Overview

Brief Summary

Bucephala albeola

A small, teal-sized duck (13-15 inches), the male Bufflehead may be most easily identified by the large white patch on the back of its head. Other distinguishing characteristics include its iridescent green head, white body, and patchy black-and-white wings visible in flight. The female Bufflehead is dull brown above with a white belly, light brown flanks, and a smaller white patch behind the eye. Duck hunters refer to this species as the “butterball” in reference to the male’s large white head patch. The Bufflehead breeds primarily in west-central Canada, in central Alaska, and at higher elevations in the Rocky Mountains. Small numbers of Buffleheads breed elsewhere in western North America, extending east to the Great Lakes. This species migrates south for the winter, when it may be found unevenly distributed across the southern half of North America. Buffleheads are found locally in the interior of their winter range, but are more common along the Atlantic and Pacific coasts north to Nova Scotia and Alaska, respectively. In summer, Buffleheads breed on ponds and lakes near forests. Buffleheads are particularly attracted to forests inhabited by the Northern Flicker (Colaptes auratus) because this species builds its nest in old Flicker nest cavities. In winter, Buffleheads may be found on sheltered saltwater bays and estuaries or, inland, on large lakes or rivers. This species primarily eats small animals, such as crustaceans, mollusks, and insects when available. One of several species of “diving ducks” in North America, Buffleheads may be observed submerging themselves to feed in the water or on the bottom. In winter, they may also be observed in small flocks on large, slow-moving bodies of water. This species is primarily active during the day.

Threat Status: Least concern

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Unknown

Supplier: DC Birds

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Distribution

Gulf of Maine, Gulf of Mexico, North West Atlantic, Portuguese Exclusive Economic Zone, Spanish Exclusive Economic Zone, United Kingdom Exclusive Economic Zone, Wimereux
Creative Commons Attribution 3.0 (CC BY 3.0)

© WoRMS for SMEBD

Source: World Register of Marine Species

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Range

Breeds n North America; winters to Mexico and Greater Antilles.
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

 

Partner Web Site: Cornell Laboratory of Ornithology

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Geographic Range

The Bufflehead ranges predominantly through boreal forests and aspen parklands of Canada and Alaska, with the highest density in British Columbia and Alberta. Their nonbreeding range extends through the contential United States into Northern Mexico.

Biogeographic Regions: nearctic (Native )

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

North America; Newfoundland to Florida
Creative Commons Attribution 3.0 (CC BY 3.0)

© WoRMS for SMEBD

Source: World Register of Marine Species

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Geographic Range

The Bufflehead ranges predominantly through boreal forests and aspen parklands of Canada and Alaska, with the highest density in British Columbia and Alberta. Their nonbreeding range extends through the contential United States into Northern Mexico.

Biogeographic Regions: nearctic (Native )

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

occurs (regularly, as a native taxon) in multiple nations

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

National Distribution

Canada

Origin: Native

Regularity: Regularly occurring

Currently: Present

Confidence: Confident

Type of Residency: Year-round

United States

Origin: Native

Regularity: Regularly occurring

Currently: Present

Confidence: Confident

Type of Residency: Year-round

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Global Range: (>2,500,000 square km (greater than 1,000,000 square miles)) BREEDING: central Alaska, Mackenzie Delta, northern Prairie Provinces, northern Ontario, south to northern Washington, northern Montana; locally south to the mountains of Oregon, northern California, and northern Colorado (Andrews and Righter 1992). NON-BREEDING: Aleutians, Alaska Peninsula, Great Lakes, New Brunswick and Newfoundland, south to Baja California, mainland Mexico, Gulf Coast, Florida; occasionally in Hawaii. The most abundant wintering populations include those around Vancouver Island, along the Atlantic coast from the Bay of Fundy to Chesapeake Bay, and in northern California-southern Oregon, Mississippi, eastern New Mexico (Root 1988).

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Physical Description

Morphology

Physical Description

The Bufflehead is a small diving duck, with males at the upper end of the weight range and females at the lower end. Buffleheads are compact, with a short neck and a short narrow grey bill. The sexes are strongly dimorphic. Breeding males have a black head marked with purple and green, along with a black back and wings. They are white underneath, as well as having a white patch over their head from their eyes covering their ear region. Females are dark brown with pale grey underneath and a less distinct white head patch.

Range mass: 297 to 551 g.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Physical Description

The Bufflehead is a small diving duck, with males at the upper end of the weight range and females at the lower end. Buffleheads are compact, with a short neck and a short narrow grey bill. The sexes are strongly dimorphic. Breeding males have a black head marked with purple and green, along with a black back and wings. They are white underneath, as well as having a white patch over their head from their eyes covering their ear region. Females are dark brown with pale grey underneath and a less distinct white head patch.

Range mass: 297 to 551 g.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Size

Length: 34 cm

Weight: 473 grams

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Ecology

Habitat

Buffleheads seek out either small lakes or permanent freshwater ponds with no outlet. Perhaps because they seem to depend on the nesting cavities of the Northern Flicker, their habitat is coincident with its habitat. It includes poplar or aspen stands or coniferous forests mixed with poplars or aspens. Bufflehead will nest in prairie habitats only when stands of trees and water are present close by.

Terrestrial Biomes: savanna or grassland ; forest

Aquatic Biomes: lakes and ponds

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Habitat and Ecology

Systems
  • Terrestrial
  • Freshwater
  • Marine
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Buffleheads seek out either small lakes or permanent freshwater ponds with no outlet. Perhaps because they seem to depend on the nesting cavities of the Northern Flicker, their habitat is coincident with its habitat. It includes poplar or aspen stands or coniferous forests mixed with poplars or aspens. Bufflehead will nest in prairie habitats only when stands of trees and water are present close by.

Terrestrial Biomes: savanna or grassland ; forest

Aquatic Biomes: lakes and ponds

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Depth range based on 62174 specimens in 1 taxon.
Water temperature and chemistry ranges based on 1 sample.

Environmental ranges
  Depth range (m): 0 - 0
  Temperature range (°C): 16.537 - 16.537
  Nitrate (umol/L): 0.165 - 0.165
  Salinity (PPS): 33.352 - 33.352
  Oxygen (ml/l): 5.634 - 5.634
  Phosphate (umol/l): 0.362 - 0.362
  Silicate (umol/l): 2.470 - 2.470
 
Note: this information has not been validated. Check this *note*. Your feedback is most welcome.
Public Domain

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Comments: BREEDING: Lakes, ponds, rivers and seacoasts (AOU 1983). Breeds in tree cavities in mixed coniferous-deciduous woodland near lakes and ponds (AOU 1983). Usually nests in natural tree cavities, or abandoned flicker holes. Females often nest in same site in successive years. NON-BREEDING: wintering on sheltered bays and estuaries as well as open freshwater situations (AOU 1983).

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Migration

Non-Migrant: No. All populations of this species make significant seasonal migrations.

Locally Migrant: No. No populations of this species make local extended movements (generally less than 200 km) at particular times of the year (e.g., to breeding or wintering grounds, to hibernation sites).

Locally Migrant: Yes. At least some populations of this species make annual migrations of over 200 km.

Migrates northward February-April. Begins moving southward from October into November.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Trophic Strategy

Food Habits

Buffleheads feed in open, shallow water. They dive for their food, which they swallow while still underwater. This includes both freshwater and saltwater aquatic invertebrates (insects, crustaceans, and molluscs). They also eat some seeds, chiefly seeds of pondweeds and bulrushes.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Food Habits

Buffleheads feed in open, shallow water. They dive for their food, which they swallow while still underwater. This includes both freshwater and saltwater aquatic invertebrates (insects, crustaceans, and molluscs). They also eat some seeds, chiefly seeds of pondweeds and bulrushes.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Comments: In fresh water feeds on aquatic insects, snails, amphipods, small fishes, and some aquatic plants. In salt water eats crustaceans, molluscs, fishes, and some aquatic plants. Often feeds in small groups, diving or watching for danger.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Population Biology

Global Abundance

>1,000,000 individuals

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

General Ecology

Usually seen in small groups of twos or threes. Female strongly defends brood territory. In British Columbia, breeding density not limited by nest sites but rather by territorial behavior (Gauthier and Smith 1987); also, may be excluded from some ponds at high Barrow's goldeneye densities (Savard et al. 1991).

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Life History and Behavior

Cyclicity

Comments: Usually migrates at night.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Life Expectancy

Lifespan/Longevity

Average lifespan

Status: wild:
224 months.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Lifespan/Longevity

Average lifespan

Status: wild:
224 months.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Lifespan, longevity, and ageing

Maximum longevity: 18.7 years (wild)
Creative Commons Attribution 3.0 (CC BY 3.0)

© Joao Pedro de Magalhaes

Source: AnAge

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Reproduction

Unlike most ducks, Buffleheads form long term monogamous pair bonds. They nest in cavities excavated by Colaptes auratus or in nest boxes. They do not modify nests once they have selected a nesting site. Egg laying occurs in early May, with each female producing 6 to 11 eggs. Females incubate the eggs alone, taking two 80 minute recesses per day. Eggs are incubated for 28 to 33 days. After hatching, the young remain at the nest for about one day, then the female leads them to the nearest water. She cares for the young alone, but never feeds them. Rather, she protects a set territory which provides the ducklings with a safe area to find food. Occasionally territiorial disputes between females arise, sometimes leading to the death of ducklings.

Range eggs per season: 6 to 11.

Range time to hatching: 28 to 33 days.

Key Reproductive Features: seasonal breeding ; gonochoric/gonochoristic/dioecious (sexes separate)

Average eggs per season: 8.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Unlike most ducks, Buffleheads form long term monogamous pair bonds. They nest in cavities excavated by northern flickers or in nest boxes. They do not modify nests once they have selected a nesting site. Egg laying occurs in early May, with each female producing 6 to 11 eggs. Females incubate the eggs alone, taking two 80 minute recesses per day. Eggs are incubated for 28 to 33 days. After hatching, the young remain at the nest for about one day, then the female leads them to the nearest water. She cares for the young alone, but never feeds them. Rather, she protects a set territory which provides the ducklings with a safe area to find food. Occasionally territiorial disputes between females arise, sometimes leading to the death of ducklings.

Range eggs per season: 6 to 11.

Range time to hatching: 28 to 33 days.

Key Reproductive Features: seasonal breeding ; gonochoric/gonochoristic/dioecious (sexes separate)

Average eggs per season: 8.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Breeding begins mid-May in south to early June in north (Harrison 1978). Clutch size 6-11 (avg. 7-9). Incubation 28-33 days, by female (Terres 1980). In British Columbia, mean hatching date is mid- to late June (Savard et al. 1991). Young tended by female, fly 50-55 days after hatching. First breeds at 2 yr.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Barcode data: Bucephala albeola

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There are 8 barcode sequences available from BOLD and GenBank.  Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.  See the BOLD taxonomy browser for more complete information about this specimen and other sequences.

NNCCTGTATCTTATCTTCGGGGCATGAACCGGGATAATTGGTACAGCACTCAGCCTGCTAATCCGCGCAGAACTCGGCCAACCAGGGACCCTCCTGGGCGATGACCAAATTTACAACGTAATCGTCACCGCCCACGCCTTCGTAATAATCTTCTTCATAGAAATGCCCATCATGATTGGAGGGTTCGGCAACTGATTAGTCCCCCTAATGATCGGCGCCCCCGACATAGCATTCCCACGAATAAACAACATAAGCTTCTGACTCCTCCCACCATCATTCCTCCTACTGCTCGCTTCATCTACCGTAGAAGCTGGCGCCGGCACAGGCTGAACCGTATACCCACCCCTAGCAGGGAATCTAGCCCACGCTGGGGCCTCCGTAGACCTGGCCATCTTCTCACTCCATTTGGCCGGTATTTCCTCCATCCTCGGGGCCATTAACTTCATCACCACAGCCATCAACATAAAACCCCCCGCACTCTCACAATACCAAACCCCACTCTTCGTCTGATCCGTCTTAATCACCGCCATCCTGCTCCTCCTGTCACTCCCTGTACTCGCTGCTGGTATCACAATACTACTAACTGACCGAAACCTAAACACCACATTCTTCGACCCCGCCGGAGGAGGAGACCCGATCTTATACCAACACCTATTCTGATTCTTCGGCCACCCAGAAGTCTACATCTTAATCCTC
-- end --

Download FASTA File
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Statistics of barcoding coverage: Bucephala albeola

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 8
Specimens with Barcodes: 8
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Conservation

Conservation Status

While Buffleheads are not prized among duck hunters, they make up about 2% of sport hunting in the U.S. and Canada. This causes a potential problem, since the tendency for ducks to return to their breeding ground year after year coupled with local overharvesting can cause devastation of local populations. Further, clear-cut lumbering threatens their boreal forest habitats. Nesting boxes provide a possible solution for this problem; however, these boxes must be the correct size and location, or other cavity-nesters may exclude Bufflehead. Currently, Bufflehead populations appear to be in good condition; they are among the few species of duck whose numbers have grown since the mid-1950's. Careful monitoring should continue, however, to insure that lumbering and overhunting do not come to threaten their populations.

IUCN Red List of Threatened Species: least concern

US Migratory Bird Act: protected

US Federal List: no special status

CITES: no special status

State of Michigan List: no special status

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

IUCN Red List Assessment


Red List Category
LC
Least Concern

Red List Criteria

Version
3.1

Year Assessed
2009

Assessor/s
BirdLife International

Reviewer/s
Bird, J., Butchart, S.

Contributor/s

Justification
This species has an extremely large range, and hence does not approach the thresholds for Vulnerable under the range size criterion (Extent of Occurrence <20,000 km2 combined with a declining or fluctuating range size, habitat extent/quality, or population size and a small number of locations or severe fragmentation). The population trend appears to be increasing, and hence the species does not approach the thresholds for Vulnerable under the population trend criterion (>30% decline over ten years or three generations). The population size is extremely large, and hence does not approach the thresholds for Vulnerable under the population size criterion (<10,000 mature individuals with a continuing decline estimated to be >10% in ten years or three generations, or with a specified population structure). For these reasons the species is evaluated as Least Concern.

History
  • 2008
    Least Concern
  • 2004
    Least Concern
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

While Buffleheads are not prized among duck hunters, they make up about 2% of sport hunting in the U.S. and Canada. This causes a potential problem, since the tendency for ducks to return to their breeding ground year after year coupled with local overharvesting can cause devastation of local populations. Further, clear-cut lumbering threatens their boreal forest habitats. Nesting boxes provide a possible solution for this problem; however, these boxes must be the correct size and location, or other cavity-nesters may exclude Bufflehead. Currently, Bufflehead populations appear to be in good condition; they are among the few species of duck whose numbers have grown since the mid-1950's. Careful monitoring should continue, however, to insure that lumbering and overhunting do not come to threaten their populations.

US Migratory Bird Act: protected

US Federal List: no special status

CITES: no special status

State of Michigan List: no special status

IUCN Red List of Threatened Species: least concern

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

National NatureServe Conservation Status

Canada

Rounded National Status Rank: N5B,N5N : N5B: Secure - Breeding, N5N: Secure - Nonbreeding

United States

Rounded National Status Rank: N5B,N5N : N5B: Secure - Breeding, N5N: Secure - Nonbreeding

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

NatureServe Conservation Status

Rounded Global Status Rank: G5 - Secure

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Global Long Term Trend: Increase of 10-25% to decline of 30%

Comments: Populations increased in the northeastern U.S., 1927-1966; during the same period, populations increased slightly in the Great Lakes region and the southeastern U.S., and declined in the West (Bellrose 1980).

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Management

Management Requirements: Will use nest boxes (see Gauthier 1988 for specifications and recommendations on placement); should be at least 30 cm deep, at least 100 m apart, close to water in dense forest dominated by conifers.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Relevance to Humans and Ecosystems

Benefits

Economic Importance for Humans: Positive

Buffleheads are hunted for sport throughout the U.S. and Canada.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Economic Importance for Humans: Positive

Buffleheads are hunted for sport throughout the U.S. and Canada.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Wikipedia

Bufflehead

The Bufflehead (Bucephala albeola) is a small American sea duck of the genus Bucephala, the goldeneyes. This species was first described by Linnaeus in his Systema naturae in 1758 as Anas albeola.[2]

Contents

Description

The Bufflehead ranges from 32–40 cm long (12.5–16 inches) and 270–550 g (0.6–1.2 lbs), with the drakes larger than the females. Averaging 35.5 cm (14 in) and 370 g (13 oz), it rivals the Green-winged Teal as the smallest American duck.

Adult males are striking black and white, with iridescent green and purple heads with a large white patch behind the eye. Females are grey-toned with a smaller white patch behind the eye and a light underside.[3]

The name Bufflehead is a combination of buffalo and head, referring to the oddly bulbous head shape of the species.[4] This is most noticeable when the male puffs out the feathers on the head, thus greatly increasing the apparent size of the head.

Distribution and habitat

They are migratory and most of them winter in protected coastal waters, or open inland waters, on the east and west coasts of North America and the southern United States. The Bufflehead is an extremely rare vagrant to western Europe. Their breeding habitat is wooded lakes and ponds in Alaska and Canada, almost entirely included in the boreal forest or taiga habitat.

Behavior

Male flying in California

Buffleheads have evolved their small size in order to fit the nesting cavity of their "metabiotic" host, a woodpecker, the Northern Flicker.[5] Due to their small size, they are highly active, undertaking dives almost continuously sustained by their high metabolism. They do not tend to collect in large flocks; groups are usually limited to small numbers. One duck will serve as a sentry, watching for predators as the others in the group dive in search of food.[3] Buffleheads are amongst the last waterfowl to leave their breeding grounds and one of the world's most punctual migrants, arriving on their wintering grounds within a narrow margin of time.[6]

Breeding

Buffleheads are monogamous, and the females return to the same breeding site, year after year. They nest in cavities in trees, primarily aspens or poplars, using mostly old Flicker nests, close (usually <25 m) to water. Nest competitors include Mountain Bluebird (Sialia currucoides), Tree Swallow (Tachycineta bicolor), and European Starling. There was one recorded instance of a female Barrow's Goldeneye killing a Bufflehead adult female and her brood. Smaller cavities are preferred because of less competition with the larger Goldeneyes. Females may be killed on the nest by mammals, such as weasels (Mustela spp.) or mink (Mustela vison), and by Goldeneyes over nest competition.

Average clutch size is 9 (range 6–11), and eggs average 50.5 by 36.3 mm.[5] Incubation averages 30 days, and nest success is high (79% in one study) compared to ground-nesting species like the Teal. A day after the last duckling hatches the brood leaps from the nest cavity. The young fledge at 50–55 days of age.[7] Predators of adults include the Peregrine Falcon (Falco peregrinus), Snowy Owl (Bubo scandiacus), Bald Eagle (Haliaeetus leucocephalus), Golden Eagle (Aquila chrysaetos), Red-tailed Hawk (Buteo jamaicensis), Great Horned Owl (Bubo virginianus), Eurasian Eagle Owl (Bubo bubo), and Cooper's Hawk (Accipiter cooperii).

Diet

These diving birds forage underwater. They prefer water depths of 1.2–4.5 m (4 to 15 ft).[3] In freshwater habitats they eat primarily insects, and in saltwater they feed predominantly on crustaceans and mollusks. Aquatic plants and fish eggs can often become locally important food items as well.

Relationship with humans

Because of their striking plumage, highly active nature and their close proximity to humans on waterfront properties, Buffleheads are one of the most popular birds amongst bird watchers.[7] For these reasons and others, they are the first species of ducks to be boldly displayed on a Coat of Arms.[8] Buffleheads are hunted and are considered a gamebird. In contrast to many other seaducks that have declined in recent decades, Bufflehead numbers have remained relatively constant.[5] Habitat degradation is the major threat to this bird, since they depend on very limited coastal habitat on their wintering grounds, and very specific habitat in their boreal breeding grounds. Although Buffleheads do use man-made nest boxes, they still need the forest habitat to thrive.

References

  1. ^ BirdLife International (2012). "Bucephala albeola". IUCN Red List of Threatened Species. Version 2012.1. International Union for Conservation of Nature. http://www.iucnredlist.org/apps/redlist/details/100600496. Retrieved 16 July 2012.
  2. ^ Linnaeus, C (1758) (in Latin). Systema naturae per regna tria naturae, secundum classes, ordines, genera, species, cum characteribus, differentiis, synonymis, locis. Tomus I. Holmiae. (Laurentii Salvii). p. 124. "A. alba, dorso remigibusque nigris, capite caerulescente, occipite albo."
  3. ^ a b c Lippson, Alice Jane; Lippson, Robert L. (1997). Life in the Chesapeake Bay. JHU Press. pp. 253. ISBN 0-8018-5475-X. http://books.google.com/books?id=SADdrFVym2cC&pg=PA253.
  4. ^ Fergus, Charles (2004). Wildlife of Virginia and Maryland and Washington DC. Stackpole Books. pp. 166. ISBN 0-8117-2821-8. http://books.google.com/books?id=W7UxSPd2XMAC&pg=PA166.
  5. ^ a b c Gauthier, G. 1993. Bufflehead, Bucephala albeola. The Birds of North America. (67), 24 pages. Edited by A. Poole and F. Gill, The Academy of Natural Sciences of Philadelphia.
  6. ^ Finley, J.K. 2007. The punctual Bufflehead, Bucephala albeola: autumn arrivals in Shoal Harbour Sanctuary, Vancouver Island, in relation to freeze-up. Canadian Field-Naturalist 121:370-374.
  7. ^ a b Erskine, A. J. 1972. Buffleheads. Canadian Wildlife Service Monograph Series #4. Information Canada, Ottawa. 240 pages
  8. ^ Town of Sidney, British Columbia, web site
Creative Commons Attribution Share Alike 3.0 (CC BY-SA 3.0)

 

Source: Wikipedia

Unreviewed

Article rating from 0 people

Average rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!