Articles on this page are available in 2 other languages: Chinese (Simplified) (7), Dutch (1) (learn more)

Overview

Brief Summary

Aythya marila

When floating far out on the water, it can be difficult to separate the Greater Scaup (18 inches) from its relative, the Lesser Scaup (Aythya affinis) (16 1/2 inches). Males of both species are medium-sized ducks with dark heads and chests, light backs and flanks, and dark tails. A closer look reveals that the Greater Scaup has a flat-topped, green-tinged head and white flanks (as opposed to the Lesser Scaup, which has a peaked, purple-tinged head and light gray flanks). The females of both species (both dark brown) are also difficult to separate, although the female Greater Scaup tends to be slightly lighter brown than the female of the other species. Both species also have blue bills, earning them the nickname “bluebill” with duck hunters. The Greater Scaup is found across much of the Northern Hemisphere. In North America, the Greater Scaup primarily breeds in western Alaska, in northeastern Canada, and along the Hudson Bay. Greater Scaups migrate south in winter, when they may be found along the Pacific coast from Alaska to Baja California, on the Atlantic coast from Newfoundland to Florida, on the northern Gulf coast, and in the Great Lakes. The Greater Scaup is more of a coastal bird than the Lesser Scaup in winter, but may be found inland on migration. In the Old World, this species breeds in Iceland, Scandinavia, and Russia, wintering south along the coast to the Mediterranean Sea, the Persian Gulf, and coastal China. Greater Scaups breed on freshwater wetlands with marsh grasses. In winter, they may be found in large numbers in offshore waters and in large bays. Although they may also be found in saltwater in winter, Lesser Scaup are somewhat less likely to be seen on the open ocean than Greater Scaup. This species’ diet primarily consists of invertebrates, such as crustaceans, mollusks, and insects when available. One of several species of “diving ducks” in North America, Greater Scaups may be observed submerging themselves to feed on invertebrates in the water or on the bottom. In winter, they may also be observed in flocks of many hundreds or thousands of birds offshore. This species is primarily active during the day.

Threat Status: Least Concern

  • Aythya marila. Xeno-canto. Xeno-canto Foundation, n.d. Web. 20 July 2012. .
  • Greater Scaup (Aythya marila). The Internet Bird Collection. Lynx Edicions, n.d. Web. 20 July 2012. .
  • Kessel, Brina, Deborah A. Rocque and John S. Barclay. 2002. Greater Scaup (Aythya marila), The Birds of North America Online (A. Poole, Ed.). Ithaca: Cornell Lab of Ornithology; Retrieved from the Birds of North America Online: http://bna.birds.cornell.edu/bna/species/650
  • Peterson, Roger Tory. Birds of Eastern and Central North America. Boston: Houghton Mifflin, 1980. Print.
  • Sibley, Daid Allen. The Sibley Guide to Birds, 2nd Edition. New York: Alfred A, Knopf, 2014. Print.
  • eBird Range Map - Greater Scaup. eBird. Cornell Lab of Ornithology, N.d. Web. 20 July 2012. .
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Smithsonian Institution

Supplier: DC Birds

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Greater scaups are small diving ducks, also known as bluebills. They look a lot like tufted ducks, but don't have a tuft and their back is gray instead of black. During the winter, they are found in both salt and fresh waters, such as the Wadden Sea and the IJsselmeer. Chances are good that you find them swimming in large groups. Unless the IJsselmeer freezes, they all move to the Wadden Sea.
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© Copyright Ecomare

Source: Ecomare

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Distribution

Range Description

Summer breeding grounds of the Greater Scaup range across the northern limits of Europe (including Iceland) and Asia, through the Aleutian Islands (year-round breeding) to Alaska (USA), and across to the Atlantic coast of Canada (del Hoyo et al. 1992). It winters further south, reaching California, the great lakes and northern Florida in North America, the Adriatic Sea and northern Black Sea in Europe, the western Caspian Sea, and on the Pacific coast of Asia as far as south-east China (del Hoyo et al. 1992).

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

North America; Oceania; Northern Labrador to Gulf of Mexico
  • North-West Atlantic Ocean species (NWARMS)
translation missing: en.license_cc_by_4_0

© WoRMS Editorial Board

Source: World Register of Marine Species

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

North America; Oceania; Northern Labrador to Gulf of Mexico
translation missing: en.license_cc_by_4_0

© WoRMS for SMEBD

Source: World Register of Marine Species

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

occurs (regularly, as a native taxon) in multiple nations

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

National Distribution

Canada

Origin: Native

Regularity: Regularly occurring

Currently: Present

Confidence: Confident

Type of Residency: Year-round

United States

Origin: Native

Regularity: Regularly occurring

Currently: Present

Confidence: Confident

Type of Residency: Year-round

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Global Range: (>2,500,000 square km (greater than 1,000,000 square miles)) Holarctic. BREEDS: in Northern America, northern Alaska east across Canada to Hudson Bay, central Quebec, and New Brunswick (McAlpine et al. 1988), south to northwestern British Columbia, southeastern Michigan. WINTERS: southeastern Alaska south to Baja California; from eastern Great Lakes area and Canadian Maritime Provinces to southern Florida and Gulf Coast; casual in Hawaii. Primary wintering areas include the coastal Pacific Northwest, southern and eastern Great Lakes, and Atlantic coast centering around Long Island Sound (Root 1988).

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Physical Description

Size

Length: 46 cm

Weight: 957 grams

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Ecology

Habitat

Habitat and Ecology

Habitat and Ecology
Behaviour This species is fully migratory (del Hoyo et al. 1992). It breeds in the high Arctic from late-May or early-June (depending on the timing of the Arctic thaw) (Kear 2005b) in single pairs or loose groups (del Hoyo et al. 1992), often with colonies of nesting gulls or terns (Kear 2005b) although it is not itself a colonial species (Snow and Perrins 1998). Males undergo short post-breeding moult migrations (Madge and Burn 1988, Scott and Rose 1996), often gathering in small or large flocks (up to 4,000 in Iceland) (Scott and Rose 1996) while females are incubating (Madge and Burn 1988). Females usually moult on the breeding grounds (Madge and Burn 1988, Scott and Rose 1996), although large concentrations (500-1,000 individuals) of moulting females have been recorded away from breeding areas (Scott and Rose 1996). During the moulting period the species is flightless for a period of c.3-4 weeks (Scott and Rose 1996). The autumn migration begins after the moulting period in mid-August (Scott and Rose 1996), with males tending to remain much further north than females or immatures (del Hoyo et al. 1992) leading to some sexual segregation during the winter ( Madge and Burn 1988). The species is highly gregarious outside of the breeding season (Kear 2005b) and is commonly observed in small or large flocks ( Madge and Burn 1988) sometimes of several thousand individuals (Scott and Rose 1996). The return spring migration generally begins in late-February (Scott and Rose 1996) although flocks of non-breeders may remain in the south, often in winter quarters, during the breeding season (Madge and Burn 1988). Habitat Breeding The species breeds in tundra (Kear 2005b), wooded tundra (Scott and Rose 1996) and moorland regions (Kear 2005b) in the high Arctic (del Hoyo et al. 1992), occupying small, shallow (del Hoyo et al. 1992), freshwater lakes, pools and rivers (Kear 2005b) with grassy shorelines and high densities of invertebrate life (Johnsgard 1978). It shows a preference for water less than 6 m deep (usually 2 m) for diving (Kear 2005b). Non-breeding The species winters on shallow coastal waters (del Hoyo et al. 1992, Kear 2005b) less than 10 m deep (Scott and Rose 1996) (especially in the vicinity of sewage outlets) (del Hoyo et al. 1992), as well as sheltered bays (del Hoyo et al. 1992), estuaries (del Hoyo et al. 1992, Kear 2005b) and brackish coastal lagoons (del Hoyo et al. 1992). It is also found inland on large lakes (Johnsgard 1978, del Hoyo et al. 1992, Kear 2005b) and reservoirs during this season (Madge and Burn 1988). Diet The species is omnivorous (Kear 2005b), its diet consisting predominantly of molluscs (e.g. mussels [Kear 2005b]Mytilus spp. [del Hoyo et al. 1992], cockles Cardium spp. and clams Macoma spp. in coastal habitats, and Hydrobia spp. in brackish habitats [Kear 2005b]) especially during the winter (Johnsgard 1978), as well as insects (del Hoyo et al. 1992), aquatic insect larvae (Johnsgard 1978), crustaceans (del Hoyo et al. 1992) (e.g. amphipods [Johnsgard 1978]), worms, small fish (del Hoyo et al. 1992), and the roots, seeds and vegetative parts of aquatic plants such as sedges (del Hoyo et al. 1992) (Kear 2005b) and water weeds (Kear 2005b). Breeding The nest is a shallow depression close to water (Madge and Burn 1988) on the ground (del Hoyo et al. 1992), either in thick vegetation (del Hoyo et al. 1992) (Kear 2005b), in cracks in rocks, under woody shrubs or under perennial herbaceous vegetation less than 50 cm high (Iceland) (Johnsgard 1978). The species is not colonial but it will sometimes nest among gulls and terns (Kear 2005b), with neighbouring nests being placed as close as 1 m in some areas (Snow and Perrins 1998). In Scotland, UK the introduction of a sewage treatment scheme in the Firth of Forth (a large marine bay) resulted in a considerable reduction in the abundance of the species, with feeding flocks only remaining at outfalls where sewage continued to be discharged in large quantities (Campbell 1984). It was unclear whether the changes in the species's distribution were due to reductions in the number of food items borne in the sewage or to reductions in aquatic invertebrate abundance as a result of the new treatment system (Campbell 1984).


Systems
  • Terrestrial
  • Freshwater
  • Marine
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Depth range based on 300 specimens in 1 taxon.
Water temperature and chemistry ranges based on 1 sample.

Environmental ranges
  Depth range (m): 0 - 0
  Temperature range (°C): 7.367 - 7.367
  Nitrate (umol/L): 3.963 - 3.963
  Salinity (PPS): 31.835 - 31.835
  Oxygen (ml/l): 7.040 - 7.040
  Phosphate (umol/l): 0.635 - 0.635
  Silicate (umol/l): 3.312 - 3.312
 
Note: this information has not been validated. Check this *note*. Your feedback is most welcome.
All rights reserved

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Depth range based on 1 specimen in 1 taxon.

Environmental ranges
  Depth range (m): 0 - 0
 
Note: this information has not been validated. Check this *note*. Your feedback is most welcome.
All rights reserved

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Comments: In migration and winter, found in bays, estuaries, and large open inland lakes and rivers.

Breeds near shores of ponds and lakes, in marshes, or on islands, primarily in forested tundra and northern borders of the taiga; among grass or shrubs, or under spruce boughs. The nest is a hollow lined with plant material, down and feathers.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Depth range based on 300 specimens in 1 taxon.
Water temperature and chemistry ranges based on 1 sample.

Environmental ranges
  Depth range (m): 0 - 0
  Temperature range (°C): 7.367 - 7.367
  Nitrate (umol/L): 3.963 - 3.963
  Salinity (PPS): 31.835 - 31.835
  Oxygen (ml/l): 7.040 - 7.040
  Phosphate (umol/l): 0.635 - 0.635
  Silicate (umol/l): 3.312 - 3.312
 
Note: this information has not been validated. Check this *note*. Your feedback is most welcome.

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Depth range based on 1 specimen in 1 taxon.

Environmental ranges
  Depth range (m): 0 - 0
 
Note: this information has not been validated. Check this *note*. Your feedback is most welcome.

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Migration

Non-Migrant: No. All populations of this species make significant seasonal migrations.

Locally Migrant: No. No populations of this species make local extended movements (generally less than 200 km) at particular times of the year (e.g., to breeding or wintering grounds, to hibernation sites).

Locally Migrant: Yes. At least some populations of this species make annual migrations of over 200 km.

Migrates northward in spring, usually arriving on breeding grounds in April-May (late May-early June in far north). Departs far north by end of September, southward migration through U.S. occurs mostly in October-November (Terres 1980). Scaup that breed in northern Alaska, northern Yukon, and Mackenzie Delta winter on the Atlantic and Gulf coasts of the southeastern U.S. (Johnson and Herter 1989). See Johnson and Herter 1989 for information on early summer molt migration in northern Alaska and northwestern Canada.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Trophic Strategy

Comments: Feeds on aquatic plants and animals. Coastally mollusks (clams, scallops, mussels, etc.) comprise a significant portion of the diet. In other areas eats seeds, leaves, stems of plants (sedges, pondweeds, muskgrass, wild celery, etc.).

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

General Ecology

May gather in winter flocks of up to 50,000 individuals.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Life History and Behavior

Life Expectancy

Lifespan, longevity, and ageing

Maximum longevity: 22.1 years (wild) Observations: Oldest banded bird was 22.1 years (http://bna.birds.cornell.edu/).
Creative Commons Attribution 3.0 (CC BY 3.0)

© Joao Pedro de Magalhaes

Source: AnAge

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Reproduction

Clutch size averages about 8-9. Incubation: 23-27 days, by female. Males usually abandon females in early incubation. Young are tended by female, fledge in 9-10 weeks. May nest in colonies of 50+ pairs.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Barcode data: Aythya marila

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There are 16 barcode sequences available from BOLD and GenBank.

Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.

See the BOLD taxonomy browser for more complete information about this specimen and other sequences.

GTGACCTTCATCAATCGATGATTATTCTCTACCAATCACAAAGACATCGGTACCTTATATCTTATCTTCGGGGCATGAGCCGGAATAATCGGCACAGCACTCAGCCTGCTAATCCGCGCAGAACTAGGCCAACCAGGAACCCTCCTAGGTGATGACCAGATTTACAACGTAATCGTCACCGCCCACGCCTTTGTAATAATCTTCTTCATAGTGATGCCCATCATAATCGGAGGGTTTGGCAACTGATTAGTCCCCCTAATAATCGGCGCCCCCGACATAGCATTCCCACGAATAAACAACATAAGCTTCTGGCTCCTCCCACCCTCATTCCTCCTCCTACTCGCCTCATCCACCGTAGAAGCTGGCGCCGGCACAGGCTGAACCGTGTACCCACCTCTAGCAGGCAACCTAGCTCACGCTGGAGCCTCAGTAGACCTGGCCATTTTCTCGCTCCACTTAGCCGGTGTTTCCTCTATTCTCGGAGCCATTAACTTCATCACCACAGCCATCAACATAAAACCCCCCGCACTCTCACAATACCAGACCCCACTCTTTGTCTGATCCGTCCTAATCACCGCTATTCTGCTCCTCCTATCACTACCCGTCCTCGCCGCTGGCATCACAATACTACTAACCGACCGAAACCTAAACACCACATTCTTTGACCCCGCCGGAGGAGGCGACCCAATCCTGTACCAACACCTATTCTGATTCTTCGGCCATCCGGAAGTCTACATCTTAATCCTC
-- end --

Download FASTA File

Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Statistics of barcoding coverage: Aythya marila

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 16
Specimens with Barcodes: 18
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Conservation

Conservation Status

IUCN Red List Assessment


Red List Category
LC
Least Concern

Red List Criteria

Version
3.1

Year Assessed
2012

Assessor/s
BirdLife International

Reviewer/s
Butchart, S. & Symes, A.

Contributor/s
McCoy, T., Burfield, I., Ellermaa, M., Kontiokorpi, J., Kharitonov, S., Lehikoinen, A., Bianki, V., Kharitonova, I., Barclay, J., Lehikoinen, E., Szymanski, M. & DeVink, J.

Justification
This species has an extremely large range, and hence does not approach the thresholds for Vulnerable under the range size criterion (Extent of Occurrence <20,000 km2 combined with a declining or fluctuating range size, habitat extent/quality, or population size and a small number of locations or severe fragmentation). Although the population may be decreasing, the decline is not believed to be sufficiently rapid to approach the thresholds for Vulnerable under the population trend criterion (>30% decline over ten years or three generations). The population size is extremely large, and hence does not approach the thresholds for Vulnerable under the population size criterion (<10,000 mature individuals with a continuing decline estimated to be >10% in ten years or three generations, or with a specified population structure). For these reasons the species is evaluated as Least Concern.

History
  • Least Concern (LC)
  • Least Concern (LC)
  • Least Concern (LC)
  • Lower Risk/least concern (LR/lc)
  • Lower Risk/least concern (LR/lc)
  • Lower Risk/least concern (LR/lc)
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5