Articles on this page are available in 1 other language: Spanish (20) (learn more)

Overview

Brief Summary

Aythya affinis

When floating far out on the water, it can be difficult to separate the Lesser Scaup from its relative, the Greater Scaup (Aythya marila). Males of both species are medium-sized ducks with dark heads and chests, light backs and flanks, and dark tails. A closer look reveals that the Lesser Scaup has a peaked, purple-tinged head and light gray flanks (as opposed to the Greater Scaup, which has a flat-topped, green-tinged head and white flanks). The females of both species (both dark brown) are also difficult to separate, although the female Lesser Scaup tends to be slightly darker brown than the female of the other species. Both species also have blue bills, earning them the nickname “bluebill” with duck hunters. The Lesser Scaup breeds across much of western Canada and Alaska, with smaller breeding populations in the northern Great Plains, in northern portions of the Rocky Mountains, and in the Great Lakes region. Most Lesser Scaups migrate south in winter, when they may be found along the Pacific and Atlantic coasts of the U.S., in the Ohio River Valley, in the interior south and southwest, and south to Mexico, Central America, and the Caribbean. Lesser Scaup are also known to winter in Hawaii. Lesser Scaups breed on fresh or slightly brackish wetlands with marsh grasses. In winter, they may be found in large numbers on large lakes, bays, and reservoirs. Although they may be found in saltwater in winter, Lesser Scaup are somewhat less likely to be seen on the open ocean than the Greater Scaup. This species’ diet primarily consists of invertebrates, such as crustaceans, mollusks, and insects when available. One of several species of “diving ducks” in North America, Lesser Scaups may be observed submerging themselves to feed on invertebrates in the water or on the bottom. In winter, they may also be observed in flocks of many hundreds or thousands of birds on large bodies of water. This species is primarily active during the day.

Threat Status: Least concern

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Unknown

Supplier: DC Birds

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Distribution

occurs (regularly, as a native taxon) in multiple nations

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

National Distribution

Canada

Origin: Native

Regularity: Regularly occurring

Currently: Present

Confidence: Confident

Type of Residency: Year-round

United States

Origin: Native

Regularity: Regularly occurring

Currently: Present

Confidence: Confident

Type of Residency: Year-round

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Global Range: (>2,500,000 square km (greater than 1,000,000 square miles)) BREEDING: central Alaska and Mackenzie Delta to northern Manitoba and northern Ontario south to southern British Columbia, northern Idaho, northern Wyoming, northern North Dakota, and Minnesota, casually or irregularly east to central Quebec and south to Washington, central California, northern Utah, central Colorado, central Nebraska, northwestern Iowa, central Illinois, and northern Ohio (AOU 1998). NON-BREEDING: southern Alaska, and from southern British Columbia, southern Idaho, Utah, northeastern Colorado, Kansas, Iowa, southern Great Lakes region, and New England south throughout the southern U.S., Middle America, and West Indies to northern Colombia, northern Venezuela (very small number at southern limit of this range); small numbers in Hawaii. Primary wintering areas in the U.S. include the Atlantic and Gulf coastal plains, Mississippi Valley north to the Ohio River, and the Pacific states, plus southern British Columbia; the highest densities occur in southern Florida and along the Mississippi River (Root 1988).

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

North America; Scotian shelf to the Gulf of Mexico
  • North-West Atlantic Ocean species (NWARMS)
Creative Commons Attribution 3.0 (CC BY 3.0)

© WoRMS for SMEBD

Source: World Register of Marine Species

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Geographic Range

Lesser scaup are an American species of Aythya. They breed in cold, northern lakes in interior Alaska and Canada and into parts of the northern United States. In winter they are found on bodies of water along the Pacific and Atlantic coasts of the United States, the southern United States, Florida, and along the Atlantic coast to Massachusetts. They are also found in the southern Great Lakes region and Ohio and Mississippi river drainages. Lesser scaup also winter throughout Mexico and Central America, the Antilles, and the Hawaiian Islands.

Biogeographic Regions: nearctic (Native ); neotropical (Native )

  • Austin, J., C. Custer, A. Afton. 1998. Lesser Scaup (Aythya affinis). The Birds of North America Online, 338: 1-17.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: BioKIDS Critter Catalog

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Range

Alaska to s US; winters n South America and Hawaiian Islands.

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Geographic Range

Lesser scaup are an American species of diving duck. They breed in interior boreal forests and parklands of Alaska and Canada and into the United States in North and South Dakota, Montana, Wyoming, northeastern Washington, and the Klamath region of southern Oregon and northeastern California. In winter they are found in appropriate habitat in the Pacific coastal states, the southern states, including Colorado, the southeast, Florida, and along the Atlantic coast to Massachusetts. They are also found in the southern Great Lakes region and Ohio and Mississippi river drainages. Lesser scaup also winter throughout Mexico and Central America, the Antilles, and the Hawaiian Islands. Occasional birds are seen in winter in the western Palearctic, Greenland, British Isles, Canary Islands, and the Netherlands.

Biogeographic Regions: nearctic (Native ); neotropical (Native )

  • Austin, J., C. Custer, A. Afton. 1998. Lesser Scaup (Aythya affinis). The Birds of North America Online, 338: 1-17.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Physical Description

Morphology

Physical Description

Lesser scaup are medium-sized Aythya. Males are slightly larger than females. Males and females have different feather colors throughout most of the year. Males in breeding plumage (August to the following June) have a blue bill and purplish-black head, breast, neck, tail, and vent. The sides and belly are white and the back is white with grey spots. Females are chocolate brown, with lighter sides, a reddish head, and a white patch at the base of their dark grey bill. In all lesser scaup there is a white wing stripe on the trailing edge of the upper wing surface.

Range mass: 600 to 1200 g.

Range length: 39.1 to 45.1 cm.

Other Physical Features: endothermic ; homoiothermic; bilateral symmetry

Sexual Dimorphism: male larger; sexes colored or patterned differently; male more colorful

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: BioKIDS Critter Catalog

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Physical Description

Lesser scaup are medium-sized diving ducks. Males are slightly larger than females: from 40.4 to 45.1 cm in males and 39.1 to 43.4 cm in females, and from 700 to 1200 g in males and 600 to 1100 g in females. Males and females have different plumage patterns throughout most of the year. Males in breeding plumage (August to the following June) have a blue bill, purplish-black head, breast, neck, tail, and vent. The sides and belly are white and the back is white with grey flecking. Females are chocolate brown, with lighter sides, a rufous head, and a white patch at the base of their dark grey bill. In all birds the secondary feathers are white at the end, resulting in a white wing stripe on the trailing edge of the upper wing surface. Iris color varies with sex and age. Irises are grayish in hatchlings, become yellow-green in juvenile males, and then deep yellow in adult males. Iris color in females stays a brownish color.

Lesser scaup are difficult to distinguish from their close relatives, greater scaup (Aythya marila), especially at a distance. There is no documented geographic variation and no subspecies described.

Range mass: 600 to 1200 g.

Range length: 39.1 to 45.1 cm.

Other Physical Features: endothermic ; homoiothermic; bilateral symmetry

Sexual Dimorphism: male larger; sexes colored or patterned differently; male more colorful

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Size

Length: 42 cm

Weight: 850 grams

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Ecology

Habitat

Comments: BREEDING: Marshes, ponds, and small lakes (AOU 1998). Usually nests near small ponds and lakes, sedge meadows, creeks; in cover 1-2 ft high, within 46 m of water. Often nest on islands among colonies of gulls or terns. NON-BREEDING: During migration and when not breeding, found along coast in sheltered bays, estuaries, and marshes or inland on lakes, ponds, and rivers; on salt water especially if lakes and ponds frozen. In southern winter range, prefers freshwater ponds, lakes, and sloughs with reasonably clear water 1 m or more deep (Stiles and Skutch 1989).

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Habitat and Ecology

Systems
  • Terrestrial
  • Freshwater
  • Marine
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Lesser scaup breed and look for food in wetland habitats. They are found throughout the year on wetlands, lakes, ponds, and along coastlines with vegetation in and above the water, like Typhus or Scirpus and Potamogeton or Myriophyllum spicatum. Lesser scaup are most common on ponds with lots of Amphipoda for them to eat. They build their nests on the land near ponds.

Habitat Regions: temperate ; freshwater

Terrestrial Biomes: savanna or grassland

Aquatic Biomes: lakes and ponds; rivers and streams; temporary pools; coastal ; brackish water

Wetlands: marsh ; bog

Other Habitat Features: estuarine

  • Lindeman, D., R. Clark. 1999. Amphipods, land-use impacts, and lesser scaup (Aythya Affinis) distribution in Saskatchewan wetlands. Wetlands, 19: 627-638.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: BioKIDS Critter Catalog

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Lesser scaup are reliant on wetland habitats for foraging and breeding. They are found throughout the year on semi-permanent or seasonal wetlands with emergent vegetation (such as cattails, Typhus, or bulrushes, Scirpus) or submergent vegetation (pondweed, Potamogeton, water milfoil, Myriophyllum spicatum, hornwort, Ceratophyllum demersum, or muskgrass, Chara). They are most abundant in ponds with high amphipod abundance and intact wetland margins. They are found in freshwater or slightly brackish wetland areas, including ponds, lakes, river impoundments, and coastal bays. Preferred wetlands are fairly shallow. Lesser scaup nest in wetland meadow or grassland areas near ponds.

Habitat Regions: temperate ; freshwater

Terrestrial Biomes: savanna or grassland

Aquatic Biomes: lakes and ponds; rivers and streams; temporary pools; coastal ; brackish water

Wetlands: marsh ; bog

Other Habitat Features: estuarine

  • Lindeman, D., R. Clark. 1999. Amphipods, land-use impacts, and lesser scaup (Aythya Affinis) distribution in Saskatchewan wetlands. Wetlands, 19: 627-638.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Depth range based on 1 specimen in 1 taxon.

Environmental ranges
  Depth range (m): 0 - 0
 
Note: this information has not been validated. Check this *note*. Your feedback is most welcome.

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Migration

Non-Migrant: No. All populations of this species make significant seasonal migrations.

Locally Migrant: No. No populations of this species make local extended movements (generally less than 200 km) at particular times of the year (e.g., to breeding or wintering grounds, to hibernation sites).

Locally Migrant: Yes. At least some populations of this species make annual migrations of over 200 km.

Migrates northward usually in March-April, arriving in far north late May-early June. Departs far north by the end of September, migrates southward through U.S. mainly October-November. Scaup that breed along Beaufort Sea coast winter throughout broad range of central and southern latitudes in North America, from coast to coast.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Trophic Strategy

Comments: Feeds on seeds of pondweeds, widgeon grass, wild rice, sedges, bulrushes; also crustaceans, mollusks, and aquatic insects. Diet varies with location. Most feeding occurs in fresh water of various depths, often 3-8 m. In midwinter in Louisiana and in spring and fall in northwestern Minnesota, important foods were crustaceans, insects, and mollusks; in fall, immatures fed heavily on amphipods and did not consume fishes or fingernail clams, which were important in adult diets; by dry weight, animal foods comprised over 90% of the diet in fall and spring, 61% in midwinter (Afton et al. 1991). During fall migration in Ontario, fed in large numbers on zebra mussels (DREISSENA) (Wormington and Leach 1992).

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Food Habits

Lesser scaup adults and young eat Insecta, Crustacea, and Mollusca. Amphipoda, Chironomidae, and Hirudinea are especially important in the diet. They sometimes also take the seeds of aquatic plants. They forage in shallow, open water by diving. They mostly eat prey underwater, but will bring larger prey to the surface.

Animal Foods: fish; eggs; insects; mollusks; terrestrial worms; aquatic crustaceans

Plant Foods: seeds, grains, and nuts

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: BioKIDS Critter Catalog

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Food Habits

Lesser scaup adults and young eat insects, crustaceans, and mollusks. They sometimes also take the seeds of aquatic plants, such as yellow pond lily (Nuphar). They forage in shallow, open water by diving. They dive at an angle and surface a few meters from where they dived. They mostly eat prey underwater, but will bring larger prey to the surface to handle it there. Diet varies with the seasonal availability of food and regionally. In breeding lakes amphipods are especially important in the diet. Midges (Chironomidae) and leeches (Hirudinea) are also important in northern lakes. Mollusks and plant seeds become more important at other times of the year and fish and their eggs are taken opportunistically. Seeds become more important in the diet in fall.

Animal Foods: fish; eggs; insects; mollusks; terrestrial worms; aquatic crustaceans

Plant Foods: seeds, grains, and nuts

Primary Diet: carnivore (Insectivore , Eats non-insect arthropods, Molluscivore , Vermivore)

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Associations

Ecosystem Roles

Lesser scaup are important predators of aquatic invertebrates in northern lakes. Eggs and hatchlings are taken by a wide range of predators. They fall ill with a range of diseases and parasites, including avian influenza, avian cholera, avian botulism, aspergillosis, and a variety of worms and blood parasites.

Lesser scaup nests are parasitized by other lesser scaup as well as by other ducks, including Aythya americana, Anas strepera, Melanitta fusca, Oxyura jamaicensis, Aythya valisineria, and Mergus serrator. Lesser scaup also parasitize the nests of other ducks, including Anas strepera, Anas clypeata, Aythya americana, Melanitta fusca, and Aythya valisineria.

Commensal/Parasitic Species:

  • gizzard worms (Streptocara_crassicauda)
  • renal coccidia (Eimeria)
  • blood parasites (Leucocytozoon_simondi)
  • blood parasites (Haemoproteus_nettionis)
  • (Sarcocystis)
  • leeches (Theromyzon_rude)
  • redheads (Aythya_americana)
  • gadwall (Anas_strepera)
  • canvasbacks (Aythya_valisineria)
  • white-winged scoters (Melanitta_fusca)
  • ruddy ducks (Oxyura_jamaicensis)
  • red-breasted mergansers (Mergus_serrator)

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: BioKIDS Critter Catalog

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Predation

Ducklings that are attacked by predators try to stay together and females will try to protect their young. Females try to keep their young near the cover of plants and the dull brown feathers of ducklings may help to protect them. Adults may pretend to be dead when attacked by large predators. Most predation is on eggs and hatchlings. Eggs are taken by Neovison vison, Procyon lotor, Vulpes vulpes, Corvus brachyrhynchos, Larus delawarensis, Larus californicus, Corvus corax, and Taxidea taxus. Ducklings are taken by many of the same predators, as well as Pica pica, Bubo virginianus, Nycticorax nycticorax, Buteo swainsoni, Fulica americana, and Gavia arctica. Adults are taken by the other mammal predators mentioned and Mephitis mephitis and Canis latrans when they are on the nest. Adults are also taken by Chelydra serpentina, Buteo jamaicensis, Falco peregrinus, Nyctea scandiaca and Haliaeetus leucocephalus.

Known Predators:

  • American mink (Neovison_vison)
  • raccoons (Procyon_lotor)
  • red foxes (Vulpes_vulpes)
  • American crows (Corvus_brachyrhynchos)
  • ring-billed gulls (Larus_delawarensis)
  • California gulls (Larus_californicus)
  • common ravens (Corvus_corax)
  • American badgers (Taxidea_taxus)
  • black-billed magpies (Pica_pica)
  • great horned owls (Bubo_virginianus)
  • black-crowned night herons (Nycticorax_nycticorax)
  • Swainson's hawks (Buteo_swainsoni)
  • American coots (Fulica_americana)
  • Arctic loons (Gavia_arctica)
  • striped skunks (Mephitis_mephitis)
  • coyotes (Canis_latrans)
  • snapping turtles (Chelydra_serpentina)
  • red-tailed hawks (Buteo_jamaicensis)
  • peregrine falcons (Falco_peregrinus)
  • snowy owls (Nyctea_scandiaca)
  • bald eagles (Haliaeetus_leucocephalus)

Anti-predator Adaptations: cryptic

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: BioKIDS Critter Catalog

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Ecosystem Roles

Lesser scaup are important predators of aquatic invertebrates in northern boreal lakes. Eggs and hatchlings are taken by a wide range of terrestrial, avian, and aquatic predators. They are susceptible to a range of diseases and parasites. Recorded diseases include avian influenza A, avian cholera (Pasteurella multocida), avian botulism, and aspergillosis (Aspergillus fumigatus). Lesser scaup host a number of scaup specific helminth parasites, including, including gizzard worms (Streptocara crassicauda). Other parasites include renal coccidia (Eimeria species), blood parasites (Leucocytozoon simondi and Haemoproteus nettionis), and g.Sarcocystis> species. Leeches (Theromyzon rude) are often found on the nasal membranes of lesser scaup.

Lesser scaup nests are parasitized by other lesser scaup as well as by other ducks, including redheads, gadwall, white-winged scoters, ruddy ducks, canvasbacks, and red-breasted mergansers. Lesser scaup also parasitize the nests of other ducks, including gadwall, orthern shovelers, redheads, white-winged scoters, and canvasbacks.

Commensal/Parasitic Species:

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Predation

Ducklings that are attacked by predators try to stay together and females will try to protect their young, but often their defenses aren't sufficient. Females try to keep their young near the cover of vegetation and the cryptic coloration of ducklings may help to protect them. Adults may feign death when taken by large predators. Most predation is on eggs and hatchlings. Eggs are taken by American mink, raccoons, red foxes, American crows, ring-billed gulls, California gulls, common ravens, and American badgers. Ducklings are taken by many of the same predators, as well as black-billed magpies, great horned owls, black-crowned night herons, Swainson's hawks, American coots, and Arctic loons. Adults are taken by the terrestrial predators mentioned, along with striped skunks and coyotes, when on the nest. Adults are also taken by snapping turtles, red-tailed hawks, peregrine falcons, snowy owls and bald eagles.

Ducklings that are attacked by predators try to stay together and females will try to protect their young. Females try to keep their young near the cover of plants and the dull brown feathers of ducklings may help to protect them. Adults may pretend to be dead when attacked by large predators. Most predation is on eggs and hatchlings. Eggs are taken by American mink, raccoons, red foxes, American crows, ring-billed gulls, California gulls, common ravens, and American badgers. Ducklings are taken by many of the same predators, as well as black-billed magpies, great horned owls, black-crowned night herons, Swainson's hawks, American coots, and Arctic loons. Adults are taken by the other mammal predators mentioned and striped skunks and coyotes when they are on the nest. Adults are also taken by snapping turtles, red-tailed hawks, peregrine falcons, snowy owls and bald eagles.

Known Predators:

Anti-predator Adaptations: cryptic

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Known predators

Aythya affinis (ducks (Lesser Scaup)) is prey of:
Mammalia

Based on studies in:
USA: Iowa, Mississippi River (River)

This list may not be complete but is based on published studies.
  • C. A. Carlson, Summer bottom fauna of the Mississippi River, above Dam 19, Keokuk, Iowa, Ecology 49(1):162-168, from p. 167 (1968).
Creative Commons Attribution 3.0 (CC BY 3.0)

© SPIRE project

Source: SPIRE

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Known prey organisms

Aythya affinis (ducks (Lesser Scaup)) preys on:
Chironomidae
Gastropoda
Amnicolidae
Bivalvia
Potamya

Based on studies in:
USA: Iowa, Mississippi River (River)

This list may not be complete but is based on published studies.
  • C. A. Carlson, Summer bottom fauna of the Mississippi River, above Dam 19, Keokuk, Iowa, Ecology 49(1):162-168, from p. 167 (1968).
Creative Commons Attribution 3.0 (CC BY 3.0)

© SPIRE project

Source: SPIRE

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

General Ecology

NON-BREEDING: usually in flocks on open water (Ridgely and Gwynne 1989).

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Life History and Behavior

Behavior

Communication and Perception

Lesser scaup use a set of visual displays, sometimes with calls, during courtship. The most common display is called the "cough" because they give a short "whew" sound while they flick their wings and tail. Males also use a head-throw and kinked-neck display to attract females. Females also make a soft "arrr" sound during courtship.

Communication Channels: visual ; acoustic

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: BioKIDS Critter Catalog

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Communication and Perception

Lesser scaup use a set of visual displays, sometimes accompanied by vocalizations, during courtship. The most common display is called the "cough" because they give a short "whew" sound while they flick their wings and tail. Males also use a head-throw and kinked-neck display to attract females. Lesser scaup are fairly quiet animals. Males give a soft call during courtship and a whistle during mating displays that accompanies their visual display. Females also make a soft "arrr" sound during courtship, which signals her interest in a particular male. Females make a "purrrr" call that is directed towards predators and is also used to attract the help of their male mates when they are flying from the nest to a pond. Males then keep other males away that might harass the female.

Communication Channels: visual ; acoustic

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Life Expectancy

Lifespan/Longevity

Most lesser scaup die within the first few weeks of hatching from predation and being exposed to cold weather. The maximum lifespan in the wild is 18 years, 4 months. Between 32 and 71% of lesser scaup die each year, depending on the area.

Range lifespan

Status: wild:
18.33 (high) years.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: BioKIDS Critter Catalog

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Lifespan/Longevity

Most mortality occurs within the first few weeks of hatching as a result of predation and cold stress. Ducklings that are hatched from larger eggs and later in the season have higher survival rates, so nutrient reserves influence survival. Lesser scaup seem to have a flexible reproductive strategy that allows them to take advantage of temporally variable resources to maximize reproductive success. The maximum recorded lifespan in the wild is 18 years, 4 months. Annual mortality estimates range from 32 to 71%.

Range lifespan

Status: wild:
18.33 (high) years.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Lifespan, longevity, and ageing

Maximum longevity: 18.3 years (wild)
Creative Commons Attribution 3.0 (CC BY 3.0)

© Joao Pedro de Magalhaes

Source: AnAge

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Reproduction

Egg-laying begins in early May in the south to mid-June in the north. Clutch size: 6-15 (usually 9-12, largest in older females). Incubation: 22-27 days, by female (Terres 1980). Young are tended by female. Variable percentage of yearling females do not breed.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Lesser scaup form male-female pairs for the breeding season when they are migrating in the spring. Before the females begin laying eggs, they sometimes switch mates.

Mating System: monogamous

Lesser scaup nest later than most other North American ducks. They arrive in the breeding area in May and build nests and lay eggs in June. Females and males start the nest as a shallow depression in a grassy area, gradually adding grasses and feathers to form a bowl throughout incubation. Females lay from 6 to 14 pale, greenish eggs in a clutch. They lay 1 egg per day until the clutch is complete and begin incubating a day or two before the final egg is laid. Some females lay eggs in the nests of other females. Males abandon their female mates about mid-way through incubation, which lasts 21 to 27 days. Young can fly 47 to 61 days after hatching. Males and females can breed in the first year after hatching.

Breeding interval: Lesser scaup breed once yearly, they typically lay one clutch, but may attempt a replacement clutch if the first is destroyed early in the season.

Breeding season: Breeding occurs in May and June.

Range eggs per season: 6 to 14.

Average eggs per season: 8-10.

Range time to hatching: 21 to 27 days.

Range fledging age: 47 to 61 days.

Range time to independence: 2 to 5 weeks.

Average age at sexual or reproductive maturity (female): 1 years.

Average age at sexual or reproductive maturity (male): 1 years.

Key Reproductive Features: seasonal breeding ; gonochoric/gonochoristic/dioecious (sexes separate)

Only females incubate the eggs and care for the young after hatching. Males abandon females when they are incubating the eggs. Young are able to walk and feed themselves when they hatch. Females lead the young away from the nest within a day of hatching. Young feed from the water surface at first, but feed by diving by 2 weeks old. Females stay with the young for 2 to 5 weeks after hatching, but then abandon them, often before they begin to fly.

Parental Investment: precocial ; pre-fertilization (Provisioning, Protecting: Female); pre-hatching/birth (Provisioning: Female, Protecting: Female); pre-weaning/fledging (Protecting: Female)

  • Austin, J., C. Custer, A. Afton. 1998. Lesser Scaup (Aythya affinis). The Birds of North America Online, 338: 1-17.
  • Dawson, R., R. Clark. 1996. Effects of variation in egg size and hatching date on survival of Lesser Scaup Aythya affinis ducklings.. Ibis, 138: 693-699.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: BioKIDS Critter Catalog

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Lesser scaup are monogamous. Mate-switching is common during the breeding season. Pairs are formed during late spring migration and last only until the females have been incubating the eggs for some time. Forced extra-pair copulations are common.

Mating System: monogamous

Lesser scaup are one of the latest nesting ducks in North America. Most individuals arrive on breeding grounds by May and nesting and egg-laying activity peaks in June. Nesting is highly synchronous across large geographic areas. Females and males start the nest as a scrape in a grassy area, gradually adding grasses and feathers to form a bowl throughout incubation. Females lay from 6 to 14 pale, greenish eggs in a clutch. They lay 1 egg per day until the clutch is complete and begin incubating a day or two before the final egg is laid. Some females lay eggs in the nests of other females. Larger clutches are found in southern populations than in northern populations. Males abandon their female mates on the nest in mid to late June, about mid-way through incubation, which lasts 21 to 27 days. Lesser scaup ducklings that hatch from larger eggs and later in the season have higher survival rates than others. It is thought that lesser scaup breed later in the season than other North American ducks in order to take best advantage of amphipod prey abundance, which increases later in the season. Young can fly 47 to 61 days after hatching. Males and females can breed in the first year after hatching, although breeding may be delayed in unfavorable years.

Breeding interval: Lesser scaup breed once yearly, they typically lay one clutch, but may attempt a replacement clutch if the first is destroyed early in the season.

Breeding season: Breeding occurs in May and June.

Range eggs per season: 6 to 14.

Average eggs per season: 8-10.

Range time to hatching: 21 to 27 days.

Range fledging age: 47 to 61 days.

Range time to independence: 2 to 5 weeks.

Average age at sexual or reproductive maturity (female): 1 years.

Average age at sexual or reproductive maturity (male): 1 years.

Key Reproductive Features: seasonal breeding ; gonochoric/gonochoristic/dioecious (sexes separate)

Only females incubate the eggs and care for the young after hatching. Males abandon females during the incubation phase. Young are precocial at hatching and can feed themselves. Females lead their brood away from the nest within a day of hatching. Young feed from the water surface initially, but feed by diving by 2 weeks old. Females attend their brood for 2 to 5 weeks after hatching, often abandoning them before they begin to fly.

Parental Investment: precocial ; pre-fertilization (Provisioning, Protecting: Female); pre-hatching/birth (Provisioning: Female, Protecting: Female); pre-weaning/fledging (Protecting: Female)

  • Austin, J., C. Custer, A. Afton. 1998. Lesser Scaup (Aythya affinis). The Birds of North America Online, 338: 1-17.
  • Dawson, R., R. Clark. 1996. Effects of variation in egg size and hatching date on survival of Lesser Scaup Aythya affinis ducklings.. Ibis, 138: 693-699.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Barcode data: Aythya affinis

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There are 11 barcode sequences available from BOLD and GenBank.  Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.  See the BOLD taxonomy browser for more complete information about this specimen and other sequences.

CTTATATCTTATCTTCGGGGCATGAGCCGGAATAATCGGCACAGCACTCAGCCTGCTAATCCGCGCAGAACTAGGCCAACCAGGAACCCTCCTAGGTGATGACCAGATTTACAACGTAATCGTCACCGCCCACGCCTTTGTAATAATCTTCTTCATAGTGATGCCCATCATAATCGGAGGGTTTGGCAACTGATTAGTCCCCCTAATAATCGGCGCCCCCGACATAGCATTCCCACGAATAAACAACATAAGCTTCTGGCTCCTCCCACCCTCATTCCTCCTCCTACTCGCCTCATCCACCGTAGAAGCTGGCGCCGGCACAGGCTGAACCGTGTACCCACCTCTAGCAGGCAACCTAGCTCACGCTGGGGCCTCAGTAGACCTGGCCATTTTCTCGCTCCACTTAGCCGGTGTTTCCTCTATTCTCGGAGCCATTAACTTCATCACCACAGCCATCAACATAAAACCCCCCGCACTCTCACAATACCAGACCCCACTCTTTGTCTGATCCGTCCTAATCACCGCTATTCTGCTCCTCCTATCACTACCCGTCCTCGCCGCTGGCATCACAATACTACTAACCGACCGAAACCTAAACACCACATTCTTTGACCCCGCCGGAGGAGGCGACCCAATCCTGTACCAACACCTATTCTGATTCTTCGGCCATCCGGAAGTCTACATCTTAATCCTC
-- end --

Download FASTA File
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Statistics of barcoding coverage: Aythya affinis

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 11
Specimens with Barcodes: 14
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Conservation

Conservation Status

National NatureServe Conservation Status

Canada

Rounded National Status Rank: N5B,N5N : N5B: Secure - Breeding, N5N: Secure - Nonbreeding

United States

Rounded National Status Rank: N5B,N5N : N5B: Secure - Breeding, N5N: Secure - Nonbreeding

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

NatureServe Conservation Status

Rounded Global Status Rank: G5 - Secure

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

IUCN Red List Assessment


Red List Category
LC
Least Concern

Red List Criteria

Version
3.1

Year Assessed
2012

Assessor/s
BirdLife International

Reviewer/s
Butchart, S. & Symes, A.

Contributor/s

Justification
This species has an extremely large range, and hence does not approach the thresholds for Vulnerable under the range size criterion (Extent of Occurrence <20,000 km2 combined with a declining or fluctuating range size, habitat extent/quality, or population size and a small number of locations or severe fragmentation). Despite the fact that the population trend appears to be decreasing, the decline is not believed to be sufficiently rapid to approach the thresholds for Vulnerable under the population trend criterion (>30% decline over ten years or three generations). The population size is extremely large, and hence does not approach the thresholds for Vulnerable under the population size criterion (<10,000 mature individuals with a continuing decline estimated to be >10% in ten years or three generations, or with a specified population structure). For these reasons the species is evaluated as Least Concern.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Lesser scaup are not considered threatened because they have large population sizes and a large range. They are one of the most abundant duck species in North America. However, in some areas people have noticed population declines that may be the result of losing wetland habitats, pollution, and lack of sufficient prey.

IUCN Red List of Threatened Species: least concern

US Migratory Bird Act: protected

US Federal List: no special status

CITES: no special status

State of Michigan List: no special status

  • Custer, C., T. Custer, M. Anteau, A. Afton, D. Wooten. 2003. Trace Elements in Lesser Scaup (Aythya affinis) from the Mississippi Flyway. Ecotoxicology, 12: 47-54.
  • Anteau, M., A. Afton. 2004. Nutrient reserves of lesser scaup (Aythya affinis) during spring migration in the Mississippi flyway: a test of the spring condition hypothesis. The Auk, 121: 917-929.
  • BirdLife International 2008, 2008. "Aythya affinis" (On-line). The IUCN Redlist. Accessed April 02, 2009 at http://www.iucnredlist.org/details/141551.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: BioKIDS Critter Catalog

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Lesser scaup are considered least concern by the IUCN because of their large population sizes and geographic range. They are one of the most abundant duck species in North America. However, regional population declines have been documented and some populations may be susceptible to habitat degradation (such as wetland destruction) and pollution. High levels of selenium have been detected in the livers of lesser scaup in the Great Lakes region, but not in other regions where research has been conducted to date. Research on female body condition just prior to egg laying in North America suggests that nutrient stress is resulting in lower reproductive success in North America.

US Migratory Bird Act: protected

US Federal List: no special status

CITES: no special status

State of Michigan List: no special status

IUCN Red List of Threatened Species: least concern

  • Custer, C., T. Custer, M. Anteau, A. Afton, D. Wooten. 2003. Trace Elements in Lesser Scaup (Aythya affinis) from the Mississippi Flyway. Ecotoxicology, 12: 47-54.
  • Anteau, M., A. Afton. 2004. Nutrient reserves of lesser scaup (Aythya affinis) during spring migration in the Mississippi flyway: a test of the spring condition hypothesis. The Auk, 121: 917-929.
  • BirdLife International 2008, 2008. "Aythya affinis" (On-line). The IUCN Redlist. Accessed April 02, 2009 at http://www.iucnredlist.org/details/141551.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Population

Population Trend
Decreasing
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Relevance to Humans and Ecosystems

Benefits

Economic Importance for Humans: Negative

There are no known adverse effects of lesser scaup on humans.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: BioKIDS Critter Catalog

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Economic Importance for Humans: Positive

Lesser scaup are important members of North American wetland ecosystems. They are also hunted during migration.

Positive Impacts: food ; body parts are source of valuable material

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: BioKIDS Critter Catalog

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Economic Importance for Humans: Negative

There are no known adverse effects of lesser scaup on humans.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Economic Importance for Humans: Positive

Lesser scaup are important members of North American wetland ecosystems. They are also hunted during migration.

Positive Impacts: food ; body parts are source of valuable material

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Wikipedia

Lesser Scaup

The lesser scaup (Aythya affinis) is a small North American diving duck that migrates south as far as Central America in winter. It is colloquially known as the little bluebill or broadbill because of its distinctive blue bill. The origin of the name scaup may stem from the bird's preference for feeding on scalp—the Scottish word for clams, oysters, and mussels; however, some credit it to the female's discordant scaup call as the name's source.[2] It is apparently a very close relative of the Holarctic greater scaup or "bluebill" (A. marila), with which it forms a superspecies.[3][4]

Description[edit]

Adults are 38–48 cm (15–19 in) long, 41.7–43 cm (16.4–16.9 in) on average. The species can weigh 454–1,089 g (1.001–2.401 lb); males weigh 820 g (1.81 lb) on average and weigh noticeably less, at 730 g (1.61 lb) on average.[5] Wing lengths (not wingspans) are about 7.5–7.9 in (19–20 cm) in males and 7.3–7.8 in (19–20 cm) in females; the tarsus is about 1.4–1.5 in (3.6–3.8 cm) long, and the bill 1.4–1.7 in (3.6–4.3 cm).[2][3][6][7] The wingspan is 68–78 cm (27–31 in).[5]

The adult males (drakes) in alternate plumage have a black, effervescent head and a small tuft at the hindcrown, a black breast, a whitish-grey back and wings with darker vermiculations and black outer and greyish-brown inner primary remiges. The underparts are white with some olive vermiculations on the flanks, and the rectrices and tail coverts are black. Adult females (hens) have a white band at the base of the bill, often a lighter ear region, and are otherwise dark brown all over, shading to white on the mid-belly. Drakes in eclipse plumage look similar, but with a very dark head and breast, little or no white on the head and usually some greyish vermiculations on the wings. Immature birds resemble the adult females, but are duller and have hardly any white at the bill base. Both sexes have white secondary remiges, a blue-grey bill with a black "nail" at the tip and grey feet; the drakes have a bright yellow iris, while that of females is orange or amber and that of immatures is brown. Downy hatchlings look much like those of related species, with dark brown upperparts and pale buff underparts, chin, supercilium and back spots.[2][3][6][7]

These birds are not very vocal, at least compared to dabbling ducks. Hens give the namesake discordant scaup, scaup call; in courtship drakes produce weak whistles. Hens vocalize more often than those of the greater scaup—particularly during flight—but their call is weaker, a guttural brrtt, brrtt.[2][6][7]

Identification[edit]

Lesser scaup are often hard to distinguish from the greater scaup when direct comparison is not possible, but in North America a large scaup flock will often have both species present. Females, juveniles and drakes in eclipse plumage are hard to identify; there is considerable overlap in length between the two species, but greater scaup are usually noticeably more bulky. Lesser scaup females and immatures tend to have less white around the bill, but this too varies considerably between individual birds. The bill may give a hint; in the lesser scaup it has a stronger curve on the upperside than in the greater, resulting in a distal part that looks somewhat flattened and wide in the lesser scaup—hence the vernacular name "broadbill". If the birds fly, the most tell-tale sign is the white secondary remiges, whereas in the greater scaup the white extends on the primary remiges also, i.e. far towards the wingtip.[2][3][6][7]

Drake of the ring-necked duck (A. collaris) in alternate plumage. Note black wings.

lesser scaup females show the characteristic darker iris (bright yellow in greater scaup males and females) at closer distances. Lesser scaup drakes in nuptial plumage are often said to be recognizable by the purple instead of green sheen of the head and a darker back. But this is unreliable because it varies according to light conditions, and these birds are often too far away from the observer to make out any sheen at all. The best trait—if the primary remiges are not visible—is the shape of the head: in the greater scaup drake, the forehead is usually quite massive, whereas the nape presents a smooth shallow curve and may appear almost straightly sloping. The lesser scaup drake presents the opposite shape, with a less bulging forehead and a nape that looks strongly curved or even angular due to the small crest. When the birds raise their heads, these differences are most easy to spot, and after observing the two species in direct comparison it usually becomes easy to recognize. In fact, in alternate plumage the lesser scaup drake may appear identical in shape and size to a drake of the ring-necked duck (A. collaris); the black back and wings of that species are hard to confuse with the light ones of the lesser scaup male though.[2][3][6][7]

Hybridization[edit]

Particularly in the case of vagrant birds in Europe, the identification is complicated by similar-looking Aythya hybrids. Except for hybrids between the two scaup species, the most reliable mark is the black bill-tip of hybrids, whereas in the scaups only the very point ("nail") of the bill is black. This is even recognizable at considerable range, as the scaups' bills appear uniformly grey from a distance, whereas those of hybrids look two-colored. European hybrids typically involve the tufted duck (A. fuligula), yielding offspring that have a small nape crest unlike any European Aythya species. Female and immature hybrids typically lack the white bill base, except in those between lesser scaup and ring-necked duck, where the white extends to the eye region. But especially with juveniles, the bi-colored bill of hybrids is most diagnostic. Hybrid combinations that are known from the wild and resemble the lesser scaup are:

  • The occurrence of hybridization between lesser and sreater scaup in the wild is disputed. Such hybrids could only be identified with certainty by DNA sequence comparison however. But while they may exist unnoticed, they cannot be frequent, as the species are largely sympatric and closely related, yet remain distinct, with no signs of significant introgression.
  • Hybrids between lesser scaup and ring-necked ducks are recognizable by very dark wings contrasting with a light grey underside more than in the lesser scaup but less than in the ring-necked duck.
  • Hybrids between the lesser scaup and the redhead (A. americana) are recognizable by the lack of contrast between wings and belly and the dull brownish head.
  • Hybrids between the tufted duck and the common pochard (A. ferina) are almost indistinguishable from lesser scaup, though neither parent species resembles A. affinis.

In theory, each and every Aythya species is able to produce potentially fertile hybrids with any other, though due to their different ranges and behavioral cues given during courtship most of these hybrids are only known from birds kept in captivity without conspecific mates.[3][6]

Distribution and migration[edit]

Their breeding habitat is inland lakes and marsh ponds in tundra from Alaska through western Canada to western Montana; few breed east of James Bay and the Great Lakes. Notable breeding concentrations, with more than half a million birds at the height of the season, can be found in Alaska, in the woodlands of the McKenzie River valley and on the Old Crow Flats. These birds migrate south (mostly via the Central and Mississippi Flyways) when the young are fledged and return in early spring, usually arriving on the breeding ground in May. Lesser scaup typically travel in flocks of 25–50 birds and winter mainly on lakes, rivers and sheltered coastal lagoons and bays between the US–Canadian border and northern Colombia, including Central America, the West Indies and Bermuda. Wintering lesser scaup are typically found in freshwater or slightly brackish habitat and unlike greater scaup rarely are seen offshore when unfrozen freshwater habitat is available. They may even spend the winter on lakes in parks, as long as they are not harassed, and will occur even on smallish Caribbean islands such as Grand Cayman. Thousands winter each year on the Topolobampo lagoons in Mexico, and even in the southernmost major wintering location—Ciénaga Grande de Santa Marta in Colombia—hundreds of birds can be seen. In Central America, flocks are present from July on, but only really numerous after September. They move north again in April and May. In the extreme southeast and southwest of the breeding range—the Rocky Mountains region of the northwestern USA and the southern Great Lakes—lesser scaup are present all-year; it is not clear whether the breeding birds are replaced by migrants from the far north in winter, or whether the local populations do not migrate, or whether both local and migrant birds are found there in winter.[2][3][6][7][8][9]

They are rarely—but apparently increasingly often—seen as vagrants in western Europe. The first documented British record was a first-winter male at Chasewater, Staffordshire in 1987[10] but by 2006, over 60 had been recorded, with an average of 2 per year. UK records are typically in the northern parts of the country. Vagrant lesser scaup have also been recorded on the Hawaiian Islands Japan, possibly China, and—for the first time on 18 January 2000—in the Marianas, as well as in Ecuador, Surinam, Trinidad and Venezuela (in winter), and Greenland (in summer).[2][3][6][11][12]

Ecology[edit]

Lesser scaup forage mainly by sifting through the bottom mud, usually after diving and swimming underwater, occasionally by dabbling without diving. They mainly eat mollusks such as mussels and clams, as well as seeds and other parts of aquatic plants like sedges and bulrushes (Cyperaceae), "pondweeds", widgeon-grass (Ruppia cirrhosa), wild celery (Vallisneria americana) or wild rice (Zizania). In winter, but less so in summer, other aquatic animals—crustacean, insect and their larvae and small fishes—form an important part of their diet. It has been reported that both the lesser and the greater scaup have shifted their traditional migration routes to take advantage of the presence of the zebra mussel (Dreissena polymorpha) in Lake Erie, which was accidentally introduced in the 1980s and has multiplied enormously. This may pose a risk to these birds because zebra mussels are efficient filter feeders and so accumulate environmental contaminants rapidly.[2][3][7][13]

They nest in a sheltered location on the ground near water, usually among thick vegetation such as sedges and bulrushes, sometimes in small loose groups and not rarely next to colonies of gulls or terns; several females may deposit eggs in a single nest. The drakes court the hens in the winter quarters; pairs form shortly before and during the spring migration. When nesting starts, the males aggregate while they moult into eclipse plumage, leaving the task of incubation and raising the young to the females alone.[6]

The nest is a shallow depression scraped in the ground and lined with plants and some down feathers. Breeding begins in May, but most birds nest only in June, later than usual for North American waterfowl. The clutch numbers about 9–11 eggs on average; up to 26 eggs have been found in a single nest, but such high numbers are from more than one female. Incubation is by the female only and lasts around 3 weeks. The young fledge some 45–50 days after hatching and soon thereafter the birds migrate to winter quarters already. Lesser scaup become sexually mature in their first or second summer. The oldest known individual reached an age of over 18 years.[3][14]

Before the start of the population decline (see below), about 57% of the lesser scaup nests failed each breeding season because the female was killed or the eggs were eaten or destroyed. The average brood size of nests where eggs hatched successfully was 8.33 hatchlings.[3]

Conservation status[edit]

Although the lesser scaup has the largest population of any species of diving duck in North America, their population has been steadily declining since the mid-1980s, and reached an all-time low in the early 20th century. During breeding bird surveys, lesser and greater scaup are counted together due to the impossibility of identifying the species unequivocally when large numbers of birds are involved. Lesser scaup are thought to comprise slightly less than nine-tenths of the scaup population of North America. In the 1970s, the lesser scaup population was estimated at 6.9 million birds on average; in the 1990s it had declined to about half that number, and by the late 2000s it is estimated at 3 million individuals or less. Due to the wide breeding range and the fact that the rate of decline, though remarkable, is still not threatening in respect to the enormous overall numbers, the lesser scaup is classified as a Species of Least Concern by the IUCN. An increase of the decline is liable to result in an uplisting to Near Threatened or even Vulnerable status.[1][2][3][7]

The causes for this stark—though not threatening yet—decline remain unknown. There are indications that the breeding success is decreasing, but why this is so remains puzzling. On one hand, pollution and habitat destruction, especially in the wintering regions, has certainly increased since the early-mid 20th century. On the other hand, the narrow time frame in which lesser scaup breed and raise their young may be tied to some specific ecological conditions—such as abundance of key food items—which shifted winterwards due to global warming, without the ducks being able to adapt. In this regard, it is alternatively or additionally possible that greater scaup, which may be increasing in numbers, is putting the lesser scaup under increasingly severe competition.[2]

However, it seems that greater scaup eats larger food items on average,[13] and the species are sympatric in part of their range and presumably have been for millennium without any problems due to competition. The experience of the past as well as the reproduction rate—even if this is declining—suggests that hunting has no major impact on lesser scaup populations at present either. Also, the breeding habitat is mainly in regions little-used by humans; habitat destruction on the breeding grounds is also not considered to be problematic. [3]

References[edit]

  1. ^ a b BirdLife International (2012). "Aythya affinis". IUCN Red List of Threatened Species. Version 2013.2. International Union for Conservation of Nature. Retrieved 26 November 2013. 
  2. ^ a b c d e f g h i j k Lesser scaup. Ducks Unlimited
  3. ^ a b c d e f g h i j k l m Carboneras, Carles (1992): 121. Lesser Scaup. In: del Hoyo, Josep; Elliott, Andrew & Sargatal, Jordi (eds.): Handbook of Birds of the World (Vol. 1: Ostrich to Ducks): 618-619, plate 48. Lynx Edicions, Barcelona. ISBN 84-87334-10-5
  4. ^ Livezey, Brad C. (1998). "A phylogenetic analysis of modern pochards (Anatidae: Aythyini)". Auk 113 (1): 74–93. doi:10.2307/4088937. 
  5. ^ a b Lesser Scaup. The Cornell Lab of Ornithology. allaboutbirds.org
  6. ^ a b c d e f g h i Madge, Steve & Burn, Hilary (1987): Wildfowl: an identification guide to the ducks, geese and swans of the world. Christopher Helm, London. ISBN 0-7470-2201-1
  7. ^ a b c d e f g h Duck of the Month – Lesser Scaup. Ducks Unlimited
  8. ^ Olson, Storrs L.; James, Helen F. & Meister, Charles A. (1981). "Winter field notes and specimen weights of Cayman Island Birds". Bull. B.O.C. 101 (3): 339–346. 
  9. ^ Herrera, Néstor; Rivera, Roberto; Ibarra Portillo, Ricardo & Rodríguez, Wilfredo (2006). "Nuevos registros para la avifauna de El Salvador" [New records for the avifauna of El Salvador]. Boletín de la Sociedad Antioqueña de Ornitología (in Spanish with English abstract) 16 (2): 1–19. 
  10. ^ Evans, Graham (1987). "Britain's first Lesser Scaup". Twitching 1 (3): 65–66. Archived from the original on 5 August 2012. 
  11. ^ Wiles, Gary J.; Johnson, Nathan C.; de Cruz, Justine B.; Dutson, Guy; Camacho, Vicente A.; Kepler, Angela Kay; Vice, Daniel S.; Garrett, Kimball L.; Kessler, Curt C. & Pratt, H. Douglas (2004). "New and Noteworthy Bird Records for Micronesia, 1986–2003". Micronesica 37 (1): 69–96. 
  12. ^ Lesser Scaup ‘’Aythya affinis’’ (Eyton, 1838). British Trust for Ornithology
  13. ^ a b Custer, Christine M. & Custer, Thomas W. (1996). "Food habits of diving ducks in the Great Lakes after the zebra mussel invasion". Journal of Field Ornithology 67 (1): 86–99. 
  14. ^ Aythya affinis life history data. genomics.senescence.info

Further reading[edit]

Creative Commons Attribution Share Alike 3.0 (CC BY-SA 3.0)

Source: Wikipedia

Unreviewed

Article rating from 0 people

Default rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!