Overview

Brief Summary

Bucephala albeola

A small, teal-sized duck (13-15 inches), the male Bufflehead may be most easily identified by the large white patch on the back of its head. Other distinguishing characteristics include its iridescent green head, white body, and patchy black-and-white wings visible in flight. The female Bufflehead is dull brown above with a white belly, light brown flanks, and a smaller white patch behind the eye. Duck hunters refer to this species as the “butterball” in reference to the male’s large white head patch. The Bufflehead breeds primarily in west-central Canada, in central Alaska, and at higher elevations in the Rocky Mountains. Small numbers of Buffleheads breed elsewhere in western North America, extending east to the Great Lakes. This species migrates south for the winter, when it may be found unevenly distributed across the southern half of North America. Buffleheads are found locally in the interior of their winter range, but are more common along the Atlantic and Pacific coasts north to Nova Scotia and Alaska, respectively. In summer, Buffleheads breed on ponds and lakes near forests. Buffleheads are particularly attracted to forests inhabited by the Northern Flicker (Colaptes auratus) because this species builds its nest in old Flicker nest cavities. In winter, Buffleheads may be found on sheltered saltwater bays and estuaries or, inland, on large lakes or rivers. This species primarily eats small animals, such as crustaceans, mollusks, and insects when available. One of several species of “diving ducks” in North America, Buffleheads may be observed submerging themselves to feed in the water or on the bottom. In winter, they may also be observed in small flocks on large, slow-moving bodies of water. This species is primarily active during the day.

Threat Status: Least concern

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Unknown

Supplier: DC Birds

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Distribution

Buffleheads are native to North America. Their summer breeding range includes central Alaska and extends south to British Columbia and east to Saskatchewan. Isolated breeding populations can also be found throughout the northern United States and in Quebec. Their winter distribution is generally split into two populations, one on the east coast and the other on the west coast of North America. The east coast population is usually found from New Jersey to North Carolina, and can be reaches up to the Bay of Fundy in New Brunswick, Canada. The west coast population is concentrated in British Columbia, Washington, and California. The most substantial winter confluence occurs on British Columbia’s Vancouver Island and the Californian coast. They are less likely to be found moving inland from the western Klamath Basin in California and Oregon toward the Mississippi River.

Biogeographic Regions: nearctic (Native )

  • Gauthier, G. 1993. "The Birds of North America Online" (On-line). Bufflehead (Bucephala albeola). Accessed February 08, 2012 at http://bna.birds.cornell.edu/bna/species/067.
  • Usai, M. 1999. Bufflehead: Diving duck winters in New York. New York State Conservationist, 53/4: 10-12.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

occurs (regularly, as a native taxon) in multiple nations

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

National Distribution

Canada

Origin: Native

Regularity: Regularly occurring

Currently: Present

Confidence: Confident

Type of Residency: Year-round

United States

Origin: Native

Regularity: Regularly occurring

Currently: Present

Confidence: Confident

Type of Residency: Year-round

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Global Range: (>2,500,000 square km (greater than 1,000,000 square miles)) BREEDING: central Alaska, Mackenzie Delta, northern Prairie Provinces, northern Ontario, south to northern Washington, northern Montana; locally south to the mountains of Oregon, northern California, and northern Colorado (Andrews and Righter 1992). NON-BREEDING: Aleutians, Alaska Peninsula, Great Lakes, New Brunswick and Newfoundland, south to Baja California, mainland Mexico, Gulf Coast, Florida; occasionally in Hawaii. The most abundant wintering populations include those around Vancouver Island, along the Atlantic coast from the Bay of Fundy to Chesapeake Bay, and in northern California-southern Oregon, Mississippi, eastern New Mexico (Root 1988).

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

North America; Newfoundland to Florida
  • North-West Atlantic Ocean species (NWARMS)
Creative Commons Attribution 3.0 (CC BY 3.0)

© WoRMS for SMEBD

Source: World Register of Marine Species

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Geographic Range

The Bufflehead ranges predominantly through boreal forests and aspen parklands of Canada and Alaska, with the highest density in British Columbia and Alberta. Their nonbreeding range extends through the contential United States into Northern Mexico.

Biogeographic Regions: nearctic (Native )

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: BioKIDS Critter Catalog

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Range

Breeds n North America; winters to Mexico and Greater Antilles.
  • Clements, J. F., T. S. Schulenberg, M. J. Iliff, D. Roberson, T. A. Fredericks, B. L. Sullivan, and C. L. Wood. 2014. The eBird/Clements checklist of birds of the world: Version 6.9. Downloaded from http://www.birds.cornell.edu/clementschecklist/download/

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Physical Description

Morphology

Buffleheads are small diving ducks that exhibit strong sexual dimorphism. Males with breeding plumage are predominately black and white, with a black head and back that appears iridescent green and purple. They have a white underbelly and a distinguishing large white patch extending from the nape of the neck to the crown of the head. Males have blue-gray bills and pink webbed feet. Females are similar in plumage to male yearlings. They are grey on the bottom and brown on top with a white patch on the sides of the head. Both male yearlings and adult females have bills that are dark gray to black and legs and toes that are dark pink while webbed feet are brown. The ear patch of female buffleheads is more defined than the that of yearling males. The downy coats of hatchlings are black to dark grey with a white patched cheeks, throats, lower breasts, and bellies.

Buffleheads weigh 270 to 513 grams and are 32 to 40 cm long. Their wingspan is 16.9 to 17.5 cm long. Sexual dimorphism is exhibited in their size as well. Adult males weigh 450 grams on average and are 35 to 40 cm long, while females weigh 325 grams on average and are 32 to 35 cm long. Their folded wings are 18 cm or less in adults and their tails are less than 8 cm long.

Adult males are sometimes mistaken for common goldeneyes (Bucephala clangula), Barrow’s goldeneyes (<< Bucephala islandica>>) and hooded mergansers (Lophodytes cucullatus). Unlike buffleheads, goldeneyes have a white patch that starts below the eye and extends towards the beak and they both have golden eyes. Hooded mergansers are larger and have a fan-shaped white patch on their heads. Unlike bufflehead males, their chests and wings haave white stripes and a brownish or golden brown underside.

Range mass: 270 to 513 g.

Range length: 32 to 40 cm.

Range wingspan: 16.9 to 17.5 cm.

Sexual Dimorphism: male larger; sexes colored or patterned differently; male more colorful

Other Physical Features: endothermic ; bilateral symmetry

  • Dugger, B., K. Dugger, L. Fredrickson. 2009. "The Birds of North America Online" (On-line). Accessed April 08, 2012 at http://bna.birds.cornell.edu/bna/species/098.
  • Eadie, J., M. Mallory, H. Lumsden. 1995. "The Birds of North America Online" (On-line). Accessed April 08, 2012 at http://bna.birds.cornell.edu/bna/species/170.
  • McKinney, R., S. McWilliams. 2005. A new model to estimate daily energy expenditure for wintering waterfowl. The Wilson Bulletin, 117/1: 44-55.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Physical Description

The Bufflehead is a small diving duck, with males at the upper end of the weight range and females at the lower end. Buffleheads are compact, with a short neck and a short narrow grey bill. The sexes are strongly dimorphic. Breeding males have a black head marked with purple and green, along with a black back and wings. They are white underneath, as well as having a white patch over their head from their eyes covering their ear region. Females are dark brown with pale grey underneath and a less distinct white head patch.

Range mass: 297 to 551 g.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: BioKIDS Critter Catalog

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Size

Length: 34 cm

Weight: 473 grams

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Ecology

Habitat

Buffleheads live in boreal forests and aspen parklands as well as seasonally-flooded wetlands and estuaries. They can be found along ecotones, and in marshes, farmlands, grasslands, and open waters. They prefer ponds and small lakes with no drainage while breeding. During migration, they use rivers and available water bodies as temporary habitat. Their winter habitat includes salty bodies of water like marshes, coastlines, and estuaries with shelter. They are not found at high mountain elevations.

Habitat Regions: temperate ; terrestrial ; saltwater or marine ; freshwater

Terrestrial Biomes: taiga ; savanna or grassland ; forest ; scrub forest

Aquatic Biomes: lakes and ponds; rivers and streams; temporary pools; coastal ; brackish water

Wetlands: marsh ; swamp ; bog

Other Habitat Features: suburban ; agricultural ; riparian ; estuarine

  • Gammonley, J., M. Heitmeyer. 1990. Behavior body condition, and foods of buffleheads and lesser scaups during spring migration through the Klamath Basin, California. Wilson Bulletin, 102/4: 672-683.
  • Knutsen, G., J. King. 2004. Bufflehead breeding activity in south-central North Dakota. The Prairie Naturalist, 36/3: 187-190.
  • McKinney, R. 2004. Habitat relationships of waterfowl wintering in Narrgansett Bay. Rhode Island Naturalist, 11/2: 3-6.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Habitat and Ecology

Systems
  • Terrestrial
  • Freshwater
  • Marine
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Comments: BREEDING: Lakes, ponds, rivers and seacoasts (AOU 1983). Breeds in tree cavities in mixed coniferous-deciduous woodland near lakes and ponds (AOU 1983). Usually nests in natural tree cavities, or abandoned flicker holes. Females often nest in same site in successive years. NON-BREEDING: wintering on sheltered bays and estuaries as well as open freshwater situations (AOU 1983).

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Buffleheads seek out either small lakes or permanent freshwater ponds with no outlet. Perhaps because they seem to depend on the nesting cavities of the Northern Flicker, their habitat is coincident with its habitat. It includes poplar or aspen stands or coniferous forests mixed with poplars or aspens. Bufflehead will nest in prairie habitats only when stands of trees and water are present close by.

Terrestrial Biomes: savanna or grassland ; forest

Aquatic Biomes: lakes and ponds

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: BioKIDS Critter Catalog

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Depth range based on 62174 specimens in 1 taxon.
Water temperature and chemistry ranges based on 1 sample.

Environmental ranges
  Depth range (m): 0 - 0
  Temperature range (°C): 16.537 - 16.537
  Nitrate (umol/L): 0.165 - 0.165
  Salinity (PPS): 33.352 - 33.352
  Oxygen (ml/l): 5.634 - 5.634
  Phosphate (umol/l): 0.362 - 0.362
  Silicate (umol/l): 2.470 - 2.470
 
Note: this information has not been validated. Check this *note*. Your feedback is most welcome.

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Migration

Non-Migrant: No. All populations of this species make significant seasonal migrations.

Locally Migrant: No. No populations of this species make local extended movements (generally less than 200 km) at particular times of the year (e.g., to breeding or wintering grounds, to hibernation sites).

Locally Migrant: Yes. At least some populations of this species make annual migrations of over 200 km.

Migrates northward February-April. Begins moving southward from October into November.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Trophic Strategy

Buffleheads primarily eat aquatic invertebrates and some seeds. Their freshwater diet consists of mostly insects like damselfly larvae, dragonfly larvae, midge larvae, water boatmen, mayfly larvae, caddisfly larvae and other insects. In saltwater habitats, a variety of arthropods and molluscs make up their diet. Buffleheads on the Pacific coast have been recorded consuming herring eggs in multi-species flocks and they occasionally eat fish like sculpins and ratfish. Prey is swallowed while submerged under the water. Buffleheads prefer to feed in water less than 3 meters deep. All of their food is acquired by diving except for downy young, who will dabble when first taking to the water.

Buffleheads' diet varies seasonally and by habitat. In the fall, pondweed seeds, sedges, bulrushes, and mare’s tail become important to the bufflehead diet. The literature reports that avian egg shells and bones have also been found in their stomachs. Female buffleheads that consumed mostly gastropods during egg-laying were found to have higher egg production. Eggs were also found to be larger with stronger shells. Gastropod consumption peaks during incubation.

Animal Foods: amphibians; fish; insects; mollusks; aquatic crustaceans; other marine invertebrates

Plant Foods: roots and tubers; wood, bark, or stems; seeds, grains, and nuts

Primary Diet: carnivore (Insectivore , Eats non-insect arthropods, Molluscivore )

  • Thompson, J., C. Ankney. 2002. Role of food in territoriality and egg production of buffleheads (Bucephala albeola) and Barrow’s goldeneyes (Bucephala islandica). The Auk, 119/4: 1075-1090.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Comments: In fresh water feeds on aquatic insects, snails, amphipods, small fishes, and some aquatic plants. In salt water eats crustaceans, molluscs, fishes, and some aquatic plants. Often feeds in small groups, diving or watching for danger.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Food Habits

Buffleheads feed in open, shallow water. They dive for their food, which they swallow while still underwater. This includes both freshwater and saltwater aquatic invertebrates (insects, crustaceans, and molluscs). They also eat some seeds, chiefly seeds of pondweeds and bulrushes.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: BioKIDS Critter Catalog

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Associations

Buffleheads disperse seeds in their environment. They compete for nests with Barrow’s goldeneyes (Bucephala islandica), common goldeneyes (Bucephala clangula), squirrels (Sciuridae), European starlings (Sturnus vulgaris) and northern flickers (Colaptes auratus).

Like many ducks, buffleheads are prone to infection by a variety of parasites. When comparing buffleheads to other ducks, however, the abundance of parasitic species is modest. By examining the gizzards and intestines of adult buffleheads several species of roundworms, flukes, tapeworms, and thorny-headed worms were found. The roundworm species found were: Amidostomum acutum, Capillaria anatis, Capillaria contorta, Echinuria parva, Ecinuria uncinata, NematodaSchistorophus, Streptocara crassicauda, Streptocara formosensis, Tetrameres crami, Tetrameres fissipina, and Tetrameres spinosa. The flukes found were: Apatemon canadensis, Apatemon gracilis, Cotylurus strigeoides, Dendritobilharzia pulverulenta, Echinoparypthium recurvatum, Echinostoma trivolvis, Gyrosoma marilae, Maritrema obstipum, Notochotylus attenuatus, Odhneria odhneri, Philophthalmus gralli, Plagiorchis elegans, Prosthogonimus cuneatus, Pseudosplotrema, Psilochasmus oxyurus, Strigea, and Zygocotyle lunata. The tapeworms found were: Abortilepis, Aploparaksis, Cloacotaenia, Cloacotaenia megalops, Dicranotaenia multisticta, Diorchis bulbodes, Diploposthe laevis, Fimbriaria, Gastrotaenia cygni, Hymenolepis, Lateriporus skrjabini, Microsomacanthus collaris, Microsomacanthus melanittae, Microsomacanthus parvula, Platyscolex ciliata, Retinometra albeola, and Shistocephalus. Finally, the following thorny-headed worms found were: Corynosoma constrictum, Polymorphus acutis, Polymorphus marilis, and Polymorphus obtusus.

Of particular interest is that buffleheads appear to be the only duck with the tapeworm Retinometra albeolae. Leeches (Theromyzon rude, Theromyzon tesulatum, and Theromyzon bifarium) may infest their upper respiratory tract as well as their eyes. Bufflehead ducklings are more prone to leeches. A trematode in the family Schistosomatidae has been observed in the arteries. Renal coccidia also have been observed. Additionally, avian cholera (Pasteurella multocida), avian malaria (Plasmodium relictum), and avian influenza all have been identified in buffleheads. The literature states that little is known about the impacts of parasites and disease on buffleheads.

Ecosystem Impact: disperses seeds

Commensal/Parasitic Species:

  • Ewart, M., J. McLaughlin. 1990. Helminths from spring and fall migrant bufflehead ducks (Bucephala albeola) at Delta, Manitoba, Canada. Canadian Journal of Zoology, 68/10: 2230-2233.
  • Gladden, B., A. Canaris. 2009. Helminth parasites of the bufflehead duck, Bucephala albeola, wintering in the Chihuahua Desert with a checklist of helminth parasites reported From this host. Journal of Parasitology, 95/1: 129-136.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Buffleheads are vulnerable to an assortment of predators that include birds of prey and mammals. Included in this list are peregrine falcons (Falco peregrinus), snowy owls (Nyctea scandiaca), and bald eagles (Haliaeetus leucocephalus), and possibly great horned owls (Bubo virginianus) and Cooper’s hawks (Accipiter cooperii). Weasels (Mustela) including mink (Neovison vison) and also squirrels (Sciuridae) and black bears (Ursus americanus) have been reported to feed on eggs in nest boxes. Female buffleheads are particularly vulnerable when perched on the nest, and eggs are vulnerable while females forage.

Known Predators:

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Population Biology

Global Abundance

>1,000,000 individuals

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

General Ecology

Usually seen in small groups of twos or threes. Female strongly defends brood territory. In British Columbia, breeding density not limited by nest sites but rather by territorial behavior (Gauthier and Smith 1987); also, may be excluded from some ponds at high Barrow's goldeneye densities (Savard et al. 1991).

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Life History and Behavior

Behavior

Buffleheads find prey underwater by sight, and they communicate through vocalizations and displays. Courting bufflehead males bob their heads and produce a loud raspy noise. In late winter and spring, they emit a low snarling grunts. Females make a loud deep throated vocalization while following males during leading displays. Females use a distinct low note to call their young which speeds up and increases in volume if she becomes distressed. Buffleheads display a head-forward posture and raised wing feathers when they are threatened or when protecting their territory or brood. Males protect their territory by posturing next to other male buffleheads. This includes a head-forward posture, flapping wings, and a raised tail. Once this display ends, they part ways. Wing beating following the toe to toe display is thought to be a sign of concession by the loser.

Communication Channels: visual ; acoustic

Other Communication Modes: duets

Perception Channels: visual ; tactile ; acoustic ; chemical

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Cyclicity

Comments: Usually migrates at night.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Life Expectancy

Buffleheads live an estimated 2.5 years for males and 2.3 years for females. In rare cases, adults live very long and the record for the oldest adult is 18.7 years old. However, information on survivorship is limited. The most recent survivorship data available (1969 to 1973) was generated in New York State and was obtained by banding and recovering birds. From these data it was estimated that annual survivorship of females is between 61 to 73%, and 58 to 70% for males. Because the sample size was particularly small, (56 to 159 birds of each sex) the accuracy of these estimates is not known.

Range lifespan

Status: wild:
18.7 (high) years.

Average lifespan

Status: wild:
2.5 years.

Average lifespan

Status: wild:
2.5 years.

Average lifespan

Status: wild:
224 months.

  • de Magalhaes, J., J. Costa. 2009. A database of vertebrate longevity records and their relation to other life-history traits. Journal of Evolutionary Biology, 22/8: 1770-1774.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Lifespan/Longevity

Average lifespan

Status: wild:
224 months.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: BioKIDS Critter Catalog

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Lifespan, longevity, and ageing

Maximum longevity: 18.7 years (wild)
Creative Commons Attribution 3.0 (CC BY 3.0)

© Joao Pedro de Magalhaes

Source: AnAge

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Reproduction

Buffleheads generally form a mating pair that stays together during the season and in subsequent seasons. Less frequently, males pair with a second female after the first has finished laying her eggs. Courtship behavior occurs throughout the year and facilitates seasonal pairing of couples. Buffleheads use an array of physical displays and vocalizations during courtship. Males bob their heads and fly low over females to display their black and white underside and their pink legs, and then land with their feet straight as if water skiing. Paired birds display a “following” behavior where the female swims behind the male. The male stretches his neck upward and the female extends her neck back while she follows behind him. Buffleheads use displays both before and after copulation. Males also perform displays after threat or aggression from other males.

Mating System: monogamous

Buffleheads breed once per year from late winter to early April. Breeding females lay a single clutch between late April and mid-May with an average of 9 eggs per clutch. Female buffleheads typically lay their eggs close to the same date each year, but second and third-year breeding females lay 4 to 9 days earlier than first year breeders. Their eggs are olive-buff colored. On average, they measure 50 by 36 mm and weigh 36.68 g. Females incubate the eggs for 30 days while males leave to molt. When leaving the nest to feed during the incubation period, females cover their eggs with feathers.

Buffleheads use nests constructed by other species. Their nests are hollowed out cavities in trees usually within 15 m of a body of water and above flood plain level. Nests are often found in poplars and aspen, although pine trees are a favorite in the western United States. Nests are bare and buffleheads do not add material to their nests. Female buffleheads scout out their nest location up to a year in advance. If the desired nest is occupied when she returns, she searches for a new site with the male. Females only 1 year old have been observed searching for potential nest sites although they do not begin breeding until age 2. Two females have been documented sharing a same nest; however, one may evict the other that leaves the nest to feed. The average nest entrance is approximately 7 cm in diameter and the cavity diameter is 11.5 to 21 cm with a depth around 33.8 cm. Larger cavities are normally avoided because they are favored by goldeneyes (Bucephala islandica and Bucephala clangula). Goldeneyes can kill buffleheads in larger nests, but cannot enter the smaller entrances where buffleheads nest.

Bufflehead chicks hatch after 28 to 35 days. They typically hatch within a span of 12 hours, but may take up to 36 hours from first to last. It is thought that late hatching eggs are laid during incubation. Precocial chicks are born with their eyes open and fully covered in down, with a mass around 23.8 g. Buffleheads are able walk as soon as their plumage dries out. Young buffleheads are nurtured intently during and after hatching. Newly hatched chicks live in the nest for 1 to 2 days and are then encouraged to jump from the nest hole. New mother buffleheads protect their brood for 3 to 6 weeks, at which point the young buffleheads are considered independent.

Young ducklings are good swimmers, feeding on insects (92-100% of the time) on the water and dabbling for vegetation. Their diving abilities develop in the first few days and become the predominant mode of feeding. In fact, downy young spend 24% of their time diving. Growth rates vary among individuals which is typical of precocial birds. By day 20, the juvenile contour feathers begin to emerge with wing feathers appearing at day 23. Their belly feathers appear next and the head, back and neck feathers appear last. By day 40, males are apparently larger than their sisters. Plumage is complete after day 50 and the chicks fledge in 45 to 55 days. They reach reproductive maturity at 2 years.

Breeding interval: Buffleheads breed once per year from late winter to early April.

Breeding season: Late winter to early April

Range eggs per season: 6 to 11.

Range time to hatching: 28 to 33 days.

Range fledging age: 45 to 55 days.

Range time to independence: 3 to 6 weeks.

Average age at sexual or reproductive maturity (female): 2 years.

Average age at sexual or reproductive maturity (male): 2 years.

Key Reproductive Features: iteroparous ; seasonal breeding ; gonochoric/gonochoristic/dioecious (sexes separate); sexual ; oviparous

Average eggs per season: 8.

Male buffleheads stay with their mates during egg laying and for part of the incubation period. Females alone attend to the brood and defend their territory. They nurture their young for the first 2 to 3 weeks after hatching. The young huddle tightly together on both sides of the female on the shore or a floating log. Young buffleheads gather tightly and close behind their mother if she gives an alarm call. In British Columbia, 34% of broods had at least one exchange of young buffleheads between mothers, usually during a fight between them. Occasionally an entire brood is acquired by a female bufflehead that won a territorial fight. Bufflehead mothers protect their brood for up to 6 weeks, when the chicks are independent.

Parental Investment: precocial ; female parental care ; pre-fertilization (Protecting: Male); pre-hatching/birth (Protecting: Male, Female); pre-weaning/fledging (Provisioning: Female, Protecting: Female); pre-independence (Provisioning: Female, Protecting: Female)

  • Ahlund, M. 2005. Behavioural tactics at nest visits differ between parasites and hosts in brood-parasitic duck. Animal Behaviour, 70/2: 433-440.
  • Gammonley, J., M. Heitmeyer. 1990. Behavior body condition, and foods of buffleheads and lesser scaups during spring migration through the Klamath Basin, California. Wilson Bulletin, 102/4: 672-683.
  • Gauthier, G. 1993. "The Birds of North America Online" (On-line). Bufflehead (Bucephala albeola). Accessed February 08, 2012 at http://bna.birds.cornell.edu/bna/species/067.
  • Knutsen, G., J. King. 2004. Bufflehead breeding activity in south-central North Dakota. The Prairie Naturalist, 36/3: 187-190.
  • Lavers, J., J. Thompson, C. Paszkowski, C. Ankney. 2006. Variation in size and composition of bufflehead (Bucephala albeola) and Barrow’s goldeneye (Bucephala islandica) eggs. The Wilson Journal of Ornithology, 118/2: 173-177.
  • Usai, M. 1999. Bufflehead: Diving duck winters in New York. New York State Conservationist, 53/4: 10-12.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Breeding begins mid-May in south to early June in north (Harrison 1978). Clutch size 6-11 (avg. 7-9). Incubation 28-33 days, by female (Terres 1980). In British Columbia, mean hatching date is mid- to late June (Savard et al. 1991). Young tended by female, fly 50-55 days after hatching. First breeds at 2 yr.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Unlike most ducks, Buffleheads form long term monogamous pair bonds. They nest in cavities excavated by Colaptes auratus or in nest boxes. They do not modify nests once they have selected a nesting site. Egg laying occurs in early May, with each female producing 6 to 11 eggs. Females incubate the eggs alone, taking two 80 minute recesses per day. Eggs are incubated for 28 to 33 days. After hatching, the young remain at the nest for about one day, then the female leads them to the nearest water. She cares for the young alone, but never feeds them. Rather, she protects a set territory which provides the ducklings with a safe area to find food. Occasionally territiorial disputes between females arise, sometimes leading to the death of ducklings.

Range eggs per season: 6 to 11.

Range time to hatching: 28 to 33 days.

Key Reproductive Features: seasonal breeding ; gonochoric/gonochoristic/dioecious (sexes separate)

Average eggs per season: 8.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: BioKIDS Critter Catalog

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Barcode data: Bucephala albeola

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There are 8 barcode sequences available from BOLD and GenBank.

Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.

See the BOLD taxonomy browser for more complete information about this specimen and other sequences.

NNCCTGTATCTTATCTTCGGGGCATGAACCGGGATAATTGGTACAGCACTCAGCCTGCTAATCCGCGCAGAACTCGGCCAACCAGGGACCCTCCTGGGCGATGACCAAATTTACAACGTAATCGTCACCGCCCACGCCTTCGTAATAATCTTCTTCATAGAAATGCCCATCATGATTGGAGGGTTCGGCAACTGATTAGTCCCCCTAATGATCGGCGCCCCCGACATAGCATTCCCACGAATAAACAACATAAGCTTCTGACTCCTCCCACCATCATTCCTCCTACTGCTCGCTTCATCTACCGTAGAAGCTGGCGCCGGCACAGGCTGAACCGTATACCCACCCCTAGCAGGGAATCTAGCCCACGCTGGGGCCTCCGTAGACCTGGCCATCTTCTCACTCCATTTGGCCGGTATTTCCTCCATCCTCGGGGCCATTAACTTCATCACCACAGCCATCAACATAAAACCCCCCGCACTCTCACAATACCAAACCCCACTCTTCGTCTGATCCGTCTTAATCACCGCCATCCTGCTCCTCCTGTCACTCCCTGTACTCGCTGCTGGTATCACAATACTACTAACTGACCGAAACCTAAACACCACATTCTTCGACCCCGCCGGAGGAGGAGACCCGATCTTATACCAACACCTATTCTGATTCTTCGGCCACCCAGAAGTCTACATCTTAATCCTC
-- end --

Download FASTA File

Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Statistics of barcoding coverage: Bucephala albeola

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 8
Specimens with Barcodes: 8
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Conservation

Conservation Status

Buffleheads are listed as least concern on the IUCN Red List and do not have special status on US government lists. Previously, they were threatened by overshooting at the end of the 19th and beginning 20th century. Toxic contaminants are a current threat as well. Buffleheads collected around Long Island, NY, had low levels of polychlorinated biphenyls (PCBs) and mercury in their bodies. However, when compared to other dangers, habitat degradation is probably their biggest threat. Aspen nesting habitat has been replaced over the last 100 years in western North America with agricultural land, and clear-cutting for lumber continues to reduce the availability of nesting habitat. Nest boxes have been installed in some areas to supplement nesting habitat. It is important that these boxes be placed in conifer-heavy areas and the box openings be the correct size and mimic their natural nesting preferences. These specifications limit competition with other cavity-nesters.

US Migratory Bird Act: no special status

US Federal List: no special status

CITES: no special status

State of Michigan List: no special status

IUCN Red List of Threatened Species: least concern

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

IUCN Red List Assessment


Red List Category
LC
Least Concern

Red List Criteria

Version
3.1

Year Assessed
2012

Assessor/s
BirdLife International

Reviewer/s
Butchart, S. & Symes, A.

Contributor/s

Justification
This species has an extremely large range, and hence does not approach the thresholds for Vulnerable under the range size criterion (Extent of Occurrence <20,000 km2 combined with a declining or fluctuating range size, habitat extent/quality, or population size and a small number of locations or severe fragmentation). The population trend appears to be increasing, and hence the species does not approach the thresholds for Vulnerable under the population trend criterion (>30% decline over ten years or three generations). The population size is extremely large, and hence does not approach the thresholds for Vulnerable under the population size criterion (<10,000 mature individuals with a continuing decline estimated to be >10% in ten years or three generations, or with a specified population structure). For these reasons the species is evaluated as Least Concern.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

National NatureServe Conservation Status

Canada

Rounded National Status Rank: N5B,N5N : N5B: Secure - Breeding, N5N: Secure - Nonbreeding

United States

Rounded National Status Rank: N5B,N5N : N5B: Secure - Breeding, N5N: Secure - Nonbreeding

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

NatureServe Conservation Status

Rounded Global Status Rank: G5 - Secure

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

While Buffleheads are not prized among duck hunters, they make up about 2% of sport hunting in the U.S. and Canada. This causes a potential problem, since the tendency for ducks to return to their breeding ground year after year coupled with local overharvesting can cause devastation of local populations. Further, clear-cut lumbering threatens their boreal forest habitats. Nesting boxes provide a possible solution for this problem; however, these boxes must be the correct size and location, or other cavity-nesters may exclude Bufflehead. Currently, Bufflehead populations appear to be in good condition; they are among the few species of duck whose numbers have grown since the mid-1950's. Careful monitoring should continue, however, to insure that lumbering and overhunting do not come to threaten their populations.

IUCN Red List of Threatened Species: least concern

US Migratory Bird Act: protected

US Federal List: no special status

CITES: no special status

State of Michigan List: no special status

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: BioKIDS Critter Catalog

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Population

Population
The global population is estimated to number > c.1,200,000 individuals (Wetlands International 2006), while the population in Japan has been estimated at
Population Trend
Increasing
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Global Long Term Trend: Increase of 10-25% to decline of 30%

Comments: Populations increased in the northeastern U.S., 1927-1966; during the same period, populations increased slightly in the Great Lakes region and the southeastern U.S., and declined in the West (Bellrose 1980).

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Management

Management Requirements: Will use nest boxes (see Gauthier 1988 for specifications and recommendations on placement); should be at least 30 cm deep, at least 100 m apart, close to water in dense forest dominated by conifers.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Relevance to Humans and Ecosystems

Benefits

There are no adverse effects of Bucephala albeola on humans.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

During the winter and fall months the habitat of buffleheads is prime duck hunting range, so they are a target for hunters. Buffleheads make up 1 to 1.5% of all ducks killed in the U.S. and 1.5 to 2% in Canada. During 2009, in the Atlantic Flyway of Georgia, Maine and Maryland, 17,947 buffleheads were harvested. In 2008, there were 27,154 were harvested. Buffleheads also eat many types of insects, some of which are pests to humans.

Positive Impacts: food ; controls pest population

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Economic Importance for Humans: Positive

Buffleheads are hunted for sport throughout the U.S. and Canada.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: BioKIDS Critter Catalog

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Wikipedia

Bufflehead

The bufflehead (Bucephala albeola) is a small American sea duck of the genus Bucephala, the goldeneyes. This species was first described by Linnaeus in his Systema naturae in 1758 as Anas albeola.[2]

Description[edit]

The Bufflehead ranges from 32–40 cm (13–16 in) long and 270–550 g (9.5–19.4 oz), with the drakes larger than the females. Averaging 35.5 cm (14.0 in) and 370 g (13 oz), it rivals the green-winged teal as the smallest American duck.

Adult males are striking black and white, with iridescent green and purple heads with a large white patch behind the eye. Females are grey-toned with a smaller white patch behind the eye and a light underside.[3]

The name bufflehead is a combination of buffalo and head, referring to the oddly bulbous head shape of the species.[4] This is most noticeable when the male puffs out the feathers on the head, thus greatly increasing the apparent size of the head.

Distribution and habitat[edit]

They are migratory and most of them winter in protected coastal waters, or open inland waters, on the east and west coasts of North America and the southern United States. The Bufflehead is an extremely rare vagrant to western Europe. Their breeding habitat is wooded lakes and ponds in Alaska and Canada, almost entirely included in the boreal forest or taiga habitat.

Behavior[edit]

Male flying in California

Buffleheads have evolved their small size in order to fit the nesting cavity of their "metabiotic" host, a woodpecker, the northern flicker.[5] Due to their small size, they are highly active, undertaking dives almost continuously while sustained by their high metabolism. They do not tend to collect in large flocks; groups are usually limited to small numbers. One duck will serve as a sentry, watching for predators as the others in the group dive in search of food.[3] Buffleheads are amongst the last waterfowl to leave their breeding grounds and one of the world's most punctual migrants, arriving on their wintering grounds within a narrow margin of time.[6]

Breeding[edit]

Buffleheads are monogamous, and the females return to the same breeding site, year after year. They nest in cavities in trees, primarily aspens or poplars, using mostly old flicker nests, close (usually < 25 m (82 ft)) to water. Nest competitors include mountain bluebird (Sialia currucoides), tree swallow (Tachycineta bicolor), and European starling. There was one recorded instance of a female Barrow's goldeneye killing a bufflehead adult female and her brood. Smaller cavities are preferred because of less competition with the larger goldeneyes. Females may be killed on the nest by mammals, such as weasels (Mustela spp.) or mink (Mustela vison), and by goldeneyes over nest competition.

Average clutch size is 9 (range 6–11), and eggs average 50.5 by 36.3 mm (1.99 by 1.43 in).[5] Incubation averages 30 days, and nest success is high (79% in one study) compared to ground-nesting species like the teal. A day after the last duckling hatches the brood leaps from the nest cavity. The young fledge at 50–55 days of age.[7] Predators of adults include the peregrine falcon (Falco peregrinus), snowy owl (Bubo scandiacus), bald eagle (Haliaeetus leucocephalus), golden eagle (Aquila chrysaetos), red-tailed hawk (Buteo jamaicensis), great horned owl (Bubo virginianus), Eurasian eagle owl (Bubo bubo), and Cooper's hawk (Accipiter cooperii).

Diet[edit]

These diving birds forage underwater. They prefer water depths of 1.2–4.5 m (3.9–14.8 ft).[3] In freshwater habitats they eat primarily insects, and in saltwater they feed predominantly on crustaceans and mollusks. Aquatic plants and fish eggs can often become locally important food items as well.

Relationship with humans[edit]

Because of their striking plumage, highly active nature and their proximity to humans on waterfront properties, buffleheads are one of the most popular birds amongst bird watchers.[7] The bufflehead, also known as the spirit duck, was added to the coat of arms of the town of Sidney, British Columbia, in 1995.[8] Buffleheads are hunted and are considered a gamebird. In contrast to many other seaducks that have declined in recent decades, bufflehead numbers have remained relatively constant.[5] Habitat degradation is the major threat to this bird, since they depend on very limited coastal habitat on their wintering grounds, and very specific habitat in their boreal breeding grounds. Although buffleheads do use man-made nest boxes, they still need the forest habitat to thrive.

References[edit]

  1. ^ BirdLife International (2012). "Bucephala albeola". IUCN Red List of Threatened Species. Version 2013.2. International Union for Conservation of Nature. Retrieved 26 November 2013. 
  2. ^ Linnaeus, C (1758). Systema naturae per regna tria naturae, secundum classes, ordines, genera, species, cum characteribus, differentiis, synonymis, locis. Tomus I (in Latin). Holmiae. (Laurentii Salvii). p. 124. A. alba, dorso remigibusque nigris, capite caerulescente, occipite albo. 
  3. ^ a b c Lippson, Alice Jane; Lippson, Robert L. (1997). Life in the Chesapeake Bay. JHU Press. p. 253. ISBN 0-8018-5475-X. 
  4. ^ Fergus, Charles (2004). Wildlife of Virginia and Maryland and Washington DC. Stackpole Books. p. 166. ISBN 0-8117-2821-8. 
  5. ^ a b c Gauthier, G. 1993. Bufflehead, Bucephala albeola. The Birds of North America. (67), 24 pages. Edited by A. Poole and F. Gill, The Academy of Natural Sciences of Philadelphia.
  6. ^ Finley, J.K. 2007. The punctual Bufflehead, Bucephala albeola: autumn arrivals in Shoal Harbour Sanctuary, Vancouver Island, in relation to freeze-up. Canadian Field-Naturalist 121:370-374.
  7. ^ a b Erskine, A. J. 1972. Buffleheads. Canadian Wildlife Service Monograph Series #4. Information Canada, Ottawa. 240 pages
  8. ^ "Town Crest & Flag". Retrieved 2013-10-19. 
Creative Commons Attribution Share Alike 3.0 (CC BY-SA 3.0)

Source: Wikipedia

Unreviewed

Article rating from 0 people

Default rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!