Articles on this page are available in 1 other language: Spanish (1) (learn more)

Overview

Distribution

Range

Widespread South America (excluding the Andes).
  • Clements, J. F., T. S. Schulenberg, M. J. Iliff, D. Roberson, T. A. Fredericks, B. L. Sullivan, and C. L. Wood. 2014. The eBird/Clements checklist of birds of the world: Version 6.9. Downloaded from http://www.birds.cornell.edu/clementschecklist/download/

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Ecology

Habitat

Habitat and Ecology

Systems
  • Terrestrial
  • Freshwater
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Life History and Behavior

Life Expectancy

Lifespan, longevity, and ageing

Maximum longevity: 24.4 years (captivity)
Creative Commons Attribution 3.0 (CC BY 3.0)

© Joao Pedro de Magalhaes

Source: AnAge

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Barcode data: Ardea cocoi

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There are 4 barcode sequences available from BOLD and GenBank.

Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.

See the BOLD taxonomy browser for more complete information about this specimen and other sequences.

TTTATATTTAATCTTTGGAGCATGAGCCGGCATAATTGGAACCGCCCTAAGCCTACTCATCCGAGCTGAACTTGGCCAACCAGGGACACTCCTAGGAGACGACCAGATCTACAATGTGATTGTTACTGCTCATGCCTTCGTAATAATCTTTTTTATAGTAATACCGATCATAATCGGAGGATTCGGAAATTGACTAGTCCCACTCATAATTGGTGCCCCAGACATAGCATTTCCGCGCATGAATAATATAAGCTTCTGACTTCTCCCGCCATCATTCATACTTCTTCTAGCCTCATCCACAGTTGAAGCAGGAGCAGGTACAGGTTGAACAGTTTACCCCCCATTAGCCGGTAACCTAGCTCATGCTGGGGCTTCAGTAGACCTAGCTATCTTCTCCCTCCACCTAGCAGGTGTATCCTCTATCCTAGGGGCAATTAACTTCATCACAACCGCCATCAACATAAAACCCCCAGCCCTATCGCAGTATCAAACTCCCTTATTCGTATGATCCGTCCTAATTACTGCCGTCCTACTCCTACTCTCACTTCCAGTCCTCGCCGCAGGCATCACAATACTACTAACTGATCGAAACCTAAACACCACATTCTTTGACCCTGCCGGAGGCGGAGACCCAGTCCTCTACCAACATCTCTTCTGATTCTTTGGCCACCCAGAAGTCTACATCCTAATTCTC
-- end --

Download FASTA File

Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Statistics of barcoding coverage: Ardea cocoi

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 4
Specimens with Barcodes: 5
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Conservation

Conservation Status

IUCN Red List Assessment


Red List Category
LC
Least Concern

Red List Criteria

Version
3.1

Year Assessed
2012

Assessor/s
BirdLife International

Reviewer/s
Butchart, S. & Symes, A.

Contributor/s

Justification
This species has an extremely large range, and hence does not approach the thresholds for Vulnerable under the range size criterion (Extent of Occurrence <20,000 km2 combined with a declining or fluctuating range size, habitat extent/quality, or population size and a small number of locations or severe fragmentation). The population trend appears to be increasing, and hence the species does not approach the thresholds for Vulnerable under the population trend criterion (>30% decline over ten years or three generations). The population size is very large, and hence does not approach the thresholds for Vulnerable under the population size criterion (<10,000 mature individuals with a continuing decline estimated to be >10% in ten years or three generations, or with a specified population structure). For these reasons the species is evaluated as Least Concern.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Population

Population Trend
Increasing
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Wikipedia

Cocoi heron

The cocoi heron (Ardea cocoi) is a species of heron in the Ardeidae family. It is common and widespread throughout most of South America including Argentina, Bolivia, Brazil, Chile, Colombia, Ecuador, French Guiana, Guyana, Panama, Paraguay, Peru, Suriname, Uruguay, and Venezuela. It is a non-breeding visitor to Trinidad and Tobago and a vagrant to the Falkland Islands and Tristan da Cunha. Its natural habitats are rivers, swamps, and freshwater lakes.

It is a large heron which can measure 95–127 cm (37–50 in) in length, stand up to 100–130 cm (39–51 in) in height and weigh 1.14–3.2 kg (2.5–7.1 lb).[2][3]

References[edit]

  1. ^ BirdLife International (2012). "Ardea cocoi". IUCN Red List of Threatened Species. Version 2013.2. International Union for Conservation of Nature. Retrieved 26 November 2013. 
  2. ^ CRC Handbook of Avian Body Masses by John B. Dunning Jr. (Editor). CRC Press (1992), ISBN 978-0-8493-4258-5.
  3. ^ CRC Handbook of Avian Body Masses, 2nd Edition by John B. Dunning Jr. (Editor). CRC Press (2008), ISBN 978-1-4200-6444-5.


Creative Commons Attribution Share Alike 3.0 (CC BY-SA 3.0)

Source: Wikipedia

Unreviewed

Article rating from 0 people

Default rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!