lakes, red foxes become serious predators.

Known Predators:

  • mew gulls (Larus canus)
  • glaucous gulls (Larus hyperboreus)
  • parasitic jaegers (Stercorarius parasiticus)
  • Arctic foxes (Vulpes lagopus)
  • red foxes (Vulpes vulpes)

Anti-predator Adaptations: cryptic

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Known predators

Clangula hyemalis (northern eider, long-tailed duck, red-throated diver) is prey of:
Stercorarius
Larus hyperboreus
Alopex lagopus

Based on studies in:
Norway: Spitsbergen (Coastal)

This list may not be complete but is based on published studies.
  • V. S. Summerhayes and C. S. Elton, Contributions to the ecology of Spitsbergen and Bear Island, J. Ecol. 11:214-286, from p. 232 (1923).
Creative Commons Attribution 3.0 (CC BY 3.0)

© SPIRE project

Source: SPIRE

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Known prey organisms

Clangula hyemalis (northern eider, long-tailed duck, red-throated diver) preys on:
Animalia
Diptera
Entomostraca
Rotifera
Tardigrada
Nematoda
Oligochaeta

Based on studies in:
Norway: Spitsbergen (Coastal)

This list may not be complete but is based on published studies.
  • V. S. Summerhayes and C. S. Elton, Contributions to the ecology of Spitsbergen and Bear Island, J. Ecol. 11:214-286, from p. 232 (1923).
Creative Commons Attribution 3.0 (CC BY 3.0)

© SPIRE project

Source: SPIRE

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Population Biology

Global Abundance

10,000 to >1,000,000 individuals

Comments: Global population very large, perhaps over 10 million individuals (Madge and Burn 1988).

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

General Ecology

Nonbreeding: may form very large concentrations, but tends to occur in small offshore flocks (Atlantic Flyway, Kehoe 1994).

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Life History and Behavior

Behavior

Long-tailed ducks have an extensive variation of calls that are used primarily for intra-species communication. A fairly vocal species in the Anatidae family, long-tailed ducks can make a variety of growling, clucking, squawking, and yodeling sounds. The calls of individuals have been described as guttural or nasal and are audible across fairly large distances. When mother long-tailed ducks lead their progeny to the nearest water sources, they use specific calls as cues for the young to dive in unison. Calls are also an integral part of mating. Males use a series of four or five calls in deep notes to advertise availability for mating. Females emit single calls or growls to acknowledge potential mates or respond to initial calls from males.

During the breeding season, males confront competitors through calls, physical contact, chases and visual cues such as spreading wings and tilting heads upward. Females defend young by spreading wings and splashing water, possibly to draw attention away from the vulnerable young individuals. Like most ducks, long-tailed ducks perceive their environment through visual, auditory, tactile and chemical stimuli.

Communication Channels: visual ; tactile ; acoustic

Perception Channels: visual ; tactile ; acoustic ; chemical

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Life Expectancy

The average lifespan of long-tailed ducks is 15.3 years. A single case of an adult male reaching the age of 22 years in the wild has been reported. No extensive studies on lifespan in captivity have been conducted. Several studies suggest that longevity is linked to food availability, stable environment, absence of disease and toxic materials such as lead and mercury.

Average nesting success is 30% in long-tailed ducks and on average, 10% of ducklings survive to 30 days old. Duckling survival, however, is highly variable to location of breeding and fluctuations in breeding environment. Average survival post-nesting for females is approximately 74%.

Range lifespan

Status: wild:
22.7 (high) years.

Average lifespan

Status: wild:
15.3 years.

  • Schamber, J., P. Flint, J. Grand, H. Wilson, J. Morse. 2009. Population dynamics of Long-tailed Ducks breeding on the Yukon-Kuskokwim Delta, Alaska. Arctic, 62/2: 190-200.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Lifespan, longevity, and ageing

Maximum longevity: 22.7 years (wild)
Creative Commons Attribution 3.0 (CC BY 3.0)

© Joao Pedro de Magalhaes

Source: AnAge

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Reproduction

Like most members of the Anatidae family, long-tailed ducks are socially monogamous. Long-tailed ducks may breed in single pairs or loose groups. Breeding pairs can form as early as individuals reach the breeding grounds. Pairs can re-form for several years or individuals may select new mates each mating season. Breeding may be initiated before spring breeding plumage develops, but in most cases, breeding occurs after.

Long-tailed ducks engage in an elaborate courtship process, though sexual selection has only been studied superficially. Males will approach available females with an upright tail and bill held outwards, a few inches from the surface of the water. When closer to his potential mate, the male will bow and then pull his head back with his bill held upward. As he is lowering his head, he will emit calls. A series of four or five calls with deep notes have been observed. These calls often attract other males and they often physically fight and chase each other for the available female. Females call in response to initial calls from the males and hold their head close to their body to indicate availability. Females will then lead males to a mating location.

Mating System: monogamous

Breeding can begin as early as May, but varies depending on the location of the breeding ground and the presence of mates. Long-tailed ducks can begin mating as early as their second year after birth. They mate near open water, either freshwater or marine, and try to nest on dry ground hidden among rocks or under plant growth. Nests are bowl-shaped and constructed by the female. They consist of nearby grasses and females pluck down from their own bodies to line the nest.

Females usually lay 6 to 8 eggs: on average, laying one egg per day. Clutch sizes of up to 17 have been recorded, but this is likely the result brood parasitism as some females will lay eggs in other's nests. Females will raise one brood per season, but can lay eggs several times if unsuccessful. Since fall migration occurs relatively late, long-tailed ducks have a long breeding season and can attempt raising a brood several times. Once eggs are laid, the incubation period lasts from 24 to 30 days. Young ducklings remain in the nest until they fledge after 35 to 40 days. The fledglings form groups of 3 to 4 broods that are tended by older females.

Breeding interval: Long-tailed ducks breed once yearly.

Breeding season: Breeding usually occurs between May and July.

Range eggs per season: 5 to 11.

Range time to hatching: 24 to 30 days.

Range fledging age: 35 to 40 days.

Range age at sexual or reproductive maturity (female): 2 (high) years.

Range age at sexual or reproductive maturity (male): 2 (high) years.

Key Reproductive Features: iteroparous ; seasonal breeding ; gonochoric/gonochoristic/dioecious (sexes separate); sexual ; oviparous

While eggs are being laid, the male will reside in the open water and help defend the nest. During the incubation period between late June and early September, the male will leave and begin molting. The newly laid eggs are then incubated and defended by the female for 24 to 30 days. Although newly hatched young can feed themselves, they are fed and closely tended by their mother. When the young begin walking, the mother leads her brood over to the water and teaches them to dive for food. First flight can occur anywhere between 35 to 40 days old. Anywhere between August and October, the mothers will leave their young to molt and ducklings will gather into large groups in and around the water. These groups are often tended by slightly older females.

According to a study of body mass dynamics in adult females during incubation, females lose proportionately less mass and rely less on endogenous reserves to lay and incubate eggs than other diving ducks. Specifically, females lose approximately 7% of their mass during incubation: average weight is 618 g at clutch completion and then drops down to 575 g at hatching. Because females are relatively smaller than other waterfowl breeding in the tundra and have access to high-quality nutrients, long-tailed ducks are able to maintain high nesting attendance rates and constant incubation without losing too much of their endogenous reserves.

Parental Investment: precocial ; female parental care ; pre-fertilization (Provisioning, Protecting: Female); pre-hatching/birth (Provisioning: Female, Protecting: Male, Female); pre-weaning/fledging (Provisioning: Female, Protecting: Female); pre-independence (Provisioning: Female, Protecting: Female)

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Breeding begins late May in south to June in north. Egg laying peaks late June-early July at Arctic Natl. Wildl. Ref. Clutch size often 5-11 (usually 6-8). Incubation 25-26 days, by female (male departs). Most eggs hatch in 2nd half of June in Beaufort Sea area. Nestlings precocial and downy. Young tended by female, independent in about 5 weeks (Harrison 1978). Does not breed until at least 2 years old. According to Bellrose (1980), nest success is around 70% and brood survival data are lacking. Frequently nests in clusters or colonies. Nests per sq km in northern Alaska: 0.6-1.8 in different areas (Johnson and Herter 1989).

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

First breeds at 2 years old. Breeds near open water, nest is on dry ground hidden under plant growth or among rocks. 6-8 eggs, incubated by the female for 24-29 days. Young can feed themselves, and are tended by the female. First flight at 35-40 days old.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Gulf of Maine - CoML

Source: Gulf of Maine Area Census of Marine Life

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Barcode data: Clangula hyemalis

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There are 15 barcode sequences available from BOLD and GenBank.

Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.

See the BOLD taxonomy browser for more complete information about this specimen and other sequences.

CCCACAAAGACATTGGCACCTTATACCTTATCTTCGGAGCATGAGCCGGAATAATCGGCACCGCACTCAGCCTGCTAATCCGCGCAGAACTGGGCCAACCAGGAACCCTCCTGGGTGATGACCAAATTTACAATGTAATCGTCACCGCCCACGCATTTGTAATAATCTTCTTCATAGTAATGCCTATCATAATCGGAGGATTTGGCAACTGATTAGTCCCCCTAATAATCGGCGCCCCTGACATGGCATTCCCACGAATAAACAACATGAGCTTTTGACTCCTCCCACCCTCCTTCCTCTTACTGCTCGCCTCATCTACCGTAGAAGCTGGCGCTGGCACAGGCTGAACCGTATATCCGCCCCTAGCAGGCAACCTAGCCCACGCCGGAGCCTCAGTAGACCTAGCCATCTTCTCACTCCATCTAGCCGGTGTTTCCTCCATCCTCGGGGCCATCAACTTCATCACCACAGCCATTAACATAAAACCTCCCGCACTCTCACAATACCAAACCCCCCTTTTCGTCTGATCCGTCCTAATCACCGCCATCCTACTCCTCCTATCACTCCCCGTCCTCGCTGCCGGTATCACAATACTACTTACCGACCGAAATCTAAACACCACATTCTTTGACCCCGCCGGAGGGGGAGACCCAATCCTGTACCAACACCTGTTCTGATTCTTCGGCCACCCAGAAGTCTATATCCTAATCCTCCCAGGATTTGGAATTATCTCCCACGTA
-- end --

Download FASTA File

Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Statistics of barcoding coverage: Clangula hyemalis

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 15
Specimens with Barcodes: 23
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Conservation

Conservation Status

IUCN Red List Assessment


Red List Category
VU
Vulnerable

Red List Criteria
A4bce

Version
3.1

Year Assessed
2012

Assessor/s
BirdLife International

Reviewer/s
Butchart, S. & Symes, A.

Contributor/s
Bellebaum, J., Below, A., Bianki, V., Bowman, T., Ellermaa, M., Fefelov, I., Grishanov, G., Hario, M., Kharitonov, S., Kharitonova, I., Kondratyev, A., Kontiokorpi, J., Lehikoinen, A., Lehikoinen, E., Lehtiniemi, T., Mikkola-Roos, M., Mineev, O., Mineev, Y., Nilsson, L., Pessa, J., Pihl, S., Rajasarkka, A., Solovyeva, D., Tiainen, J. & Valkama, J.

Justification
This species has been uplisted to Vulnerable because an apparently drastic decline detected in the wintering population in the Baltic Sea since at least the early 1990s implies that the global population will undergo at least a rapid decline over three generations (1993-2020), even when factoring-in uncertainty regarding the sizes and trends of other populations. Improved knowledge regarding populations outside the Baltic Sea might lead to the species being uplisted to Endangered if the overall rate of decline can be confidently shown to be very rapid.


History
  • Least Concern (LC)
  • Least Concern (LC)
  • Least Concern (LC)
  • Least Concern (LC)
  • Lower Risk/least concern (LR/lc)
  • Lower Risk/least concern (LR/lc)
  • Lower Risk/least concern (LR/lc)