Articles on this page are available in 2 other languages: Chinese (Simplified) (7), Dutch (1) (learn more)

Overview

Brief Summary

Greater scaups are small diving ducks, also known as bluebills. They look a lot like tufted ducks, but don't have a tuft and their back is gray instead of black. During the winter, they are found in both salt and fresh waters, such as the Wadden Sea and the IJsselmeer. Chances are good that you find them swimming in large groups. Unless the IJsselmeer freezes, they all move to the Wadden Sea.
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© Copyright Ecomare

Source: Ecomare

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Aythya marila

When floating far out on the water, it can be difficult to separate the Greater Scaup from its relative, the Lesser Scaup (Aythya affinis). Males of both species are medium-sized ducks with dark heads and chests, light backs and flanks, and dark tails. A closer look reveals that the Greater Scaup has a flat-topped, green-tinged head and white flanks (as opposed to the Lesser Scaup, which has a peaked, purple-tinged head and light gray flanks). The females of both species (both dark brown) are also difficult to separate, although the female Greater Scaup tends to be slightly lighter brown than the female of the other species. Both species also have blue bills, earning them the nickname “bluebill” with duck hunters. The Greater Scaup is found across much of the Northern Hemisphere. In North America, the Greater Scaup primarily breeds in western Alaska, in northeastern Canada, and along the Hudson Bay. Greater Scaups migrate south in winter, when they may be found along the Pacific coast from Alaska to Baja California, on the Atlantic coast from Newfoundland to Florida, on the northern Gulf coast, and in the Great Lakes. The Greater Scaup is more of a coastal bird than the Lesser Scaup in winter, but may be found inland on migration. In the Old World, this species breeds in Iceland, Scandinavia, and Russia, wintering south along the coast to the Mediterranean Sea, the Persian Gulf, and coastal China. Greater Scaups breed on freshwater wetlands with marsh grasses. In winter, they may be found in large numbers in offshore waters and in large bays. Although they may also be found in saltwater in winter, Lesser Scaup are somewhat less likely to be seen on the open ocean than Greater Scaup. This species’ diet primarily consists of invertebrates, such as crustaceans, mollusks, and insects when available. One of several species of “diving ducks” in North America, Greater Scaups may be observed submerging themselves to feed on invertebrates in the water or on the bottom. In winter, they may also be observed in flocks of many hundreds or thousands of birds offshore. This species is primarily active during the day.

Threat Status: Least concern

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Unknown

Supplier: DC Birds

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Distribution

occurs (regularly, as a native taxon) in multiple nations

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

National Distribution

Canada

Origin: Native

Regularity: Regularly occurring

Currently: Present

Confidence: Confident

Type of Residency: Year-round

United States

Origin: Native

Regularity: Regularly occurring

Currently: Present

Confidence: Confident

Type of Residency: Year-round

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Global Range: (>2,500,000 square km (greater than 1,000,000 square miles)) Holarctic. BREEDS: in Northern America, northern Alaska east across Canada to Hudson Bay, central Quebec, and New Brunswick (McAlpine et al. 1988), south to northwestern British Columbia, southeastern Michigan. WINTERS: southeastern Alaska south to Baja California; from eastern Great Lakes area and Canadian Maritime Provinces to southern Florida and Gulf Coast; casual in Hawaii. Primary wintering areas include the coastal Pacific Northwest, southern and eastern Great Lakes, and Atlantic coast centering around Long Island Sound (Root 1988).

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

North America; Oceania; Northern Labrador to Gulf of Mexico
  • North-West Atlantic Ocean species (NWARMS)
Creative Commons Attribution 3.0 (CC BY 3.0)

© WoRMS for SMEBD

Source: World Register of Marine Species

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Range Description

Summer breeding grounds of the Greater Scaup range across the northern limits of Europe (including Iceland) and Asia, through the Aleutian Islands (year-round breeding) to Alaska (USA), and across to the Atlantic coast of Canada (del Hoyo et al. 1992). It winters further south, reaching California, the great lakes and northern Florida in North America, the Adriatic Sea and northern Black Sea in Europe, the western Caspian Sea, and on the Pacific coast of Asia as far as south-east China (del Hoyo et al. 1992).

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Physical Description

Size

Length: 46 cm

Weight: 957 grams

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Ecology

Habitat

Comments: In migration and winter, found in bays, estuaries, and large open inland lakes and rivers.

Breeds near shores of ponds and lakes, in marshes, or on islands, primarily in forested tundra and northern borders of the taiga; among grass or shrubs, or under spruce boughs. The nest is a hollow lined with plant material, down and feathers.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Habitat and Ecology

Habitat and Ecology
Behaviour This species is fully migratory (del Hoyo et al. 1992). It breeds in the high Arctic from late-May or early-June (depending on the timing of the Arctic thaw) (Kear 2005b) in single pairs or loose groups (del Hoyo et al. 1992), often with colonies of nesting gulls or terns (Kear 2005b) although it is not itself a colonial species (Snow and Perrins 1998). Males undergo short post-breeding moult migrations (Madge and Burn 1988, Scott and Rose 1996), often gathering in small or large flocks (up to 4,000 in Iceland) (Scott and Rose 1996) while females are incubating (Madge and Burn 1988). Females usually moult on the breeding grounds (Madge and Burn 1988, Scott and Rose 1996), although large concentrations (500-1,000 individuals) of moulting females have been recorded away from breeding areas (Scott and Rose 1996). During the moulting period the species is flightless for a period of c.3-4 weeks (Scott and Rose 1996). The autumn migration begins after the moulting period in mid-August (Scott and Rose 1996), with males tending to remain much further north than females or immatures (del Hoyo et al. 1992) leading to some sexual segregation during the winter ( Madge and Burn 1988). The species is highly gregarious outside of the breeding season (Kear 2005b) and is commonly observed in small or large flocks ( Madge and Burn 1988) sometimes of several thousand individuals (Scott and Rose 1996). The return spring migration generally begins in late-February (Scott and Rose 1996) although flocks of non-breeders may remain in the south, often in winter quarters, during the breeding season (Madge and Burn 1988). Habitat Breeding The species breeds in tundra (Kear 2005b), wooded tundra (Scott and Rose 1996) and moorland regions (Kear 2005b) in the high Arctic (del Hoyo et al. 1992), occupying small, shallow (del Hoyo et al. 1992), freshwater lakes, pools and rivers (Kear 2005b) with grassy shorelines and high densities of invertebrate life (Johnsgard 1978). It shows a preference for water less than 6 m deep (usually 2 m) for diving (Kear 2005b). Non-breeding The species winters on shallow coastal waters (del Hoyo et al. 1992, Kear 2005b) less than 10 m deep (Scott and Rose 1996) (especially in the vicinity of sewage outlets) (del Hoyo et al. 1992), as well as sheltered bays (del Hoyo et al. 1992), estuaries (del Hoyo et al. 1992, Kear 2005b) and brackish coastal lagoons (del Hoyo et al. 1992). It is also found inland on large lakes (Johnsgard 1978, del Hoyo et al. 1992, Kear 2005b) and reservoirs during this season (Madge and Burn 1988). Diet The species is omnivorous (Kear 2005b), its diet consisting predominantly of molluscs (e.g. mussels [Kear 2005b] Mytilus spp. [del Hoyo et al. 1992], cockles Cardium spp. and clams Macoma spp. in coastal habitats, and Hydrobia spp. in brackish habitats [Kear 2005b]) especially during the winter (Johnsgard 1978), as well as insects (del Hoyo et al. 1992), aquatic insect larvae (Johnsgard 1978), crustaceans (del Hoyo et al. 1992) (e.g. amphipods [Johnsgard 1978]), worms, small fish (del Hoyo et al. 1992), and the roots, seeds and vegetative parts of aquatic plants such as sedges (del Hoyo et al. 1992) (Kear 2005b) and water weeds (Kear 2005b). Breeding The nest is a shallow depression close to water (Madge and Burn 1988) on the ground (del Hoyo et al. 1992), either in thick vegetation (del Hoyo et al. 1992) (Kear 2005b), in cracks in rocks, under woody shrubs or under perennial herbaceous vegetation less than 50 cm high (Iceland) (Johnsgard 1978). The species is not colonial but it will sometimes nest among gulls and terns (Kear 2005b), with neighbouring nests being placed as close as 1 m in some areas (Snow and Perrins 1998). In Scotland, UK the introduction of a sewage treatment scheme in the Firth of Forth (a large marine bay) resulted in a considerable reduction in the abundance of the species, with feeding flocks only remaining at outfalls where sewage continued to be discharged in large quantities (Campbell 1984). It was unclear whether the changes in the species's distribution were due to reductions in the number of food items borne in the sewage or to reductions in aquatic invertebrate abundance as a result of the new treatment system (Campbell 1984).


Systems
  • Terrestrial
  • Freshwater
  • Marine
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Depth range based on 300 specimens in 1 taxon.
Water temperature and chemistry ranges based on 1 sample.

Environmental ranges
  Depth range (m): 0 - 0
  Temperature range (°C): 7.367 - 7.367
  Nitrate (umol/L): 3.963 - 3.963
  Salinity (PPS): 31.835 - 31.835
  Oxygen (ml/l): 7.040 - 7.040
  Phosphate (umol/l): 0.635 - 0.635
  Silicate (umol/l): 3.312 - 3.312
 
Note: this information has not been validated. Check this *note*. Your feedback is most welcome.

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Migration

Non-Migrant: No. All populations of this species make significant seasonal migrations.

Locally Migrant: No. No populations of this species make local extended movements (generally less than 200 km) at particular times of the year (e.g., to breeding or wintering grounds, to hibernation sites).

Locally Migrant: Yes. At least some populations of this species make annual migrations of over 200 km.

Migrates northward in spring, usually arriving on breeding grounds in April-May (late May-early June in far north). Departs far north by end of September, southward migration through U.S. occurs mostly in October-November (Terres 1980). Scaup that breed in northern Alaska, northern Yukon, and Mackenzie Delta winter on the Atlantic and Gulf coasts of the southeastern U.S. (Johnson and Herter 1989). See Johnson and Herter 1989 for information on early summer molt migration in northern Alaska and northwestern Canada.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Trophic Strategy

Comments: Feeds on aquatic plants and animals. Coastally mollusks (clams, scallops, mussels, etc.) comprise a significant portion of the diet. In other areas eats seeds, leaves, stems of plants (sedges, pondweeds, muskgrass, wild celery, etc.).

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

General Ecology

May gather in winter flocks of up to 50,000 individuals.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Life History and Behavior

Life Expectancy

Lifespan, longevity, and ageing

Maximum longevity: 22.1 years (wild) Observations: Oldest banded bird was 22.1 years (http://bna.birds.cornell.edu/).
Creative Commons Attribution 3.0 (CC BY 3.0)

© Joao Pedro de Magalhaes

Source: AnAge

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Reproduction

Clutch size averages about 8-9. Incubation: 23-27 days, by female. Males usually abandon females in early incubation. Young are tended by female, fledge in 9-10 weeks. May nest in colonies of 50+ pairs.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Statistics of barcoding coverage: Aythya marila

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 16
Specimens with Barcodes: 18
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Barcode data: Aythya marila

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There are 16 barcode sequences available from BOLD and GenBank.  Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.  See the BOLD taxonomy browser for more complete information about this specimen and other sequences.

GTGACCTTCATCAATCGATGATTATTCTCTACCAATCACAAAGACATCGGTACCTTATATCTTATCTTCGGGGCATGAGCCGGAATAATCGGCACAGCACTCAGCCTGCTAATCCGCGCAGAACTAGGCCAACCAGGAACCCTCCTAGGTGATGACCAGATTTACAACGTAATCGTCACCGCCCACGCCTTTGTAATAATCTTCTTCATAGTGATGCCCATCATAATCGGAGGGTTTGGCAACTGATTAGTCCCCCTAATAATCGGCGCCCCCGACATAGCATTCCCACGAATAAACAACATAAGCTTCTGGCTCCTCCCACCCTCATTCCTCCTCCTACTCGCCTCATCCACCGTAGAAGCTGGCGCCGGCACAGGCTGAACCGTGTACCCACCTCTAGCAGGCAACCTAGCTCACGCTGGAGCCTCAGTAGACCTGGCCATTTTCTCGCTCCACTTAGCCGGTGTTTCCTCTATTCTCGGAGCCATTAACTTCATCACCACAGCCATCAACATAAAACCCCCCGCACTCTCACAATACCAGACCCCACTCTTTGTCTGATCCGTCCTAATCACCGCTATTCTGCTCCTCCTATCACTACCCGTCCTCGCCGCTGGCATCACAATACTACTAACCGACCGAAACCTAAACACCACATTCTTTGACCCCGCCGGAGGAGGCGACCCAATCCTGTACCAACACCTATTCTGATTCTTCGGCCATCCGGAAGTCTACATCTTAATCCTC
-- end --

Download FASTA File
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Conservation

Conservation Status

National NatureServe Conservation Status

Canada

Rounded National Status Rank: N5B,N5N : N5B: Secure - Breeding, N5N: Secure - Nonbreeding

United States

Rounded National Status Rank: N5B,N5N : N5B: Secure - Breeding, N5N: Secure - Nonbreeding

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

NatureServe Conservation Status

Rounded Global Status Rank: G5 - Secure

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

IUCN Red List Assessment


Red List Category
LC
Least Concern

Red List Criteria

Version
3.1

Year Assessed
2012

Assessor/s
BirdLife International

Reviewer/s
Butchart, S. & Symes, A.

Contributor/s
McCoy, T., Burfield, I., Ellermaa, M., Kontiokorpi, J., Kharitonov, S., Lehikoinen, A., Bianki, V., Kharitonova, I., Barclay, J., Lehikoinen, E., Szymanski, M. & DeVink, J.

Justification
This species has an extremely large range, and hence does not approach the thresholds for Vulnerable under the range size criterion (Extent of Occurrence <20,000 km2 combined with a declining or fluctuating range size, habitat extent/quality, or population size and a small number of locations or severe fragmentation). Although the population may be decreasing, the decline is not believed to be sufficiently rapid to approach the thresholds for Vulnerable under the population trend criterion (>30% decline over ten years or three generations). The population size is extremely large, and hence does not approach the thresholds for Vulnerable under the population size criterion (<10,000 mature individuals with a continuing decline estimated to be >10% in ten years or three generations, or with a specified population structure). For these reasons the species is evaluated as Least Concern.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Population

Population
The global population is estimated to number c.1,200,000-1,400,000 individuals (Wetlands International 2006), while national population sizes have been estimated at c.50-1,000 individuals on migration and c.50-1,000 wintering individuals in Taiwan and c.1,000 wintering individuals in Korea (Brazil 2009).

Population Trend
Decreasing
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Threats

Comments: Declines may be due to the effect of poor water quality on food resources and/or poor reproduction caused by contaminants (Barclay and Zingo 1994).

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Major Threats
The species is susceptible to oil pollution (Kirby et al. 1993, Kear 2005b) when moulting and in winter and may be threatened by high levels of organochloride contaminants (Kear 2005b). Its habit of congregating around coastal sewage outlets in the winter also puts it at risk from other pollution types (del Hoyo et al. 1992) and large numbers often drown due to entanglement in fishing nets (Kirby et al. 1993). The species is threatened by hunting for sport in North America (Schmidt 2006, Blohm et al. 2006), and suffers from disturbance from hunting (Evans and Day 2002). It is also susceptible to avian influenza, so may be threatened by future outbreaks of the virus (Melville and Shortridge 2006). The species is hunted legally for sport in seven countries of the European Union (Kear 2005b) (e.g. Denmark [Bregnballe et al. 2006]), and is hunted for commercial and recreational purposes in Iran (Balmaki and Barati 2006).

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Management

Conservation Actions

Conservation Actions
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Wikipedia

Greater scaup

The greater scaup (Aythya marila), just scaup in Europe, or colloquially "bluebill" in North America for its bright blue bill,[3] is a mid-sized diving duck though it is larger than the closely related lesser scaup. It is a circumpolar species, which means that its range circles one of Earth's poles. It spends the summer months breeding in Alaska, northern Canada, Siberia, and the northernmost reaches of Europe. During the winter, it migrates south down the coasts of North America, Europe, and Japan.

Drake greater scaup are larger and have more rounded heads than females; they have a bright blue bill and yellow eyes. They have dark heads with a glossy green tint, white undersides and wings with white on the tips. The females are mostly brown, with white bands located on their wingtips. They have a blue bill that is slightly duller then the drake's.

Greater scaup nest near water, typically on islands in northern lakes or on floating mats of vegetation. They begin breeding at age two, but start building nests in the first year. The drakes have a complex courtship procedure, which takes place on the return migration to the summer breeding grounds and concludes with the formation of monogamous pairs. Females lay a clutch of six to nine olive-buff colored eggs. The eggs hatch in 24 to 28 days. The down-covered ducklings are able to follow their mother in her search for food immediately after hatching.

Greater scaup eat aquatic mollusks, plants, and insects, which they obtain by diving underwater. They form large groups, called "rafts", that can number in the thousands. Their main threat is human development, although they are preyed upon by owls, skunks, raccoons, foxes, coyotes, and humans. Greater scaup populations have been declining since the 1980s; however, they are still listed as a species of least concern on the IUCN Red List.[2]

Taxonomy[edit]

The genus name Aythya is derived from the Ancient Greek aithuia which refers to a seabird mentioned by Aristotle and others and is thought to refer to a duck, auklet or other seabird. The species name marila is from the Greek word for charcoal embers or coal dust.[4] The greater scaup was first studied by Linnaeus in 1761.[5] Male greater scaup from America are distinguishable from those in Europe and Asia by the stronger vermiculations, worm-like carvings or marks[6] on the mantle and scapulars, and are considered a separate subspecies, A. m. nearctica.[7] Females of the two subspecies are indistinguishable.[8] Based on size differences, a Pleistocene paleosubspecies, Aythya marila asphaltica, has also been described by Serebrovskij in 1941 from fossils recovered at Binagady, Azerbaijan. The greater scaup's name may come from "scalp", a Scottish and Northern English word for a shellfish bed,[9] or from the duck's mating call: "scaup scaup".

A phylogenetic analysis of the diving ducks, examining the skeletal anatomy and skin, found that the greater and lesser scaups are each other's closest relatives, with the tufted duck as the next closest relative of the pair.[10]

Description[edit]

The adult greater scaup is 39–56 cm (15–22 in) long with a 71–84 cm (28–33 in) wingspan and a body mass of 726–1,360 g (1.601–2.998 lb). It has a blue bill and yellow eyes and is 20% heavier and 10% longer than the closely related lesser scaup.[11] The male has a dark head with a green sheen, a black breast, a light back, a black tail, and a white underside. The drake or male greater scaup is larger and has a more rounded head than the female. The drake's belly and flanks are a bright white. Its neck, upper chest, and tail feathers are a glossy black, while its lower flanks are gray. The drake also has a white speculum on its wings. The adult female has a white band and brown oval shaped patches at the base of the bill, which is a slightly duller shade of blue than the drake's bill. Females have grey on both their legs and feet. They have a brown body and head, with white bands on their wingtips.[12] Juvenile greater scaup look similar to adult females. The greater scaup drake's eclipse plumage looks similar to its breeding plumage, except the pale parts of the plumage are a buffy gray.[13] Distinguishing greater from lesser scaups can be extraordinarily difficult in the field, especially in terms of plumage, although (depending on posture) their general shape is slightly different.

Distribution and habitat[edit]

The greater scaup has a circumpolar distribution, breeding within the Arctic Circle both in the Old World (the Palearctic) and North America (the Nearctic). It spends the summer months in Alaska, Siberia. and the northern parts of Europe. It is also found in Asia, and is present in the Aleutian Islands year round.[14] The summer habitat is marshy lowland tundra and islands in fresh water lakes. In the fall, the greater scaup populations start their migration south for the winter. They winter along the Pacific and Atlantic coasts of North America, the coasts of northwest Europe, the Caspian Sea, the Black Sea, the coast of Japan, Yellow Sea and East China Sea.[15] During the winter months, they are found in coastal bays, estuaries, and sometimes inland lakes,[16] such as the lakes of Central Europe and the Great Lakes.[15]

In Europe, the greater scaup breeds in Iceland, the northern coasts of the Scandinavian peninsula, including much of the northern parts of the Baltic Sea, the higher mountains of Scandinavia and the areas close to the Arctic Sea in Russia. These birds spend the winters in the British Isles, western Norway, the southern tip of Sweden, the coast from Brittany to Poland, including all of Denmark, the Alps, the eastern Adriatic Sea, the northern and western Black sea and the southwestern Caspian Sea.[17][18]

In North America, the greater scaup summers in Newfoundland and Labrador, along with Ungava Bay, the Hudson Bay, Lake Winnipeg, Northern Yukon, Northern Manitoba, and Northern Saskatchewan. It winters in Nova Scotia New Brunswick, and the entire west coast of British Columbia. It will also winter along the entire west coast of North America, including the Baja Peninsula. The greater scaup also winters along the shores of the Great Lakes, the Gulf of Mexico and the entire US east coast from Maine to Florida.[15]

Behaviour[edit]

Breeding[edit]

Greater scaup breed all the way from Iceland to northern Scandinavia, northern Russia, northern Siberia and the western North American Arctic. They breed in the tundra and the boreal forest; it is estimated that 75% of the North American population breed in Alaska. Greater scaup typically nest on islands in large northern lakes. Greater scaup begin breeding when they are two years old, although they may start nesting at age one. Drake greater scaup have a soft quick whistle to get the attention of hens during their courtship which takes place from late winter to early spring, on the way back to their northern breeding grounds. Female greater scaup have a single pitch, a raspy “arrr-arrr-arrr-arrr-arrr” sounding vocalization.[19] The courtship procedure is complex and results in the formation of monogamous pairs.[20] Pairs nest in close proximity to each other in large colonies, usually near water, on an island or shoreline, or on a raft of floating vegetation. The nest consists of a shallow depression made by the female and lined with her down.[11] After the female lays the eggs, the drake abandons the female.[20] Once the drakes leave the females, they go to a large, isolated lake, in order to molt. These lakes can be very close to the breeding grounds, or miles away. The lakes chosen are used yearly by the same ducks. The optimal molting lake is fairly shallow, has an abundance of food sources, and cover.[21] The female lays six to nine olive-buff colored eggs,[22] which she incubates for 24–28 days.[23] A large clutch could indicates brood parasitism by other greater scaups or even ducks of other species.[24] Newly hatched chicks are covered with down and are soon able to walk, swim, and feed themselves; however, they are not able to fly until 40–45 days after hatching.[15][20] The vulnerable small chicks follow their mother, who protects them from predators.[20]

Feeding[edit]

Flock feeding in Tokyo bay, Japan

The greater scaup dive to obtain food, which they eat on the surface.[11] They mainly eat mollusks, aquatic plants, and aquatic insects,.[19] During the summer months, the greater scaup will eat small aquatic crustaceans.[11] There is a report of four greater scaups swallowing leopard frogs (with body length about 5 cm (2.0 in)), which they dredged out of a roadside freshwater pond.[25] In freshwater ecosystems, the greater scaup will eat seeds, leaves, stems and roots, along with sedges, pondweeds, muskgrass, and wild celery.[12] Owing to the greater scaup's webbed feet and weight, it can dive up to 6 metres (20 ft) and stay submerged for up to a minute, allowing it to reach food sources that are unobtainable to other diving ducks.[26] The greater scaup forms large flocks, some of which can contain thousands of birds. When flocks are in water, they will face the current, and as the ducks float backwards, some fly to the front of the flock to maintain position.

Threats[edit]

Common predators of the greater scaup are owls, skunks, raccoons, foxes, coyotes, and humans.[5] Greater scaup often find themselves entangled in fishing nets, thus large numbers of them drown in nets each year. Greater scaup can catch avian influenza, so future outbreaks have the potential to threaten greater scaup populations.[14]

Although the greater scaup faces numerous threats, the most significant challenge to their survival is habitat degradation caused by a mix of human development and runoff.[27] Greater scaup, when moulting and during the winter, are threatened by escalated levels of organochloride contaminants. Oil and sewage pollution also threaten this duck. Since 80% of the greater scaup population winters in the urbanized part of the Atlantic Flyway, these ducks are subject to high levels of organic contaminates, along with increased levels of heavy metals in foods and habitat.[16]

A joint group of American and Canadian scientists researching scaup migration across the Great Lakes found that 100% of female greater scaup, and 77% of female lesser scaup, had escalated levels of selenium in their bodies. Selenium is an occurring semimetallic trace element that occurs naturally in some soils and minute amounts are necessary for animal life. However excessive selenium can cause reproductive harm and is highly toxic. On their migration across the Great Lakes, greater scaups are at risk of ingesting selenium by eating the invasive zebra mussels, which can render a hen infertile.[3] This sterilization of hens is causing the population to decrease.

In a study of 107 scaup, they all had traces of iron, zinc, manganese, copper, lead, cadmium, cobalt and nickel in their tissue samples with varying concentrations of metals in different types of tissues. Further analysis revealed that the kidneys had the highest levels of cadmium, the liver had the highest levels of copper and manganese, the liver and the stomach had the highest levels of zinc, and the lungs and liver had the highest levels of iron.[28] There was no difference in concentration when comparing genders.

Conservation[edit]

Photograph
Drake with a leg ring in North Carolina

Greater scaup are rated as a species of least concern by the IUCN Redlist.[2] During aerial population surveys greater and lesser scaup are counted together, because they look almost identical from the air. It was estimated that the greater scaup made up about 11% of the continental scaup population. Since the 1980s, scaup populations have been steadily decreasing. Some of the primary factors contributing to this decline are habitat loss, contaminants, changes in breeding habitat, and a lower female survival rate. The 2010 American scaup population survey was 4.2 million scaup,[29] however, the worldwide greater scaup population survey estimated 1,200,000 to 1,400,000 mature greater scaup.[14] Along with the aerial population surveys, there is a banding program for the greater scaup. Metal leg bands are placed on them, so that if the scaup is killed by a hunter or if it is captured by another banding group, the number on the band can be reported to biologists and wildlife organizations. These banding programs yield valuable data about migration patterns, harvest rates, and survival rates.[30]

Greater scaup decoys, male on the left and female on the right. Each is attached to a lead weight.

Human interactions[edit]

Greater scaup are a popular game bird in North America and Europe.[31] They are hunted in Denmark, Germany, Greece, France, the United Kingdom, and Ireland,[31] and in Iran for both sport and commercial reasons.[15] Greater scaup are hunted with shotguns, because they must be shot on the fly, a very challenging task, as they can fly at up to 121 km/h (75 mph). Greater scaup are hunted from shorelines and in open water hunting blinds or layout boats, low-profile kayak-like boats that hunters lie inside. Hunters frequently use decoys to attract the birds, often arranged to simulate a raft of greater scaup and featuring an open area to attract the birds to land.[32] In most countries where greater scaup are hunted, a duck stamp is required along with the normal hunting licences that are required to pursue other game. In America and Canada, waterfowl must be hunted with non-toxic shot.

References[edit]

  1. ^ Alvarez, Rafae (1977). "A pleistocene avifauna from Jalisco, Mexico". University of Michigan. p. 214. Retrieved 6 December 2011. 
  2. ^ a b c BirdLife International (2012). "Aythya marila". IUCN Red List of Threatened Species. Version 2013.2. International Union for Conservation of Nature. Retrieved 26 November 2013. 
  3. ^ a b "Bluebills". Minnesota Department of Natural Resources. Retrieved 3 November 2011. 
  4. ^ Jobling, James A. (2010). The Helm Dictionary of Scientific Bird Names. London: Christopher Helm. pp. 64, 242. ISBN 978-1-4081-2501-4. 
  5. ^ a b "Greater Scaup". United States Fauna. Retrieved 2 November 2011. 
  6. ^ "Vermiculation". Dictionary.com. Retrieved 11 December 2011. 
  7. ^ Sangster, George; Collinson, J Martin; Helbig, Andreas J; Knox, Alan G and Parkin, David T (2005), "Taxonomic recommendations for British birds: third report", Ibis 147 (4): 821–826, doi:10.1111/j.1474-919X.2005.00483.x 
  8. ^ Banks, RC (1986). "Subspecies of the Greater Scaup and their names". Wilson Bulletin 98 (3): 433–444. 
  9. ^ New Shorter Oxford English Dictionary. Oxford University Press. 1993. ISBN 0-19-861271-0. 
  10. ^ Livezey, Bradley C. (1996). "A phylogenetic analysis of modern pochards (Anatidae: Aythyini)". The Auk 113 (1): 74–93. doi:10.2307/4088937. 
  11. ^ a b c d "Greater Scaup". Bird Web. Seattle Audubon Society. Retrieved 26 October 2011. 
  12. ^ a b "Greater Scaup". Ducks Unlimited. Retrieved 1 November 2011. 
  13. ^ "Greater Scaup". e nature. Retrieved 11 December 2011. 
  14. ^ a b c "Greater Scaup Aythya marila". Bird Life International. Retrieved 2 November 2011. 
  15. ^ a b c d e "Redlist". IUCN Redlist of Threatened Species. Retrieved 8 November 2011. 
  16. ^ a b "Greater Scaup". The Birds of North America. Cornell Lab of Ornithology. Retrieved 2 January 2011. 
  17. ^ Ullman, Magnus (1992). Fåglar i Europa. Wahlström & Widstrand. p. 102. ISBN 91-46-17633-0. 
  18. ^ Delin, Håkan (2001). Färgfotoguiden över alla Europas fåglar. Bonniers. p. 50. ISBN 91-34-51940-8. 
  19. ^ a b Mayntz, Melissa. "Greater Scaup". About.com. Retrieved 20 August 2011. 
  20. ^ a b c d "Greater Scaup". Utah Department of Natural Resources. Retrieved 8 November 2011. 
  21. ^ "Greater Scaup". Cornwall Lab of Ornithology. Retrieved 18 December 2011. 
  22. ^ "Greater Scaup". National Audubon Society, Inc. Retrieved 27 November 2011. 
  23. ^ "Greater Scaup". Ohio Department of Natural Resources. Retrieved 1 December 2011. 
  24. ^ Fournier M A & J E Hines (2001). "Breeding Ecology of Sympatric Greater and Lesser Scaup (Aythya marila and Aythya affinis) in the Subarctic Northwest Territories". Arctic 54 (4): 444– 456. doi:10.14430/arctic801. 
  25. ^ Longley, William H. (1948). "Greater scaup eating frogs". The Auk 66 (2): 200. 
  26. ^ "Greater Scaup". Audubon. National Audubon Society. Retrieved 26 October 2011. 
  27. ^ "Greater Scaup". National Biological Information Infrastructure. Retrieved 8 November 2011. 
  28. ^ "Trace metals in the soft tissues of scaup ducks (Aythya marila L.) wintering in Gdańsk bay, Baltic sea". Elsevier B.V. Retrieved 13 December 2011. 
  29. ^ "Waterfowl Hunting Management in North America". Scaup Population Estimates. U.S. Fish and Wildlife Service in collaboration with flyway and state waterfowl managers. 29 June 2010. Retrieved 4 November 2011. .
  30. ^ "Banding and Marking Programs". U.S. Fish and Wildlife Service. Retrieved 28 November 2011. 
  31. ^ a b "European Union Management Plan". EU. European Union. Retrieved 2 November 2011. 
  32. ^ "Greater Scaup". Discover the Outdoors. Retrieved 19 November 2011. 

Further reading[edit]

Creative Commons Attribution Share Alike 3.0 (CC BY-SA 3.0)

Source: Wikipedia

Unreviewed

Article rating from 0 people

Default rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!