Articles on this page are available in 2 other languages: Chinese (Simplified) (6), Dutch (1) (learn more)

Overview

Brief Summary

As its name says, this duck has a golden eye. Males have a white spot under their eyes, making it look like they are wearing glasses. You can see goldeneyes along the Dutch coast in the winter, where they dive for food on the sea floor. They often make their nests in hollow trees. When the young ducklings hatch, they let themselves fall out of the tree in order to follow their mother to water.
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© Copyright Ecomare

Source: Ecomare

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Bucephala clangula

Although the Common Goldeneye’s bright yellow eyes give this species its name, this field mark is only visible at close range. At a distance, male Common Goldeneyes may be identified by their size (20 inches), green head, white body, patchy black-and-white wings, and, most notably, their white cheek patch. Female Common Goldeneyes have brown heads, grayish-brown bodies, and white necks. Duck hunters often refer to this duck as the “whistler” in reference to the sound its wings make in flight. The Common Goldeneye is found across the Northern Hemisphere. In North America, this species breeds across Canada, Alaska, and extreme northern portions of the lower 48. In winter, Goldeneyes migrate to coastal Canada as well as south into the United States and northern Mexico. In the Old World, this species breeds locally in northern Europe, Scandinavia and Russia, wintering south along the coast to the Mediterranean Sea and coastal China. In summer, the Common Goldeneye breeds in freshwater wetlands near forests with tree cavities in which to nest. During the winter, Common Goldeneyes are found primarily in sheltered saltwater estuaries and bays, with smaller concentrations wintering inland on ice-free lakes and rivers. The Common Goldeneye’s diet consists primarily of insects during the summer, eating mollusks, crustaceans, and fish during the winter. One of several species of “diving ducks” in North America, Common Goldeneyes may be observed submerging themselves to feed in the water or on the bottom. In winter, they may also be observed in small flocks on large, slow-moving bodies of water. This species is primarily active during the day.

Threat Status: Least concern

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Unknown

Supplier: DC Birds

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Biology

Goldeneyes feed during the day on a wide range of invertebrates such as small bivalve molluscs and crabs (5). They are able to dive to depths of 4 meters and can stay submerged for over 30 seconds (6). At the start of the breeding season in late winter and early spring, males can be seen displaying. They throw their heads back over their body whilst producing a growling noise. Several males gather to perform in this way and one or more females will watch. The nest is typically built 10-15 m off the ground in a tree hole or in a specially built nesting box (6). The female lays between 8 and 11 eggs, which are incubated for up to 30 days. The young will have fledged after a further 57 to 66 days (3).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Description

The goldeneye is a well-known attractive diving duck (5). It has a compact shape, with a large rounded head. The upper part of the forewing is white and the undersides of the wings are dark (2). In breeding plumage, the adult male (drake) has a glossy green sheen to the black head, obvious yellow eyes, a white patch in front of the eye and white sides and breast (3). Females have a brown head, a white collar, pale yellow eyes, and the breast and sides are greyish in colour (2). Juveniles are similar in appearance to females but the head is a more greyish brown (2). The goldeneye is not a very vocal duck; a quiet 'krrr' is occasionally produced (7) and when displaying, males emit a loud 'zee-zee' call (3). In flight the wings produce a whistling or rattling sound (7).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Distribution

Gulf of Maine, Gulf of Mexico, North West Atlantic, Polish Exclusive Economic Zone, Portuguese Exclusive Economic Zone, Spanish Exclusive Economic Zone, Swedish Exclusive Economic Zone, United Kingdom Exclusive Economic Zone, Wimereux
Creative Commons Attribution 3.0 (CC BY 3.0)

© WoRMS for SMEBD

Source: World Register of Marine Species

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Geographic Range

Common goldeneyes are found throughout North America and Eurasia. In summer they breed in the northern parts of their range, mainly in Canada, the northern United States, northern Europe, and northern Russia. In winter they are found mainly in large, inland lakes and along the coasts of North America from Alaska to Baja California, Newfoundland to Florida, and the northern Gulf of Mexico. In Eurasia they are found in all coastal waters from Scandinavia to the Mediterranean, Black, and Caspian Seas and from Kamchatka to Japan. They are also found in inland lakes that remain ice-free.

Biogeographic Regions: nearctic (Native ); palearctic (Native )

Other Geographic Terms: holarctic

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

North America; Oceania; Labrador to Virginia; also, in the Gulf of Mexico
Creative Commons Attribution 3.0 (CC BY 3.0)

© WoRMS for SMEBD

Source: World Register of Marine Species

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Range Description

The Common Goldeneye ranges across the boreal forests of Scandinavia, eastern Europe, Russia, Mongolia, northern China, Canada, Alaska and northern USA. Its wintering range is equally broad, encompassing the coast of northern Europe including inland United Kingdom, scattered coastal and inland water bodies in south-eastern Europe (e.g. Turkey) and central Asia, the coasts of eastern China, Korea, Japan and the Kamchatkha Peninsula (Russia), the Pacific coast of Canada and the Alaskan coast and inland USA1.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Geographic Range

Common goldeneyes are found throughout North America and Eurasia. They breed in higher latitudes, from Scotland, northern Europe, and Scandinavia across northern Eurasia to the Kamchatka Peninsula and throughout much of Canada from interior British Columbia to Newfoundland. They breed also in northernmost Michigan, northeastern Minnesota, northern Montana, and portions of northern New York, Vermont, and Maine. Winter ranges include coastal North America from Alaska to Baja California, Newfoundland to Florida, and the northern Gulf of Mexico, throughout inland United States except for portions of Texas, the southeast, and Arizona, and into the Sierra Madre range of Mexico and northernmost coastal Mexico. In Eurasia they are found in coastal waters from Scandinavia to the Mediterranean, Black, and Caspian Seas and from Kamchatka to Japan. They are also found in inland lakes that remain ice-free.

Biogeographic Regions: nearctic (Native ); palearctic (Native )

Other Geographic Terms: holarctic

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

occurs (regularly, as a native taxon) in multiple nations

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

National Distribution

Canada

Origin: Native

Regularity: Regularly occurring

Currently: Present

Confidence: Confident

Type of Residency: Year-round

United States

Origin: Native

Regularity: Regularly occurring

Currently: Present

Confidence: Confident

Type of Residency: Year-round

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Global Range: (>2,500,000 square km (greater than 1,000,000 square miles)) BREEDS: Eurasia; North America, western and central Alaska, Mackenzie Delta, east to southern Hudson Bay and Newfoundland, south to northern Washington, central Montana, northern North Dakota, northern Minnesota, northern Wisconsin, northern Michigan, northern New York, northern Vermont, Maine. WINTERS: Eurasia, to Mediterranean, southern China; in North America, Aleutians and southeastern Alaska to southern California, Great Lakes through the Ohio and Mississippi valleys to the Gulf Coast, St. Lawrence River and Nova Scotia to Florida, and inland national wildlife refuges (e.g., Browns Park in Colorado and Mundt in South Dakota) (Root 1988).

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Range

In Britain, this duck breeds in the Highlands of Scotland in relatively small numbers. Birds from Scandinavia and western Russia overwinter throughout much of Britain (5), arriving from August and departing in February and March (3). There are two subspecies; the form that occurs in Eurasia (Bucephala clangula clangula) and a North American subspecies (Bucephala clangula americana). The Eurasian subspecies has a wide breeding distribution extending through northern Eurasia (4).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Physical Description

Morphology

Physical Description

Common goldeneyes are medium-sized diving ducks. Males are slightly larger than females, from 45 to 51 cm in length (40 to 50 cm in females) and about 1000 grams (800 grams in females) weight. Males also have more brightly colored plumage for most of the year. Breeding males have a brilliant, greenish-black head with an oval, white patch at the base of the bill. Their sides, breast, belly, and secondary feathers are bright white and their back, wings, and tail are black. Female feathers are more muted, with rich brown heads, greyish backs, wings, and tails, and white sides, breasts, and bellies. Mature adults of both sexes have bright, deep, yellow irises, giving them the common name "goldeneye." Immature individuals have brownish irises. In flight their wings produce a whistling sound.

Average mass: 800-1000 g.

Range length: 40 to 51 cm.

Other Physical Features: endothermic ; homoiothermic; bilateral symmetry

Sexual Dimorphism: male larger; sexes colored or patterned differently; male more colorful

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Physical Description

Common goldeneyes are medium-sized diving ducks. Males are slightly larger than females, from 45 to 51 cm in length (40 to 50 cm in females) and about 1000 grams (800 grams in females) weight. Males also have more brightly colored plumage for most of the year. Breeding males have a brilliant, greenish-black head marked with an oval, white patch at the base of the bill. Their sides, breast, belly, and secondary feathers are bright white and their back, wings, and tail are black. Female plumage is more muted, with rich brown heads, greyish backs, wings, and tails, and white sides, breasts, and bellies. Immature or eclipse males resemble females. Mature adults of both sexes have bright, deep, yellow irises, giving them the common name "goldeneye." Immature individuals have brownish irises. In flight their wings produce a whistling sound, which is characteristic.

The North American subspecies of common goldeneyes (B. c. americana) is larger overall and has a thicker bill than the Eurasian subspecies (B. c. clangula). Common goldeneyes can be confused with Barrow's goldeneyes (Bucephala islandica). However, adult male common goldeneyes have an oval white patch on the head (crescent shaped in Barrow's goldeneyes) and more white on the secondary feathers. Females are more easily confused, but female common goldeneyes have longer, sloping heads and bills and more white on the secondary feathers than female Barrow's goldeneyes. In western North America, female Barrow's goldeneyes have all yellow bills, common goldeneyes do not. This character does not work in other regions. Hatchlings of both species are also similar in appearance.

Average mass: 800-1000 g.

Range length: 40 to 51 cm.

Other Physical Features: endothermic ; homoiothermic; bilateral symmetry

Sexual Dimorphism: male larger; sexes colored or patterned differently; male more colorful

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Size

Length: 47 cm

Weight: 1000 grams

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Diagnostic Description

See Tobish (1987) for details on identification of Barrow's and common goldeneyes in all plumages.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Ecology

Habitat

During the summer, common goldeneyes are found on northern lakes and rivers that are surrounded by mature forests where tree cavities can be found for nesting. They prefer lakes with clear water, little vegetation, and plenty of invertebrate prey.

During the winter, non-breeding season, common goldeneyes are found mainly in coastal waters and large, interior lakes and rivers. They prefer areas with shallow water and sandy, gravel, or rocky substrates. They seem to prefer slow-flowing water.

Habitat Regions: temperate ; freshwater

Aquatic Biomes: lakes and ponds; rivers and streams; coastal ; brackish water

Other Habitat Features: estuarine

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Habitat and Ecology

Habitat and Ecology
Behaviour Most of this species is fully migratory although it may only travel short distances2, and certain populations in the north-west of Europe may also be sedentary1. The species breeds from April in solitary pairs1, after which it undertakes short northerly moult migrations to coastal areas, large lakes and rivers2 to undergo a period of flightless moult lasting 3-4 weeks (males leave for this moult migration first while females are still incubating)5. Large moult gatherings are common during this period, males arriving at such gatherings in early-June and numbers peaking in late-August when adult females arrive5. The southward autumn migration begins in late-August with most arriving in the winter quarters by early-December5. Females tend to migrate further than males3, 5 and juveniles migrate further than adults5. The return migration to the breeding areas occurs as early as mid-February5, the species timing its arrival to coincide with the thawing and appearance of open water2. Non-breeders may also oversummer on wintering grounds3. The species is gregarious outside of the breeding season2, 6 usually being observed in small scattered groups5 or in small flocks on migration2. Several hundred individuals may roost together6 and large flocks often gather to feed at sewage outfalls1 during the winter, although the species rarely occurs in very large flocks5. Habitat The species is restricted to water close to the shore and less than 10 m deep5 (showing a preference for waters 4 m deep)6. Breeding When breeding the species shows a preference for oligotrophic lakes devoid of fish2 but with abundant invertebrate life4, and requires tree-holes (or artificial nestboxes) for nesting1. Suitable habitats include freshwater lakes, pools, rivers1 and deep marshes4 surrounded by coniferous forest1. Non-breeding The species winters mainly at sea5 on inshore waters1, shallow bays2, estuaries1 and coastal lagoons1, 5, especially in the vicinity of sewage outfalls1. Further to the south and on migration the species may also frequent large rivers, lakes2, 5 and reservoirs5. Diet The diet of the species consists predominantly of aquatic invertebrates such as molluscs, worms, crustaceans, aquatic insects and insect larvae1 (e.g. dragonflies, damsel flies and may flies)4, as well as amphibians, small fish1 and some plant material (mainly in the autumn) such as seeds, roots and the vegetative parts of aquatic plants1. Breeding site The species nests in hollows of mature trees1 (e.g. aspen, spruce or oak)7 formed by woodpeckers or by bacterial or fungal heart-rot invasions2 that have internal cavity diameters of c.20 cm (although the height of the hollow does not seem to be important)4. The species will preferentially nest in trees in open stands near water3, 4 or solitary trees on the edges of marshes4, rather than in trees in dense stands (to increase the ease of entry by flying)4. The species will also nest in artificial nestboxes1. Management information In Scotland, UK the introduction of a sewage treatment scheme in the Firth of Forth (a large marine bay) resulted in a considerable reduction in the abundance of the species, with feeding flocks only remaining at outfalls where sewage continued to be discharged in large quantities9. It was unclear whether the changes in the species's distribution were due to reductions in the number of food items borne in the sewage or to reductions in aquatic invertebrate abundance as a result of the new treatment system9. In some areas nestbox erection programmes have been shown to cause significant range expansions and population increases1, 11, although an experiment in southern Finland found that even though nestbox provision increased breeding numbers of the species there was a negative density-dependent effect on reproductive output (i.e. the number of fledged young did not increase despite an increase in breeding pairs)10. Nesting habitats in general may also benefit from a more extended rotation of timber harvesting2.

Systems
  • Terrestrial
  • Freshwater
  • Marine
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

During the breeding season, common goldeneyes are found on northern lakes and rivers that are surrounded by mature forests where tree cavities can be found for nesting. They prefer lakes with clear water and little emergent vegetation, although areas adjacent to bulrushes (Scirpus) are sometimes used for foraging. Preferred lakes are those with abundant invertebrate prey. Lakes that lack predatory fish, such as yellow perch (Perca flavescens), typically have the highest abundance of invertebrate prey.

During the winter, non-breeding season, common goldeneyes are found mainly in coastal marine and estuarine habitats and large, interior lakes and rivers. They prefer areas with shallow water and sandy, gravel, or rocky substrates. They are strong swimmers and can forage well in areas with strong current, but seem to prefer slow-flowing water. Common goldeneyes stop to refuel at large, interior lakes and rivers during migration towards coastal areas.

Habitat Regions: temperate ; freshwater

Aquatic Biomes: lakes and ponds; rivers and streams; coastal ; brackish water

Other Habitat Features: estuarine

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Depth range based on 10080 specimens in 1 taxon.
Water temperature and chemistry ranges based on 4 samples.

Environmental ranges
  Depth range (m): 0 - 0
  Temperature range (°C): 8.237 - 9.521
  Nitrate (umol/L): 1.335 - 3.961
  Salinity (PPS): 6.428 - 34.972
  Oxygen (ml/l): 6.418 - 8.154
  Phosphate (umol/l): 0.258 - 0.439
  Silicate (umol/l): 2.336 - 10.415

Graphical representation

Temperature range (°C): 8.237 - 9.521

Nitrate (umol/L): 1.335 - 3.961

Salinity (PPS): 6.428 - 34.972

Oxygen (ml/l): 6.418 - 8.154

Phosphate (umol/l): 0.258 - 0.439

Silicate (umol/l): 2.336 - 10.415
 
Note: this information has not been validated. Check this *note*. Your feedback is most welcome.
Public Domain

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Comments: Ponds, lakes, rivers and coastal bays, wintering primarily in bays and estuaries, less commonly on rivers and lakes (AOU 1983). Nests usually near pond, lake, or river, but may nest in woodland up to a mile from water. May nest in natural tree cavity in large hardwood tree, in abandoned woodpecker hole, or nest-box. Often nests in same area in successive years. May "prospect" for future nest sites at end of breeding season.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Breeding takes place near lakes and rivers where there are plenty of old trees that provide nesting holes. Although often thought of as a sea-duck, it is found inland (5). In winter, this duck can be found on lakes, lochs, reservoirs, gravel pits, rivers, estuaries and bays (3) (5).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Migration

Non-Migrant: No. All populations of this species make significant seasonal migrations.

Locally Migrant: No. No populations of this species make local extended movements (generally less than 200 km) at particular times of the year (e.g., to breeding or wintering grounds, to hibernation sites).

Locally Migrant: Yes. At least some populations of this species make annual migrations of over 200 km.

Migrates northward February-March, southward to wintering areas October-November.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Trophic Strategy

Food Habits

Common goldeneyes eat mainly aquatic Insecta during breeding season in northern, boreal lakes. In their winter ranges they rely on Actinopterygii, Crustacea, and Mollusca. They may also take some seeds and tubers. Important insect prey include Trichoptera, Corixidae, Odonata, Ephemeroptera, and Coleoptera. Common goldeneyes usually hunt in open water less than 4 meters deep. They dive to catch prey and dives can be from 10 to 55 seconds long. Downy hatchlings feed at the surface for their first few days but then begin short dives. Prey is eaten underwater.

Animal Foods: fish; eggs; insects; mollusks; aquatic crustaceans

Plant Foods: roots and tubers; seeds, grains, and nuts

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Food Habits

Common goldeneyes eat mainly aquatic insects during breeding season in northern, boreal lakes. In their winter ranges they rely on fish, crustaceans, and mollusks. They may also take some seeds and tubers. A study of 395 common goldeneyes throughout the year suggested that the majority of their diet is made up of crustaceans, insects, and mollusks (70% altogether), with the remainder made up of fish, eggs, and plant material. Diet is likely to vary regionally, but important crustaceans include crabs (Hemigrapsus, Cancer, Pagurus, Cambarus, Astacus), amphipods (Ischyrocerus, Pseudalibrotus, Gammarellus, Hyalella), shrimp, isopods, and barnacles. Important insect prey include caddisfly larvae (Trichoptera), water boatmen (Corixidae), dragonfly and damselfly nymphs (Odonata), mayfly nymphs (Ephemeroptera), and beetles (Coleoptera). Mollusk prey includes Mytilus, Lymnea, Macoma, Littorina, Nucula, Goniobasis, Nassarius, Lacuna, Bittium, and Mitrella. Fish prey may be locally important. For example, in British Columbia salmon and their eggs can make up a large portion of the diet. Other fish taken include sticklebacks (Gasterosteidae), sculpins (Cottidae), minnows (Cyprinidae), topminnows (Poeciliidae), and whitefishes (Coregonus). Plant matter taken includes freshwater pond weeds (Potomogeton, Zostera, Ruppia, Najas, Zanichellia) and spatterdock (Nymphaea).

Common goldeneyes typically hunt for prey in water less than 4 meters deep. They seem to prefer foraging in open water, although they may hunt along the edges of aquatic vegetation. They dive to catch prey and dives can be from 10 to 55 seconds long. Downy hatchlings mainly feed at the surface for their first few days but then begin short dives. Hatchlings forage in the same ways as adults, although they seem to be more selective about prey taken. They take greater proportions of dragonfly and damselfly nymphs (Odonata), caddisfly larvae (Trichoptera), and water boatmen (Corixidae). Foraging flocks often dive synchronously. Prey items are typically consumed underwater.

Animal Foods: fish; eggs; insects; mollusks; aquatic crustaceans

Plant Foods: roots and tubers; seeds, grains, and nuts

Primary Diet: carnivore (Insectivore , Eats non-insect arthropods, Molluscivore )

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Comments: In inland areas during the summer and fall, feeds on aquatic insects, crustaceans and aquatic plants. Along coastal wintering grounds feeds largely on crustaceans, mollusks, small fishes, and some plant material (Bellrose 1976).

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Associations

Ecosystem Roles

Common goldeneyes compete directly with fish for prey and tend to be found on fish-free lakes more often than on lakes with fish.

Like many other species of Anseriformes, common goldeneyes practice nest parasitism towards other common goldeneyes. Females lay eggs in the nests of other females. Clutches with introduced eggs can be as large as 24.

Common goldeneyes are susceptible to botulism (Clostridium_botulinum), avian cholera (Pasteurella_multocida), and duck viral enteritis. Parasites include several species of protozoans, flukes, and nematodes.

Mutualist Species:

  • river perch (Perca_fluviatilis)
  • roach (Rutilus_rutilus)

Commensal/Parasitic Species:

  • flukes (Trematoda)
  • nematodes (Nematoda)
  • protozoans (Protozoa)

  • Eriksson, M. 1979. Competition Between Freshwater Fish and Goldeneyes Bucephala clangula for Common Prey. Oecologia, 41: 99-107.
  • Andersson, M., M. Eri. 1982. Nest Parasitism in Goldeneyes Bucephala clangula: Some Evolutionary Aspects. The American Naturalist, 120: 1-16.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Predation

Most predators take females and young in nests. North American predators include Ursus americanus, Martes americanus, Neovison vison, Procyon lotor, Accipitridae, Strigiformes, Haliaeetus leucocephalus, and Aquila chrysaetos. Hatchlings are also taken by northern Colaptes auratus, Tamiasciurus hudsonicus, and Esox lucius. Females distract predators with broken-wing displays.

Known Predators:

  • American black bears (Ursus_americanus)
  • American martens (Martes_americanus)
  • mink (Neovison_vison)
  • raccoons (Procyon_lotor)
  • hawks (Accipitridae)
  • owls (Strigiformes)
  • bald eagles (Haliaeetus_leucocephalus 
  • golden eagles (Aquila_chrysaetos)
  • northern flickers (Colaptes_auratus)
  • red squirrels (Tamiasciurus_hudsonicus)
  • northern pike (Esox_lucius)

Anti-predator Adaptations: cryptic

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Ecosystem Roles

Common goldeneyes compete directly with fish for prey and tend to be found on fish-free lakes more often than on lakes with fish. Removal of river perch (Perca flavescens) and roach (Rutilus rutilus) from a lake in Sweden resulted in increased use of that lake by common goldeneyes.

Like many other species of ducks, intraspecific nest parasitism is common in Bucephala clangula. Females whose nests are parasitized accept introduced eggs as their own but will abandon nests when too many introduced eggs are added to the nest in a short period of time. Common goldeneye females lay fewer of their own eggs when other eggs are introduced early in the egg-laying phase because they tend to brood only clutches of an optimal size. Levels of intraspecific parasitism vary substantially among populations and may be influenced by how limited nest cavities are in that area. Levels of parasitism range from 0 to 77.8% in British Columbia - seeming to vary mostly by local area and less year to year. Clutches with introduced eggs can be as large as 24, but most parasitized nests in British Columbia had less than 13 eggs in them.

Common goldeneyes are susceptible to botulism (Clostridium botulinum), avian cholera (Pasteurella multocida), and duck viral enteritis. Known parasites include several species of protozoans, flukes, and nematodes.

Mutualist Species:

Commensal/Parasitic Species:

  • Eriksson, M. 1979. Competition Between Freshwater Fish and Goldeneyes Bucephala clangula for Common Prey. Oecologia, 41: 99-107.
  • Andersson, M., M. Eri. 1982. Nest Parasitism in Goldeneyes Bucephala clangula: Some Evolutionary Aspects. The American Naturalist, 120: 1-16.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Predation

Most predation occurs on females and young in nests. North American predators of incubating females and hatchlings include black bears (Ursus americanus), American martens (Martes americanus), mink (Neovison vison), raccoons (Procyon lotor), hawks (Accipitridae), owls (Strigiformes), bald eagles (Haliaeetus leucocephalus), and golden eagles (Aquila chrysaetos). Hatchlings are also taken by northern flickers (Colaptes auratus), red squirrels (Tamiasciurus hudsonicus), and northern pike (Esox lucius). Hatchlings are cryptically colored and females have subdued plumage as well. Females defend their nests and broods with broken-wing displays.

Known Predators:

Anti-predator Adaptations: cryptic

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Population Biology

Global Abundance

>1,000,000 individuals

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Life History and Behavior

Behavior

Communication and Perception

Common goldeneyes are mainly silent outside of the courtship and nest-finding period. Males make short, faint "peent" calls during courtship displays. Females make "gack" sounds when looking for nest sites or when disturbed.

Communication Channels: visual ; acoustic

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Communication and Perception

Common goldeneyes are mainly silent outside of the courtship and nest-finding period. Males make short, faint "peent" calls during courtship displays and grunting sounds after copulation. Females make "gack" sounds that are described as harsh croaks when looking for nest sites or when disturbed. Visual signals are used in courtship and aggression.

Communication Channels: visual ; acoustic

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Life Expectancy

Lifespan/Longevity

Males can live to 11 years and females to 12 years, one common goldeneye lived to 15 years. Hunting, predation, and diseases are the leading causes of death in adults. Many hatchlings die within their first few weeks of life from predators and from being exposed to cold, wet weather.

Range lifespan

Status: wild:
15 (high) years.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Lifespan/Longevity

Adult females have a mean annual survival rate of from 58 to 77%, varying with study and region. Banding records in Canada suggest that males can live to 11 years and females to 12 years, although an unsexed individual was recorded living to 15 years. Hunting, predation, and diseases are noted as the leading causes of mortality in adults. Hatchlings are susceptible to cold, wet weather, which may result in mortality. Young suffer heavy mortality within the first few weeks of hatching.

Range lifespan

Status: wild:
15 (high) years.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Lifespan, longevity, and ageing

Maximum longevity: 18.4 years (wild) Observations: In the wild, the IMR has been estimated at 0.4 per year (http://bna.birds.cornell.edu/).
Creative Commons Attribution 3.0 (CC BY 3.0)

© Joao Pedro de Magalhaes

Source: AnAge

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Reproduction

Common goldeneyes are monogamous. Pairs form in December and last until the male abandons the female at the beginning of incubation. Males use a complex set of courtship displays from December to March to establish and maintain the pair bond. The most spectacular display is the "head-throw-kick," in which a male repeatedly thrusts his head forward, then moves it back towards his rump and utters a call. He then flicks his head forward again while kicking the water with his feet.

Mating System: monogamous

Reproduction in common goldeneyes has been well-studied because they are relatively common in northern boreal areas and they will nest in boxes, making them easy to observe. Females lay from 4 to 12.3 greenish eggs in a single clutch each season. Females lay 1 egg every other day. Common goldeneyes nest in tree cavities, but will accept nest boxes also. Females find nest cavities and line them with other materials and downy feathers. Nests are generally within 1.3 km of water. Females tend to nest in the same place each year and near to the spot where they were hatched. Females incubate the eggs for 28 to 32 days. They leave the nest occasionally during the day to forage. Eggs all hatch within 12 hours of each other. Females first to breed at over 2 years old.

Breeding interval: Common goldeneyes breed yearly, although some individuals do skip occasional years.

Breeding season: Breeding occurs from December through May.

Range eggs per season: 4 to 12.3.

Average eggs per season: 8.7.

Range time to hatching: 28 to 32 days.

Range fledging age: 56 to 65 days.

Range time to independence: 7 to 42 days.

Range age at sexual or reproductive maturity (female): 2 to 6 years.

Average age at sexual or reproductive maturity (female): 3.2 years.

Range age at sexual or reproductive maturity (male): 2 (low) years.

Key Reproductive Features: seasonal breeding ; gonochoric/gonochoristic/dioecious (sexes separate)

Young leave the nest and can walk and swim within 24 to 36 hours after hatching. The mother sits at the nest cavity entrance until all of the young jump to the ground. Females lead their brood away from the nest site to a brooding territory up to 10 km away. Females defend the young and brood them at night and during cold weather. Females abandon their broods before they can fly, usually around 5 to 6 weeks old.

Parental Investment: precocial ; pre-fertilization (Provisioning, Protecting: Female); pre-hatching/birth (Provisioning: Female, Protecting: Female); pre-weaning/fledging (Provisioning: Female, Protecting: Female)

  • Eriksson, M. 1979. Aspects of the breeding biology of the goldeneye Bucephala clangula. Ecography, 2: 186-194.
  • Dow, H., S. Fredga. 1984. Factors Affecting Reproductive Output of the Goldeneye Duck Bucephala clangula. The Journal of Animal Ecology, 53: 679-692.
  • Dow, H., S. Fredga. 1983. Breeding and natal dispersal of the goldeneye, Bucephala clangula. Journal of Animal Ecology, 52: 681-695.
  • Eadie, J., M. Mallory, H. Lumsden. 1995. Common Goldeneye (Bucephala clangula). Pp. 1-20 in J Poole`, ed. The Birds of North America Online, Vol. 170. Ithaca: The Cornell Lab of Ornithology. Accessed March 05, 2009 at http://bna.birds.cornell.edu.proxy.lib.umich.edu/bna/species/170.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Common goldeneyes are monogamous. Pair bonds are formed in December and last until the male abandons the female at the beginning of incubation. It is unknown if pair bonds last over multiple years. Males use a complex set of courtship displays from December to March to establish and maintain the pair bond. Courtship displays occur in groups of several males and females, averaging 4.4 males and 1.2 females per group. There are variations on the displays. The most spectacular is the "head-throw-kick," in which a male repeatedly thrusts his head forward, then moves it back towards his rump and utters a call. He then flicks his head forward again while kicking the water with his feet.

Mating System: monogamous

Reproduction in common goldeneyes has been well-studied because they are relatively common in northern boreal areas and nest in boxes, making them easier to observe. Females lay from 4 to 12.3 greenish eggs in a clutch and lay a single clutch each season. Clutch size estimates are difficult to determine because of the frequency of intraspecific nest parasitism, which inflates clutch sizes. in one study average clutch size was 9.77, when parasitized nests were excluded, average clutch size was 7.13 eggs. Eggs are from 61.2 to 66.6 grams. Females lay 1 egg every other day.

Common goldeneyes nest in tree cavities, but will accept nest boxes and occasionally are found in rock cavities. Females find nest cavities and line them with a nest bowl constructed of other materials and downy feathers. Preferred nesting sites seem to be those used previously with success, rather than nesting sites closer to food resources for adults or young. Nests are generally within 1.3 km of water. Females who fail to breed successfully are more likely to change nest sites between years. Changing nest sites also seems to decrease reproductive success, producing smaller clutches. Females tend to nest in the general vicinity of their previous nest or natal nest. Younger females generally lay smaller clutches later in the season and have lower reproductive success than experienced breeders. After about 6 years old, clutch sizes begin to decline. Nest mortality is mainly due to predation. Clutches laid late in the year have higher mortality rates compared to early clutches.

Females incubate the eggs for 28 to 32 days. They leave the nest occasionally during the day to forage. Eggs hatch synchronously, within 12 hours of each other. Females first breed at over 2 years old, some researchers estimate breeding starts at about 3.2 years old on average and breeding continues annually for 3.9 years.

Breeding interval: Common goldeneyes breed yearly, although some individuals do skip occasional years.

Breeding season: Breeding occurs from December through May.

Range eggs per season: 4 to 12.3.

Average eggs per season: 8.7.

Range time to hatching: 28 to 32 days.

Range fledging age: 56 to 65 days.

Range time to independence: 7 to 42 days.

Range age at sexual or reproductive maturity (female): 2 to 6 years.

Average age at sexual or reproductive maturity (female): 3.2 years.

Range age at sexual or reproductive maturity (male): 2 (low) years.

Key Reproductive Features: seasonal breeding ; gonochoric/gonochoristic/dioecious (sexes separate)

Young are precocial and leave the nest 24 to 36 hours after hatching. The mother attends the nest cavity entrance until all of the young jump to the ground. Females lead their brood away from the nest site to a brooding territory up to 10 km away. Only females defend the young and brood them at night and during cold weather. Females abandon their broods before they fledge, usually around 5 to 6 weeks old, but sometimes as early as 1 week after hatching.

Parental Investment: precocial ; pre-fertilization (Provisioning, Protecting: Female); pre-hatching/birth (Provisioning: Female, Protecting: Female); pre-weaning/fledging (Provisioning: Female, Protecting: Female)

  • Eriksson, M. 1979. Aspects of the breeding biology of the goldeneye Bucephala clangula. Ecography, 2: 186-194.
  • Dow, H., S. Fredga. 1984. Factors Affecting Reproductive Output of the Goldeneye Duck Bucephala clangula. The Journal of Animal Ecology, 53: 679-692.
  • Dow, H., S. Fredga. 1983. Breeding and natal dispersal of the goldeneye, Bucephala clangula. Journal of Animal Ecology, 52: 681-695.
  • Eadie, J., M. Mallory, H. Lumsden. 1995. Common Goldeneye (Bucephala clangula). Pp. 1-20 in J Poole`, ed. The Birds of North America Online, Vol. 170. Ithaca: The Cornell Lab of Ornithology. Accessed March 05, 2009 at http://bna.birds.cornell.edu.proxy.lib.umich.edu/bna/species/170.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Breeding begins in early May in south, June in north. Clutch size is 5-19 (usually 8-12). Incubation, by female, lasts 28-32 days (Terres 1980; Ziucs et al. 1995, Condor 97:461-472). Nestlings are precocial and downy. Young are tended by female, can fly at 51-60 days (Harrison 1978).

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Barcode data: Bucephala clangula

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There are 12 barcode sequences available from BOLD and GenBank.  Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.  See the BOLD taxonomy browser for more complete information about this specimen and other sequences.

GTGACCTTCATCAACCGATGATTATTCTCCACCAATCACAAGGACATCGGCACCCTATATCTTATCTTCGGAGCATGAGCCGGGATAATTGGCACAGCACTCAGCCTGCTAATCCGCGCAGAACTCGGCCAGCCAGGGACCCTCCTGGGCGATGACCAAATTTACAACGTAGTCGTCACCGCCCACGCCTTTGTAATAATCTTCTTCATAGTAATGCCCATCATGATTGGAGGATTCGGCAACTGATTAGTCCCCCTAATAATCGGCGCCCCCGACATAGCATTCCCACGAATAAACAACATAAGCTTCTGACTCCTCCCACCGTCCTTTCTCCTCCTGCTCGCCTCATCTACCGTAGAGGCCGGCGCCGGCACAGGCTGAACCGTGTACCCACCCCTAGCAGGGAACCTAGCCCACGCCGGGGCCTCAGTAGACCTGGCTATCTTCTCCCTCCATTTGGCCGGTATTTCCTCCATCCTGGGGGCCATTAACTTCATCACCACAGCCATCAACATAAAACCTCCCGCACTCTCACAATACCAAACCCCACTCTTCGTCTGATCCGTCCTAATCACCGCCATCCTACTCCTCCTGTCACTCCCTGTCCTCGCCGCCGGCATCACAATGCTGCTAACTGACCGAAACCTAAACACCACATTCTTTGACCCCGCCGGGGGAGGAGACCCGATCCTATACCAACACCTATTCTGATTCTTCGGCCACCCAGAAGTCTACATCTTAATCCTCCCAGGATTCGGGATCATCTCCCACGTAGTCACATACTACTCAGGTAAAAAAGAGCCCTTT
-- end --

Download FASTA File
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Statistics of barcoding coverage: Bucephala clangula

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 10
Specimens with Barcodes: 12
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Conservation

Conservation Status

Common goldeneye populations are relatively stable despite threats to their aquatic habitats, such as acid rain, contamination, and habitat destruction. They are considered "least concern" because of their large range, large population size, and no documented population declines. They are protected as a migratory bird under the U.S. Migratory Bird Act.

IUCN Red List of Threatened Species: least concern

US Migratory Bird Act: protected

US Federal List: no special status

CITES: no special status

State of Michigan List: no special status

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

IUCN Red List Assessment


Red List Category
LC
Least Concern

Red List Criteria

Version
3.1

Year Assessed
2009

Assessor/s
BirdLife International

Reviewer/s
Bird, J., Butchart, S.

Contributor/s
Pihl, S.

Justification
This species has an extremely large range, and hence does not approach the thresholds for Vulnerable under the range size criterion (Extent of Occurrence <20,000 km2 combined with a declining or fluctuating range size, habitat extent/quality, or population size and a small number of locations or severe fragmentation). The population trend appears to be stable, and hence the species does not approach the thresholds for Vulnerable under the population trend criterion (>30% decline over ten years or three generations). The population size is extremely large, and hence does not approach the thresholds for Vulnerable under the population size criterion (<10,000 mature individuals with a continuing decline estimated to be >10% in ten years or three generations, or with a specified population structure). For these reasons the species is evaluated as Least Concern.

History
  • 2008
    Least Concern
  • 2004
    Least Concern
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Common goldeneye populations seem to be relatively stable despite threats to their aquatic habitats, such as acid rain, contamination, and habitat destruction. They are considered "least concern" by the IUCN because of their large range, large population size, and no documented population declines. They are protected as a migratory bird under the U.S. Migratory Bird Act. Population densities may be most affected by availability of nest cavities.

US Migratory Bird Act: protected

US Federal List: no special status

CITES: no special status

State of Michigan List: no special status

IUCN Red List of Threatened Species: least concern

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

National NatureServe Conservation Status

Canada

Rounded National Status Rank: N5B,N5N : N5B: Secure - Breeding, N5N: Secure - Nonbreeding

United States

Rounded National Status Rank: N5B,N5N : N5B: Secure - Breeding, N5N: Secure - Nonbreeding

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

NatureServe Conservation Status

Rounded Global Status Rank: G5 - Secure

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Status

Included in the Birds of Conservation Concern Amber List (medium conservation concern) (3). Receives general protection in the UK under Schedule 1 of the Wildlife and Countryside Act and listed under Annex II of the EC Birds Directive (4).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Threats

Major Threats
The species is threatened by wetland degradation and loss in North America and is susceptible to atmospheric acid deposition (e.g. acid rain) throughout a large part of its breeding range2. The main threat to the species in its wintering range is pollution (e.g. from coastal oil spills or other pollutants from sewage outfalls)1. Utilisation The species is hunted sustainably in Denmark8 although the influence of hunting on global populations is unknown2.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

This species is not threatened at present.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Management

Conservation

Building nest boxes for goldeneyes throughout Europe has resulted in an increase in numbers of this duck. Furthermore, this factor has aided the colonisation of the Scottish breeding population (4). 26% of the overwintering population in Britain occurs in Special Protection Areas (SPAs) (4).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Relevance to Humans and Ecosystems

Benefits

Economic Importance for Humans: Negative

There are no known adverse effects of common goldeneyes on humans.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Economic Importance for Humans: Positive

Common goldeneyes are hunted throughout much of their range.

Positive Impacts: food

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Economic Importance for Humans: Negative

There are no known adverse effects of common goldeneyes on humans.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Economic Importance for Humans: Positive

Common goldeneyes are hunted throughout much of their range.

Positive Impacts: food

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Wikipedia

Common Goldeneye

The Common Goldeneye (Bucephala clangula) is a medium-sized sea duck of the genus Bucephala, the goldeneyes. Their closest relative is the similar Barrow's Goldeneye.

Adult males ranges from 45–52 cm (18–21 inches) and from 888 to 1400 grams (1.9 to 3.1 lbs), while females range from 40–50 cm (16–20 inches) and from 500 to 1182 grams (1.1 to 2.6 lbs). The species is aptly named for its golden-yellow eye. Adult males have a dark head with a greenish gloss and a circular white patch below the eye, a dark back and a white neck and belly. Adult females have a brown head and a mostly grey body. Their legs and feet are orange-yellow.

Their breeding habitat is the taiga. They are found in the lakes and rivers of boreal forests across Canada and the northern United States, Scandinavia and northern Russia. They are migratory and most winter in protected coastal waters or open inland waters at more temperate latitudes. Naturally, they nest in cavities in large trees. They will readily use nestboxes, and this has enabled a healthy breeding population to establish in Scotland where they are increasing and slowly spreading with the help of nestboxes. They are usually quite common in winter around lakes of Britain and some are being encouraged to nest in nestboxes which are put up to try to have them there all year round. Occasionally recorded as a vagrant in various parts of the Indian Subcontinent.

Often the natural tree cavities are made by broken limbs, unless they are made by Pileated Woodpeckers or Black Woodpeckers, the only tree-cavity-making animals who make a cavity large enough to normally accommodate a goldeneye. Average egg size is a breadth of 43.3 mm (1.7 inches), a length of 59.3 mm (2.3 inches) and a weight of 64 grams (2.3 oz). The incubation period ranges from 28 to 32 days. The female does all the incubating and is abandoned by the male about 1 to 2 weeks into incubation. The young remain in the nest for about 24–36 hours. Brood parasitism is quite common both with other Common Goldeneyes as well as other duck species and even Tree Swallow and European Starling eggs have been found mixed with goldeneye eggs! The broods commonly start to mix with other females' broods as they become more independent. Goldeneye young have been known to be competitively killed by other goldeneye mothers, Common Loons and Red-necked Grebes. The young are capable of flight at 55–65 days of age.

In flight over Rideau River, Ottawa, Ontario
Pair

These diving birds forage underwater. Year-round, about 32% of their prey is crustaceans, 28% is aquatic insects and 10% is molluscs. Insects are the predominant prey while nesting and crustaceans are the predominant prey during migration and winter. Locally, fish eggs and aquatic plants can be important foods. They themselves may fall prey to various hawks, owls and eagles, while females and their broods have been preyed upon by bears (Ursus spp.), various weasels (Mustela spp.), mink (Mustela vison), raccoons (Procyon lotor) and even Northern Flickers (Colaptes auratus) and red squirrels (Tamiasciurus husonicus).

The Common Goldeneye is one of the species to which the Agreement on the Conservation of African-Eurasian Migratory Waterbirds (AEWA) applies.

Approximately 188 300 Common Goldeneyes were killed by duck hunters in North America during the 1970s, representing about 4% of the total number of ducks killed in the region during that period[citation needed]. The rate is probably similar today. Both the breeding and winter habitat of these birds has been degraded by clearance and pollution. However, this is the only duck in North America known to derive short-term benefits from lake acidification.

References

Creative Commons Attribution Share Alike 3.0 (CC BY-SA 3.0)

 

Source: Wikipedia

Unreviewed

Article rating from 0 people

Average rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!