Overview

Brief Summary

Bucephala albeola

A small, teal-sized duck (13-15 inches), the male Bufflehead may be most easily identified by the large white patch on the back of its head. Other distinguishing characteristics include its iridescent green head, white body, and patchy black-and-white wings visible in flight. The female Bufflehead is dull brown above with a white belly, light brown flanks, and a smaller white patch behind the eye. Duck hunters refer to this species as the “butterball” in reference to the male’s large white head patch. The Bufflehead breeds primarily in west-central Canada, in central Alaska, and at higher elevations in the Rocky Mountains. Small numbers of Buffleheads breed elsewhere in western North America, extending east to the Great Lakes. This species migrates south for the winter, when it may be found unevenly distributed across the southern half of North America. Buffleheads are found locally in the interior of their winter range, but are more common along the Atlantic and Pacific coasts north to Nova Scotia and Alaska, respectively. In summer, Buffleheads breed on ponds and lakes near forests. Buffleheads are particularly attracted to forests inhabited by the Northern Flicker (Colaptes auratus) because this species builds its nest in old Flicker nest cavities. In winter, Buffleheads may be found on sheltered saltwater bays and estuaries or, inland, on large lakes or rivers. This species primarily eats small animals, such as crustaceans, mollusks, and insects when available. One of several species of “diving ducks” in North America, Buffleheads may be observed submerging themselves to feed in the water or on the bottom. In winter, they may also be observed in small flocks on large, slow-moving bodies of water. This species is primarily active during the day.

Threat Status: Least Concern

  • Bucephala albeola. Xeno-canto. Xeno-canto Foundation, n.d. Web. 20 July 2012. .
  • Bufflehead (Bucephala albeola). The Internet Bird Collection. Lynx Edicions, n.d. Web. 20 July 2012. .
  • Gauthier, Gilles. 1993. Bufflehead (Bucephala albeola), The Birds of North America Online (A. Poole, Ed.). Ithaca: Cornell Lab of Ornithology; Retrieved from the Birds of North America Online: http://bna.birds.cornell.edu/bna/species/067
  • Peterson, Roger Tory. Birds of Eastern and Central North America. Boston: Houghton Mifflin, 1980. Print.
  • eBird Range Map - Bufflehead. eBird. Cornell Lab of Ornithology, N.d. Web. 20 July 2012. .
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Smithsonian Institution

Supplier: DC Birds

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Distribution

North America; Newfoundland to Florida
  • North-West Atlantic Ocean species (NWARMS)
translation missing: en.license_cc_by_4_0

© WoRMS Editorial Board

Source: World Register of Marine Species

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

North America; Newfoundland to Florida
translation missing: en.license_cc_by_4_0

© WoRMS for SMEBD

Source: World Register of Marine Species

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Buffleheads are native to North America. Their summer breeding range includes central Alaska and extends south to British Columbia and east to Saskatchewan. Isolated breeding populations can also be found throughout the northern United States and in Quebec. Their winter distribution is generally split into two populations, one on the east coast and the other on the west coast of North America. The east coast population is usually found from New Jersey to North Carolina, and can be reaches up to the Bay of Fundy in New Brunswick, Canada. The west coast population is concentrated in British Columbia, Washington, and California. The most substantial winter confluence occurs on British Columbia’s Vancouver Island and the Californian coast. They are less likely to be found moving inland from the western Klamath Basin in California and Oregon toward the Mississippi River.

Biogeographic Regions: nearctic (Native )

  • Gauthier, G. 1993. "The Birds of North America Online" (On-line). Bufflehead (Bucephala albeola). Accessed February 08, 2012 at http://bna.birds.cornell.edu/bna/species/067.
  • Usai, M. 1999. Bufflehead: Diving duck winters in New York. New York State Conservationist, 53/4: 10-12.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

occurs (regularly, as a native taxon) in multiple nations

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

National Distribution

Canada

Origin: Native

Regularity: Regularly occurring

Currently: Present

Confidence: Confident

Type of Residency: Year-round

United States

Origin: Native

Regularity: Regularly occurring

Currently: Present

Confidence: Confident

Type of Residency: Year-round

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Global Range: (>2,500,000 square km (greater than 1,000,000 square miles)) BREEDING: central Alaska, Mackenzie Delta, northern Prairie Provinces, northern Ontario, south to northern Washington, northern Montana; locally south to the mountains of Oregon, northern California, and northern Colorado (Andrews and Righter 1992). NON-BREEDING: Aleutians, Alaska Peninsula, Great Lakes, New Brunswick and Newfoundland, south to Baja California, mainland Mexico, Gulf Coast, Florida; occasionally in Hawaii. The most abundant wintering populations include those around Vancouver Island, along the Atlantic coast from the Bay of Fundy to Chesapeake Bay, and in northern California-southern Oregon, Mississippi, eastern New Mexico (Root 1988).

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Geographic Range

The Bufflehead ranges predominantly through boreal forests and aspen parklands of Canada and Alaska, with the highest density in British Columbia and Alberta. Their nonbreeding range extends through the contential United States into Northern Mexico.

Biogeographic Regions: nearctic (Native )

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: BioKIDS Critter Catalog

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Range

Breeds n North America; winters to Mexico and Greater Antilles.
  • Clements, J. F., T. S. Schulenberg, M. J. Iliff, D. Roberson, T. A. Fredericks, B. L. Sullivan, and C. L. Wood. 2014. The eBird/Clements checklist of birds of the world: Version 6.9. Downloaded from http://www.birds.cornell.edu/clementschecklist/download/

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Physical Description

Morphology

Buffleheads are small diving ducks that exhibit strong sexual dimorphism. Males with breeding plumage are predominately black and white, with a black head and back that appears iridescent green and purple. They have a white underbelly and a distinguishing large white patch extending from the nape of the neck to the crown of the head. Males have blue-gray bills and pink webbed feet. Females are similar in plumage to male yearlings. They are grey on the bottom and brown on top with a white patch on the sides of the head. Both male yearlings and adult females have bills that are dark gray to black and legs and toes that are dark pink while webbed feet are brown. The ear patch of female buffleheads is more defined than the that of yearling males. The downy coats of hatchlings are black to dark grey with a white patched cheeks, throats, lower breasts, and bellies.

Buffleheads weigh 270 to 513 grams and are 32 to 40 cm long. Their wingspan is 16.9 to 17.5 cm long. Sexual dimorphism is exhibited in their size as well. Adult males weigh 450 grams on average and are 35 to 40 cm long, while females weigh 325 grams on average and are 32 to 35 cm long. Their folded wings are 18 cm or less in adults and their tails are less than 8 cm long.

Adult males are sometimes mistaken for common goldeneyes (Bucephala clangula), Barrow’s goldeneyes (<< Bucephala islandica>>) and hooded mergansers (Lophodytes cucullatus). Unlike buffleheads, goldeneyes have a white patch that starts below the eye and extends towards the beak and they both have golden eyes. Hooded mergansers are larger and have a fan-shaped white patch on their heads. Unlike bufflehead males, their chests and wings haave white stripes and a brownish or golden brown underside.

Range mass: 270 to 513 g.

Range length: 32 to 40 cm.

Range wingspan: 16.9 to 17.5 cm.

Sexual Dimorphism: male larger; sexes colored or patterned differently; male more colorful

Other Physical Features: endothermic ; bilateral symmetry

  • Dugger, B., K. Dugger, L. Fredrickson. 2009. "The Birds of North America Online" (On-line). Accessed April 08, 2012 at http://bna.birds.cornell.edu/bna/species/098.
  • Eadie, J., M. Mallory, H. Lumsden. 1995. "The Birds of North America Online" (On-line). Accessed April 08, 2012 at http://bna.birds.cornell.edu/bna/species/170.
  • McKinney, R., S. McWilliams. 2005. A new model to estimate daily energy expenditure for wintering waterfowl. The Wilson Bulletin, 117/1: 44-55.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Physical Description

The Bufflehead is a small diving duck, with males at the upper end of the weight range and females at the lower end. Buffleheads are compact, with a short neck and a short narrow grey bill. The sexes are strongly dimorphic. Breeding males have a black head marked with purple and green, along with a black back and wings. They are white underneath, as well as having a white patch over their head from their eyes covering their ear region. Females are dark brown with pale grey underneath and a less distinct white head patch.

Range mass: 297 to 551 g.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: BioKIDS Critter Catalog

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Size

Length: 34 cm

Weight: 473 grams

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Ecology

Habitat

Habitat and Ecology

Systems
  • Terrestrial
  • Freshwater
  • Marine
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Depth range based on 62174 specimens in 1 taxon.
Water temperature and chemistry ranges based on 1 sample.

Environmental ranges
  Depth range (m): 0 - 0
  Temperature range (°C): 16.537 - 16.537
  Nitrate (umol/L): 0.165 - 0.165
  Salinity (PPS): 33.352 - 33.352
  Oxygen (ml/l): 5.634 - 5.634
  Phosphate (umol/l): 0.362 - 0.362
  Silicate (umol/l): 2.470 - 2.470
 
Note: this information has not been validated. Check this *note*. Your feedback is most welcome.
All rights reserved

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Buffleheads live in boreal forests and aspen parklands as well as seasonally-flooded wetlands and estuaries. They can be found along ecotones, and in marshes, farmlands, grasslands, and open waters. They prefer ponds and small lakes with no drainage while breeding. During migration, they use rivers and available water bodies as temporary habitat. Their winter habitat includes salty bodies of water like marshes, coastlines, and estuaries with shelter. They are not found at high mountain elevations.

Habitat Regions: temperate ; terrestrial ; saltwater or marine ; freshwater

Terrestrial Biomes: taiga ; savanna or grassland ; forest ; scrub forest

Aquatic Biomes: lakes and ponds; rivers and streams; temporary pools; coastal ; brackish water

Wetlands: marsh ; swamp ; bog

Other Habitat Features: suburban ; agricultural ; riparian ; estuarine

  • Gammonley, J., M. Heitmeyer. 1990. Behavior body condition, and foods of buffleheads and lesser scaups during spring migration through the Klamath Basin, California. Wilson Bulletin, 102/4: 672-683.
  • Knutsen, G., J. King. 2004. Bufflehead breeding activity in south-central North Dakota. The Prairie Naturalist, 36/3: 187-190.
  • McKinney, R. 2004. Habitat relationships of waterfowl wintering in Narrgansett Bay. Rhode Island Naturalist, 11/2: 3-6.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Comments: BREEDING: Lakes, ponds, rivers and seacoasts (AOU 1983). Breeds in tree cavities in mixed coniferous-deciduous woodland near lakes and ponds (AOU 1983). Usually nests in natural tree cavities, or abandoned flicker holes. Females often nest in same site in successive years. NON-BREEDING: wintering on sheltered bays and estuaries as well as open freshwater situations (AOU 1983).

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Buffleheads seek out either small lakes or permanent freshwater ponds with no outlet. Perhaps because they seem to depend on the nesting cavities of the Northern Flicker, their habitat is coincident with its habitat. It includes poplar or aspen stands or coniferous forests mixed with poplars or aspens. Bufflehead will nest in prairie habitats only when stands of trees and water are present close by.

Terrestrial Biomes: savanna or grassland ; forest

Aquatic Biomes: lakes and ponds

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: BioKIDS Critter Catalog

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Depth range based on 62174 specimens in 1 taxon.
Water temperature and chemistry ranges based on 1 sample.

Environmental ranges
  Depth range (m): 0 - 0
  Temperature range (°C): 16.537 - 16.537
  Nitrate (umol/L): 0.165 - 0.165
  Salinity (PPS): 33.352 - 33.352
  Oxygen (ml/l): 5.634 - 5.634
  Phosphate (umol/l): 0.362 - 0.362
  Silicate (umol/l): 2.470 - 2.470
 
Note: this information has not been validated. Check this *note*. Your feedback is most welcome.

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Migration

Non-Migrant: No. All populations of this species make significant seasonal migrations.

Locally Migrant: No. No populations of this species make local extended movements (generally less than 200 km) at particular times of the year (e.g., to breeding or wintering grounds, to hibernation sites).

Locally Migrant: Yes. At least some populations of this species make annual migrations of over 200 km.

Migrates northward February-April. Begins moving southward from October into November.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Trophic Strategy

Buffleheads primarily eat aquatic invertebrates and some seeds. Their freshwater diet consists of mostly insects like damselfly larvae, dragonfly larvae, midge larvae, water boatmen, mayfly larvae, caddisfly larvae and other insects. In saltwater habitats, a variety of arthropods and molluscs make up their diet. Buffleheads on the Pacific coast have been recorded consuming herring eggs in multi-species flocks and they occasionally eat fish like sculpins and ratfish. Prey is swallowed while submerged under the water. Buffleheads prefer to feed in water less than 3 meters deep. All of their food is acquired by diving except for downy young, who will dabble when first taking to the water.

Buffleheads' diet varies seasonally and by habitat. In the fall, pondweed seeds, sedges, bulrushes, and mare’s tail become important to the bufflehead diet. The literature reports that avian egg shells and bones have also been found in their stomachs. Female buffleheads that consumed mostly gastropods during egg-laying were found to have higher egg production. Eggs were also found to be larger with stronger shells. Gastropod consumption peaks during incubation.

Animal Foods: amphibians; fish; insects; mollusks; aquatic crustaceans; other marine invertebrates

Plant Foods: roots and tubers; wood, bark, or stems; seeds, grains, and nuts

Primary Diet: carnivore (Insectivore , Eats non-insect arthropods, Molluscivore )

  • Thompson, J., C. Ankney. 2002. Role of food in territoriality and egg production of buffleheads (Bucephala albeola) and Barrow’s goldeneyes (Bucephala islandica). The Auk, 119/4: 1075-1090.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Comments: In fresh water feeds on aquatic insects, snails, amphipods, small fishes, and some aquatic plants. In salt water eats crustaceans, molluscs, fishes, and some aquatic plants. Often feeds in small groups, diving or watching for danger.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Food Habits

Buffleheads feed in open, shallow water. They dive for their food, which they swallow while still underwater. This includes both freshwater and saltwater aquatic invertebrates (insects, crustaceans, and molluscs). They also eat some seeds, chiefly seeds of pondweeds and bulrushes.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: BioKIDS Critter Catalog

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Associations

Buffleheads disperse seeds in their environment. They compete for nests with Barrow’s goldeneyes (Bucephala islandica), common goldeneyes (Bucephala clangula), squirrels (Sciuridae), European starlings (Sturnus vulgaris) and northern flickers (Colaptes auratus).

Like many ducks, buffleheads are prone to infection by a variety of parasites. When comparing buffleheads to other ducks, however, the abundance of parasitic species is modest. By examining the gizzards and intestines of adult buffleheads several species of roundworms, flukes, tapeworms, and thorny-headed worms were found. The roundworm species found were: Amidostomum acutum, Capillaria anatis, Capillaria contorta, Echinuria parva, Ecinuria uncinata, NematodaSchistorophus, Streptocara crassicauda, Streptocara formosensis, Tetrameres crami, Tetrameres fissipina, and Tetrameres spinosa. The flukes found were: Apatemon canadensis, Apatemon gracilis, Cotylurus strigeoides, Dendritobilharzia pulverulenta, Echinoparypthium recurvatum, Echinostoma trivolvis, Gyrosoma marilae, Maritrema obstipum, Notochotylus attenuatus, Odhneria odhneri, Philophthalmus gralli, Plagiorchis elegans, Prosthogonimus cuneatus, Pseudosplotrema, Psilochasmus oxyurus, Strigea, and Zygocotyle lunata. The tapeworms found were: Abortilepis, Aploparaksis, Cloacotaenia, Cloacotaenia megalops, Dicranotaenia multisticta, Diorchis bulbodes, Diploposthe laevis, Fimbriaria, Gastrotaenia cygni, Hymenolepis, Lateriporus skrjabini, Microsomacanthus collaris, Microsomacanthus melanittae, Microsomacanthus parvula, Platyscolex ciliata, Retinometra albeola, and Shistocephalus. Finally, the following thorny-headed worms found were: Corynosoma constrictum, Polymorphus acutis, Polymorphus marilis, and Polymorphus obtusus.

Of particular interest is that buffleheads appear to be the only duck with the tapeworm Retinometra albeolae. Leeches (Theromyzon rude, Theromyzon tesulatum, and Theromyzon bifarium) may infest their upper respiratory tract as well as their eyes. Bufflehead ducklings are more prone to leeches. A trematode in the family Schistosomatidae has been observed in the arteries. Renal coccidia also have been observed. Additionally, avian cholera (Pasteurella multocida), avian malaria (Plasmodium relictum), and avian influenza all have been identified in buffleheads. The literature states that little is known about the impacts of parasites and disease on buffleheads.

Ecosystem Impact: disperses seeds

Commensal/Parasitic Species:

  • roundworms Amidostomum acutum
  • roundworms Capillaria anatis
  • roundworms Capillaria contorta
  • roundworms Ecinuria parva
  • roundworms Echinuria uncinata
  • roundworms Schistorophus
  • roundworms Streptocara crassicauda
  • roundworms Streptocara formosensis
  • roundworms Tetrameres crami
  • roundworms Tetrameres fissipina
  • roundworms Tetrameres spinosa
  • flukes Apatemon canadensis
  • flukes Apatemon gracillis
  • flukes Cotylurus strigeoides
  • flukes Dendritobilharzia pulverulenta
  • flukes Echinoparypthium recurvatum
  • flukes Echinostoma trivolvis
  • flukes Gyrosoma marilae
  • flukes Maritrema obstipum
  • flukes Notochotylus attenuatus
  • flukes Odhneria odhneri
  • flukes Philophthalmus gralli
  • flukes Plagiorchis elegans
  • flukes Prosthogonimus cuneatus
  • flukes Pseudosplotrema
  • flukes Psilochasmus oxyurus
  • flukes Strigea
  • flukes Zygocotyle lunata
  • tapeworms Abortilepis
  • tapeworms Aploparaksis
  • tapeworms Cloacotaenia
  • tapeworms Cloacotaenia megalops
  • tapeworms Dicranotaenia multisticta
  • tapeworms Diorchis bulbodes
  • tapeworms Diploposthe laevis
  • tapeworms Fimbriaria
  • tapeworms Gastrotaenia cygni
  • tapeworms Hymenolepis
  • tapeworms Lateriporus skrjabini
  • tapeworms Microsomacanthus collaris
  • tapeworms Microsomacanthus melanittae
  • tapeworms Microsomacanthus parvula
  • tapeworms Platyscolex ciliata
  • tapeworms Retinometra albeola
  • tapeworms Shistocephalus
  • thorny-headed worms Corynosoma constrictum
  • thorny-headed worms Polymorphus acutis
  • thorny-headed worms Polymorphus marilis
  • thorny-headed worms Polymorphus obtusus

  • Ewart, M., J. McLaughlin. 1990. Helminths from spring and fall migrant bufflehead ducks (Bucephala albeola) at Delta, Manitoba, Canada. Canadian Journal of Zoology, 68/10: 2230-2233.
  • Gladden, B., A. Canaris. 2009. Helminth parasites of the bufflehead duck, Bucephala albeola, wintering in the Chihuahua Desert with a checklist of helminth parasites reported From this host. Journal of Parasitology, 95/1: 129-136.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Buffleheads are vulnerable to an assortment of predators that include birds of prey and mammals. Included in this list are peregrine falcons (Falco peregrinus), snowy owls (Nyctea scandiaca), and bald eagles (Haliaeetus leucocephalus), and possibly great horned owls (Bubo virginianus) and Cooper’s hawks (Accipiter cooperii). Weasels (Mustela) including mink (Neovison vison) and also squirrels (Sciuridae) and black bears (Ursus americanus) have been reported to feed on eggs in nest boxes. Female buffleheads are particularly vulnerable when perched on the nest, and eggs are vulnerable while females forage.

Known Predators:

  • peregrine falcons (Falco peregrinus)
  • snowy owls (Nyctea scandiaca)
  • bald eagles (Haliaeetus leucocephalus)
  • great horned owls (Bubo virginianus)
  • Cooper’s hawks (Accipiter cooperii)
  • weasels (Mustela)
  • American mink (Neovison vison)
  • black bears (Ursus americanus)

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Population Biology

Global Abundance

>1,000,000 individuals

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

General Ecology

Usually seen in small groups of twos or threes. Female strongly defends brood territory. In British Columbia, breeding density not limited by nest sites but rather by territorial behavior (Gauthier and Smith 1987); also, may be excluded from some ponds at high Barrow's goldeneye densities (Savard et al. 1991).

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Life History and Behavior

Behavior

Buffleheads find prey underwater by sight, and they communicate through vocalizations and displays. Courting bufflehead males bob their heads and produce a loud raspy noise. In late winter and spring, they emit a low snarling grunts. Females make a loud deep throated vocalization while following males during leading displays. Females use a distinct low note to call their young which speeds up and increases in volume if she becomes distressed. Buffleheads display a head-forward posture and raised wing feathers when they are threatened or when protecting their territory or brood. Males protect their territory by posturing next to other male buffleheads. This includes a head-forward posture, flapping wings, and a raised tail. Once this display ends, they part ways. Wing beating following the toe to toe display is thought to be a sign of concession by the loser.

Communication Channels: visual ; acoustic

Other Communication Modes: duets

Perception Channels: visual ; tactile ; acoustic ; chemical

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Cyclicity

Comments: Usually migrates at night.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Life Expectancy

Buffleheads live an estimated 2.5 years for males and 2.3 years for females. In rare cases, adults live very long and the record for the oldest adult is 18.7 years old. However, information on survivorship is limited. The most recent survivorship data available (1969 to 1973) was generated in New York State and was obtained by banding and recovering birds. From these data it was estimated that annual survivorship of females is between 61 to 73%, and 58 to 70% for males. Because the sample size was particularly small, (56 to 159 birds of each sex) the accuracy of these estimates is not known.

Range lifespan

Status: wild:
18.7 (high) years.

Average lifespan

Status: wild:
2.5 years.

Average lifespan

Status: wild:
2.5 years.

Average lifespan

Status: wild:
224 months.

  • de Magalhaes, J., J. Costa. 2009. A database of vertebrate longevity records and their relation to other life-history traits. Journal of Evolutionary Biology, 22/8: 1770-1774.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Lifespan/Longevity

Average lifespan

Status: wild:
224 months.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: BioKIDS Critter Catalog

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Lifespan, longevity, and ageing

Maximum longevity: 18.7 years (wild)
Creative Commons Attribution 3.0 (CC BY 3.0)

© Joao Pedro de Magalhaes

Source: AnAge

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Reproduction

Buffleheads generally form a mating pair that stays together during the season and in subsequent seasons. Less frequently, males pair with a second female after the first has finished laying her eggs. Courtship behavior occurs throughout the year and facilitates seasonal pairing of couples. Buffleheads use an array of physical displays and vocalizations during courtship. Males bob their heads and fly low over females to display their black and white underside and their pink legs, and then land with their feet straight as if water skiing. Paired birds display a “following” behavior where the female swims behind the male. The male stretches his neck upward and the female extends her neck back while she follows behind him. Buffleheads use displays both before and after copulation. Males also perform displays after threat or aggression from other males.

Mating System: monogamous

Buffleheads breed once per year from late winter to early April. Breeding females lay a single clutch between late April and mid-May with an average of 9 eggs per clutch. Female buffleheads typically lay their eggs close to the same date each year, but second and third-year breeding females lay 4 to 9 days earlier than first year breeders. Their eggs are olive-buff colored. On average, they measure 50 by 36 mm and weigh 36.68 g. Females incubate the eggs for 30 days while males leave to molt. When leaving the nest to feed during the incubation period, females cover their eggs with feathers.

Buffleheads use nests constructed by other species. Their nests are hollowed out cavities in trees usually within 15 m of a body of water and above flood plain level. Nests are often found in poplars and aspen, although pine trees are a favorite in the western United States. Nests are bare and buffleheads do not add material to their nests. Female buffleheads scout out their nest location up to a year in advance. If the desired nest is occupied when she returns, she searches for a new site with the male. Females only 1 year old have been observed searching for potential nest sites although they do not begin breeding until age 2. Two females have been documented sharing a same nest; however, one may evict the other that leaves the nest to feed. The average nest entrance is approximately 7 cm in diameter and the cavity diameter is 11.5 to 21 cm with a depth around 33.8 cm. Larger cavities are normally avoided because they are favored by goldeneyes (Bucephala islandica and Bucephala clangula). Goldeneyes can kill buffleheads in larger nests, but cannot enter the smaller entrances where buffleheads nest.

Bufflehead chicks hatch after 28 to 35 days. They typically hatch within a span of 12 hours, but may take up to 36 hours from first to last. It is thought that late hatching eggs are laid during incubation. Precocial chicks are born with their eyes open and fully covered in down, with a mass around 23.8 g. Buffleheads are able walk as soon as their plumage dries out. Young buffleheads are nurtured intently during and after hatching. Newly hatched chicks live in the nest for 1 to 2 days and are then encouraged to jump from the nest hole. New mother buffleheads protect their brood for 3 to 6 weeks, at which point the young buffleheads are considered independent.

Young ducklings are good swimmers, feeding on insects (92-100% of the time) on the water and dabbling for vegetation. Their diving abilities develop in the first few days and become the predominant mode of feeding. In fact, downy young spend 24% of their time diving. Growth rates vary among individuals which is typical of precocial birds. By day 20, the juvenile contour feathers begin to emerge with wing feathers appearing at day 23. Their belly feathers appear next and the head, back and neck feathers appear last. By day 40, males are apparently larger than their sisters. Plumage is complete after day 50 and the chicks fledge in 45 to 55 days. They reach reproductive maturity at 2 years.

Breeding interval: Buffleheads breed once per year from late winter to early April.

Breeding season: Late winter to early April

Range eggs per season: 6 to 11.

Range time to hatching: 28 to 33 days.

Range fledging age: 45 to 55 days.

Range time to independence: 3 to 6 weeks.

Average age at sexual or reproductive maturity (female): 2 years.

Average age at sexual or reproductive maturity (male): 2 years.

Key Reproductive Features: iteroparous ; seasonal breeding ; gonochoric/gonochoristic/dioecious (sexes separate); sexual ; oviparous

Average eggs per season: 8.

Male buffleheads stay with their mates during egg laying and for part of the incubation period. Females alone attend to the brood and defend their territory. They nurture their young for the first 2 to 3 weeks after hatching. The young huddle tightly together on both sides of the female on the shore or a floating log. Young buffleheads gather tightly and close behind their mother if she gives an alarm call. In British Columbia, 34% of broods had at least one exchange of young buffleheads between mothers, usually during a fight between them. Occasionally an entire brood is acquired by a female bufflehead that won a territorial fight. Bufflehead mothers protect their brood for up to 6 weeks, when the chicks are independent.

Parental Investment: precocial ; female parental care ; pre-fertilization (Protecting: Male); pre-hatching/birth (Protecting: Male, Female); pre-weaning/fledging (Provisioning: Female, Protecting: Female); pre-independence (Provisioning: Female, Protecting: Female)

  • Ahlund, M. 2005. Behavioural tactics at nest visits differ between parasites and hosts in brood-parasitic duck. Animal Behaviour, 70/2: 433-440.
  • Gammonley, J., M. Heitmeyer. 1990. Behavior body condition, and foods of buffleheads and lesser scaups during spring migration through the Klamath Basin, California. Wilson Bulletin, 102/4: 672-683.
  • Gauthier, G. 1993. "The Birds of North America Online" (On-line). Bufflehead (Bucephala albeola). Accessed February 08, 2012 at http://bna.birds.cornell.edu/bna/species/067.
  • Knutsen, G., J. King. 2004. Bufflehead breeding activity in south-central North Dakota. The Prairie Naturalist, 36/3: 187-190.
  • Lavers, J., J. Thompson, C. Paszkowski, C. Ankney. 2006. Variation in size and composition of bufflehead (Bucephala albeola) and Barrow’s goldeneye (Bucephala islandica) eggs. The Wilson Journal of Ornithology, 118/2: 173-177.
  • Usai, M. 1999. Bufflehead: Diving duck winters in New York. New York State Conservationist, 53/4: 10-12.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Breeding begins mid-May in south to early June in north (Harrison 1978). Clutch size 6-11 (avg. 7-9). Incubation 28-33 days, by female (Terres 1980). In British Columbia, mean hatching date is mid- to late June (Savard et al. 1991). Young tended by female, fly 50-55 days after hatching. First breeds at 2 yr.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Unlike most ducks, Buffleheads form long term monogamous pair bonds. They nest in cavities excavated by Colaptes auratus or in nest boxes. They do not modify nests once they have selected a nesting site. Egg laying occurs in early May, with each female producing 6 to 11 eggs. Females incubate the eggs alone, taking two 80 minute recesses per day. Eggs are incubated for 28 to 33 days. After hatching, the young remain at the nest for about one day, then the female leads them to the nearest water. She cares for the young alone, but never feeds them. Rather, she protects a set territory which provides the ducklings with a safe area to find food. Occasionally territiorial disputes between females arise, sometimes leading to the death of ducklings.

Range eggs per season: 6 to 11.

Range time to hatching: 28 to 33 days.

Key Reproductive Features: seasonal breeding ; gonochoric/gonochoristic/dioecious (sexes separate)

Average eggs per season: 8.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: BioKIDS Critter Catalog

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Barcode data: Bucephala albeola

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There are 8 barcode sequences available from BOLD and GenBank.

Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.

See the BOLD taxonomy browser for more complete information about this specimen and other sequences.

NNCCTGTATCTTATCTTCGGGGCATGAACCGGGATAATTGGTACAGCACTCAGCCTGCTAATCCGCGCAGAACTCGGCCAACCAGGGACCCTCCTGGGCGATGACCAAATTTACAACGTAATCGTCACCGCCCACGCCTTCGTAATAATCTTCTTCATAGAAATGCCCATCATGATTGGAGGGTTCGGCAACTGATTAGTCCCCCTAATGATCGGCGCCCCCGACATAGCATTCCCACGAATAAACAACATAAGCTTCTGACTCCTCCCACCATCATTCCTCCTACTGCTCGCTTCATCTACCGTAGAAGCTGGCGCCGGCACAGGCTGAACCGTATACCCACCCCTAGCAGGGAATCTAGCCCACGCTGGGGCCTCCGTAGACCTGGCCATCTTCTCACTCCATTTGGCCGGTATTTCCTCCATCCTCGGGGCCATTAACTTCATCACCACAGCCATCAACATAAAACCCCCCGCACTCTCACAATACCAAACCCCACTCTTCGTCTGATCCGTCTTAATCACCGCCATCCTGCTCCTCCTGTCACTCCCTGTACTCGCTGCTGGTATCACAATACTACTAACTGACCGAAACCTAAACACCACATTCTTCGACCCCGCCGGAGGAGGAGACCCGATCTTATACCAACACCTATTCTGATTCTTCGGCCACCCAGAAGTCTACATCTTAATCCTC
-- end --

Download FASTA File

Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Statistics of barcoding coverage: Bucephala albeola

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 8
Specimens with Barcodes: 8
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Conservation

Conservation Status

IUCN Red List Assessment


Red List Category
LC
Least Concern

Red List Criteria

Version
3.1

Year Assessed
2012

Assessor/s
BirdLife International

Reviewer/s
Butchart, S. & Symes, A.

Contributor/s

Justification
This species has an extremely large range, and hence does not approach the thresholds for Vulnerable under the range size criterion (Extent of Occurrence <20,000 km2 combined with a declining or fluctuating range size, habitat extent/quality, or population size and a small number of locations or severe fragmentation). The population trend appears to be increasing, and hence the species does not approach the thresholds for Vulnerable under the population trend criterion (>30% decline over ten years or three generations). The population size is extremely large, and hence does not approach the thresholds for Vulnerable under the population size criterion (<10,000 mature individuals with a continuing decline estimated to be >10% in ten years or three generations, or with a specified population structure). For these reasons the species is evaluated as Least Concern.

History
  • Least Concern (LC)
  • Least Concern (LC)
  • Least Concern (LC)
  • Lower Risk/least concern (LR/lc)
  • Lower Risk/least concern (LR/lc)
  • Lower Risk/least concern (LR/lc)
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5