Overview

Brief Summary

Aythya americana

Ironically, the Redhead is not the only duck in North America with a red head. In many parts of its range, this species occurs side by side with another redheaded duck, the Canvasback (Aythya valisineria), and a couple field marks must be noted in order to distinguish the two. The Redhead is slightly smaller (19-20 inches), has a shorter bill, and is darker on the back and flanks. Males have a red head and grey body, while females are mostly dark brown. The Redhead breeds primarily in the northern Great Plains, with smaller breeding populations in the southern Plains, the Rockies, and Alaska. Although some western areas see Redheads all year, most Redhead populations migrate south to the southern two-thirds of the United States and into Mexico in winter. Despite this vast winter range, much higher concentrations of wintering Redheads may be found along the coast than in the interior. Redheads breed in freshwater wetlands. In winter, this species primarily inhabits coastal areas with plentiful seagrasses. Redheads predominantly eat aquatic plants in summer; in winter, their diet includes seagrasses and mollusks. One of several species of “diving ducks” in North America, Redheads may be observed submerging themselves to feed on submerged plant matter. In winter, they may also be observed in large flocks on coastal bays and lagoons. This species is primarily active during the day.

Threat Status: Least concern

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Unknown

Supplier: DC Birds

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Distribution

North America; Oceania; Nova Scotia region in the summer
translation missing: en.license_cc_by_4_0

© WoRMS for SMEBD

Source: World Register of Marine Species

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

The Aythya americana breeding range extends from southern Canada to the northern United States (Washington to Maine). Many breed in the Prairie Pothole region of the northern Great Plains of North America. There are also some breeding populations in central Alaska. In September, these ducks migrate to winter in northern and central Mexico, and from California to the Gulf and Atlantic Coast. A large portion of redheads winter in Florida and Mexico.

Biogeographic Regions: nearctic (Native )

  • Baldassarre, G., E. Bolen. 1994. Waterfowl Ecology and Management. New York: John Wiley & Sons, Inc..
  • Bellrose, F. 1976. Ducks, Geese and Swans of North America. Harrisburg: Stackpole Books.
  • Johnsgard, P. 1992. Ducks in the Wild: Conserving Waterfowl and Their Habitats. New York: Prentice Hall General Reference.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

occurs (regularly, as a native taxon) in multiple nations

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

National Distribution

Canada

Origin: Native

Regularity: Regularly occurring

Currently: Present

Confidence: Confident

Type of Residency: Year-round

United States

Origin: Native

Regularity: Regularly occurring

Currently: Present

Confidence: Confident

Type of Residency: Year-round

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Global Range: (>2,500,000 square km (greater than 1,000,000 square miles)) BREEDS: locally in south-central and southeastern Alaska, to western Canada and northwestern Minnesota, south to southern California and east to southern Wisconsin, northwestern Pennsylvania. Breeds in greatest abundance in the prairies and parklands of Manitoba, Saskatchewan, North Dakota, and South Dakota; nest densities are highest in the marshes of Nevada and Utah (Custer 1993). WINTERS: southern British Columbia, east to Nevada, northern Arkansas, and southern Illinois, eastern Indiana, eastern Michigan, New York, Connecticut, and eastern Maryland south to Mexico (most of), Guatemala, Cuba, Jamaica and Bahamas; casual in Hawaii. Primary wintering areas in the U.S. include eastern New Mexico-western Texas to Red River (Texas-Oklahoma), Gulf Coast from Texas to Florida, Atlantic coast from southern New Jersey to North Carolina, eastern Florida, and lakes Erie and Ontario (Root 1988). An estimated 80% of the total population winters on the hypersaline Laguna Madre along the Gulf Coast of northern Mexico and southern Texas (Custer 1993). Lake Winnipegosis in Manitoba is an important fall staging and molting area (Custer 1993).

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Geographic Range

Redheads breed from southern Canada to the northern United States (Washington to Maine). Many breed in the prairie pothole region of the northern Great Plains of North America or in central Alaska. In September, these ducks migrate for the winter to northern and central Mexico, California, the Gulf of Mexico, and the Atlantic coast of the southeastern United States, especially Florida.

Biogeographic Regions: nearctic (Native )

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: BioKIDS Critter Catalog

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Range

Alaska to s US; winters to Guatemala and Greater Antilles.

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

In North America: Throughout the United States, Canada, and into Mexico.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Gulf of Maine - CoML

Source: Gulf of Maine Area Census of Marine Life

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Physical Description

Morphology

Males of this species are characterized by a copper-colored head and orange-yellow eyes. The back and flanks are greyish in color, the chest and tail is blackish, the breast is white, and the belly is a whitish color marked with dusty undertones. The wings are grey with slight flecks of white. The feet are bluish grey in color. When the male duck molts in June, the blackish color become more brown, and the reddish head is not as vibrant. By November, darker winter feathers have grown in.

Females do not have colors as vibrant as male coloration. The head of a female is a yellowish brown that is a bit darker on the crown, and she has a slight pale ring around her brown eyes. Her body and tail is mostly dark greyish brown and her belly is whitish fading into greyish brown. Her wings are also a brownish grey color. Her feet are a bluish color, although a little duller than that of the male.

Both the male and the female of this species have a pale blue bill with a white ring around the black tip. It is about .5 inches long. Again, the female's coloring is not as dark.

The juvenile duck's first plumage resemble a mottled version of the female. As the duckling matures, the male becomes darker than the female and they begin to have the coloring of the adults.

Mass - Males: 2.1 to 3.2 pounds, average 2.44 pounds

 Females: 1.5 to 2.9 pounds, average 2.14 pounds

Length - Males: 18.1 to 21.7 inches, average 20.0 inches

 Females: 18.0 to 20.5 inches, average 19.0 inches

Wingspan - Males: average 9.16 inches

 Females: average 8.79 inches

(Bellrose, 1976; Kortright, 1942; Phillips and Lincoln, 1930)

Range mass: 680 to 1450 g.

Range length: 457 to 550 mm.

Average wingspan: 228 mm.

Other Physical Features: endothermic ; bilateral symmetry

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Physical Description

Males of this species are characterized by a copper-colored head and orange-yellow eyes. The back and flanks are greyish in color, the chest and tail is blackish, the breast is white, and the belly is a whitish color marked with dusty undertones. The wings are grey with slight flecks of white. The feet are bluish grey in color. When the male duck molts in June, the blackish color become more brown, and the reddish head is not as vibrant. By November, darker winter feathers have grown in.

Females do not have colors as vibrant as male coloration. The head of a female is a yellowish brown that is a bit darker on the crown, and she has a slight pale ring around her brown eyes. Her body and tail is mostly dark greyish brown and her belly is whitish fading into greyish brown. Her wings are also a brownish grey color. Her feet are a bluish color, although a little duller than that of the male.

Both the male and the female of this species have a pale blue bill with a white ring around the black tip. It is about .5 inches long. Again, the female's coloring is not as dark.

The juvenile duck's first plumage resemble a mottled version of the female. As the duckling matures, the male becomes darker than the female and they begin to have the coloring of the adults.

Mass - Males: 2.1 to 3.2 pounds, average 2.44 pounds

 Females: 1.5 to 2.9 pounds, average 2.14 pounds

Length - Males: 18.1 to 21.7 inches, average 20.0 inches

 Females: 18.0 to 20.5 inches, average 19.0 inches

Wingspan - Males: average 9.16 inches

 Females: average 8.79 inches

(Bellrose, 1976; Kortright, 1942; Phillips and Lincoln, 1930)

Range mass: 680 to 1450 g.

Range length: 457 to 550 mm.

Average wingspan: 228 mm.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: BioKIDS Critter Catalog

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Size

Length: 48 cm

Weight: 1100 grams

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Length: 47.5 cm, Wingspan: 72.5 cm
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Gulf of Maine - CoML

Source: Gulf of Maine Area Census of Marine Life

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Ecology

Habitat

Aythya americana habitat includes shallow freshwater lakes, ponds, and marshes. The body of water needs to be at least 28 inches deep so that the ducks can dive. The Prairie Pothole region provides a perfect area for breeding due to the fact that the potholes fill up with water from melting snow and rain to provide temporary, seasonal, deposits of freshwater. Marshes also provide an area rich with aquatic plants and vegetation cover to act as protection. The ducks may be found on brackish and coastal bays and lakes.

(Baldassarre and Bolden, 1994; Johnsgard, 1992)

Habitat Regions: temperate ; terrestrial ; freshwater

Aquatic Biomes: lakes and ponds

Wetlands: marsh

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Habitat and Ecology

Systems
  • Terrestrial
  • Freshwater
  • Marine
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Comments: Large marshes, lakes, lagoons, rivers and bays, wintering mostly in brackish and marine lagoons and bays, less frequently in inland fresh-water situations (AOU 1983). Birds arriving in fall on saltwater wintering areas, and those wintering in high salinity areas, generally make daily flights to nearby freshwater ponds to drink, preen, and bathe (but not to feed) (Custer 1993).

The most important breeding areas are concentrated in the prairies of the U.S. and Canada. Nests in large freshwater marshes (semipermanently and seasonally flooded palustrine wetlands with persistent emergent vegetation; optimum nesting conditions are wetlands that are 2 ha or more and not more than 0.4 km from a large permanent or semipermanent lake; nests usually are placed in dense bulrush or cattail stands that are interspersed with small areas of open water; nests usually are within 3-4 m of open water; bottom of nest usually is 4-24 cm above the water (Custer 1993). Broods use shallow ponds if emergent vegetation is available for escape cover; ideally these should have high invertebrate populations; later, access to deeper water with ample pondweeds is important (Custer 1993). After nesting, many move to large lakes to molt (Custer 1993). Commonly deposits eggs in nests of other waterfowl species.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Aythya_americana habitat includes shallow freshwater lakes, ponds, and marshes. The body of water needs to be at least 28 inches deep so that the ducks can dive. The Prairie Pothole region provides a perfect area for breeding due to the fact that the potholes fill up with water from melting snow and rain to provide temporary, seasonal, deposits of freshwater. Marshes also provide an area rich with aquatic plants and vegetation cover to act as protection. The ducks may be found on brackish and coastal bays and lakes.

(Baldassarre and Bolden, 1994; Johnsgard, 1992)

Habitat Regions: temperate ; terrestrial ; freshwater

Aquatic Biomes: lakes and ponds

Wetlands: marsh

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: BioKIDS Critter Catalog

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Depth range based on 6 specimens in 1 taxon.

Environmental ranges
  Depth range (m): 0 - 0
 
Note: this information has not been validated. Check this *note*. Your feedback is most welcome.

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Lakes, saltwater bays and estuaries, and freshwater marshes.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Gulf of Maine - CoML

Source: Gulf of Maine Area Census of Marine Life

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Migration

Non-Migrant: No. All populations of this species make significant seasonal migrations.

Locally Migrant: No. No populations of this species make local extended movements (generally less than 200 km) at particular times of the year (e.g., to breeding or wintering grounds, to hibernation sites).

Locally Migrant: Yes. At least some populations of this species make annual migrations of over 200 km.

Migrates northward March-May, reaching Canada by mid-April. Migrates southward in fall, though northward movements from nesting areas to molting areas occur in some areas (usually not in Utah) (Custer 1993).

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Migrates in flocks.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Gulf of Maine - CoML

Source: Gulf of Maine Area Census of Marine Life

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Trophic Strategy

Redhead diet is mainly composed of vegetable matter. It dives to the bottom of the body of water to feed on aquatic plants and mollusks and dabbles on the surface of shallow marshes to locate insects. Prior to the egg-laying season the females up their animal matter intake to increase their protein levels. At this time about 77% of their diet is animal related. About half of the duckling's diet is made up of animal matter to supply the nutrients needed to grow.

Foods commonly eaten include: shoalgrass, pondweeds, muskgrass, sedges, grasses, wild celery, duckweeds, water lilies, grasshoppers, caddisflies, midges, water fleas, scuds, water boatmen and snails.

(Kortright, 1942; Baldassarre and Bolen, 1994)

Animal Foods: insects; mollusks

Plant Foods: leaves; algae

Primary Diet: omnivore

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Comments: Omnivorous, except in winter (Custer 1993). Winter diet includes shoalgrass rhizomes and wildcelery winter buds; at other times, eats tubers, rhizomes, seeds, other parts of aquatic plants, and aquatic invertebrates, including insects, crustaceans, and mollusks (Custer 1993). In breeding season in North Dakota, ate 51-70% invertebrates (mostly chironomids) and 30-49% plant matter; seeds of shallow marsh emergent plants were important in diet of females during a wet year (Woodin and Swanson 1989). Young eat mainly animal matter initially, then shift to mainly plant matter before fledging (Custer 1993). Feeds most often by head dipping or tipping up in shallow water; diving is infrequent in many areas; may dabble for food during the breeding season (Custer 1993).

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Food Habits

Redhead diet is mainly composed of vegetable matter. It dives to the bottom of the body of water to feed on aquatic plants and mollusks and dabbles on the surface of shallow marshes to locate insects. Prior to the egg-laying season the females up their animal matter intake to increase their protein levels. At this time about 77% of their diet is animal related. About half of the duckling's diet is made up of animal matter to supply the nutrients needed to grow.

Foods commonly eaten include: shoalgrass, pondweeds, muskgrass, sedges, grasses, wild celery, duckweeds, water lilies, grasshoppers, caddisflies, midges, water fleas, scuds, water boatmen and snails.

(Kortright, 1942; Baldassarre and Bolen, 1994)

Animal Foods: insects; mollusks

Plant Foods: leaves; algae

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: BioKIDS Critter Catalog

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Consumes mostly aquatic plants and insects. Also will eat mollusks and small fish.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Gulf of Maine - CoML

Source: Gulf of Maine Area Census of Marine Life

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Associations

Redheads have adapted parasitic egg-laying strategies, where they lay their eggs in another duck's nest.

(See Reproduction section.)

Their eggs are also part of the food web for predators.

(Bellrose, 1976)

Species Used as Host:

  • other redheads
  • canvasbacks
  • mallards
  • blue-winged teals
  • cinnamon teals
  • lesser scaups
  • ruddy ducks

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Some Redheads build their nests over the water so that terrestrial animals, like skunks, will not destroy them. Unfortunately, water poses no problem for raccoons. Terrestrial and bird predators eat the duck's eggs. Redheads also attempt to hide their nests, and this greatly reduces the risk of predation.

The female of the species has muted colors so that she will be less noticible to predators when she is incubating her clutch. The ducklings are camouflaged as well. This characteristic allows the ducks to conceal themselves from sport hunters, too.

(Bellrose, 1976)

Known Predators:

  • humans (Homo sapiens)
  • skunks (Mephitinae)
  • raccoons (Procyon lotor)
  • crows (Corvus)
  • magpies (Pica)
  • California gulls (Larus californicus)

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Ecosystem Roles

Redheads have adapted parasitic egg-laying strategies, where they lay their eggs in another duck's nest.

(See Reproduction section.)

Their eggs are also part of the food web for predators.

(Bellrose, 1976)

Species Used as Host:

  • other redheads
  • canvasbacks
  • mallards
  • blue-winged teals
  • cinnamon teals
  • lesser scaups
  • ruddy ducks

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: BioKIDS Critter Catalog

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Predation

Some Redheads build their nests over the water so that terrestrial animals, like skunks, will not destroy them. Unfortunately, water poses no problem for raccoons. Terrestrial and bird predators eat the duck's eggs. Redheads also attempt to hide their nests, and this greatly reduces the risk of predation.

The female of the species has muted colors so that she will be less noticible to predators when she is incubating her clutch. The ducklings are camouflaged as well. This characteristic allows the ducks to conceal themselves from sport hunters, too.

(Bellrose, 1976)

Known Predators:

  • humans (Homo_sapiens)
  • skunks (Mephitinae)
  • raccoons (Procyon_lotor)
  • crows (Corvus)
  • magpies (Pica)
  • California gulls (Larus_californicus)

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: BioKIDS Critter Catalog

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Known predators

Aythya americana is prey of:
Pica
Corvus
Larus californicus
Homo sapiens
Procyon lotor
Mephitinae

This list may not be complete but is based on published studies.
Creative Commons Attribution 3.0 (CC BY 3.0)

© SPIRE project

Source: SPIRE

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Known prey organisms

Aythya americana preys on:
Mollusca
Insecta

This list may not be complete but is based on published studies.
Creative Commons Attribution 3.0 (CC BY 3.0)

© SPIRE project

Source: SPIRE

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

General Ecology

Annual mortality rate is relatively high, 80% in first year, 40% in second year (Bellrose 1980).

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Life History and Behavior

Behavior

Perception Channels: visual ; tactile ; acoustic ; chemical

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Cyclicity

Comments: Usually feeds in mornings and evenings; may feed at night.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Life Cycle

After an incubation period of 24-28 days, the eggs of the Redhead hatch. The ducklings remain in the nest for 3-18 hours after hatching so that their down can dry. At 56 days, the juvenile can be seen flapping accross the water, and at 70 to 84 days the ducks are learning to fly. Some ducks can sexually reproduce at a year, but more time is usually needed.

(Bellrose, 1976)

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Development

After an incubation period of 24-28 days, the eggs of the Redhead hatch. The ducklings remain in the nest for 3-18 hours after hatching so that their down can dry. At 56 days, the juvenile can be seen flapping accross the water, and at 70 to 84 days the ducks are learning to fly. Some ducks can sexually reproduce at a year, but more time is usually needed.

(Bellrose, 1976)

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: BioKIDS Critter Catalog

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Life Expectancy

Disease greatly affects the longevity of the Redhead. Duck Virus Enteritis (DVE), caused by the herpes virus, can cause hemorrhaging and death within two weeks of exposure. If the duck survives, it may become a carrier of the disease. Redheads are moderately susceptible to this. Another disease that affects the ducks is avian botulism. The disease affects the peripheral nerves, and one characteristic is a drooping neck. Maggots feed on the birds that died of avian botulism, concentrating toxin inside themselves. When a Redhead eats the maggot, the toxin is ingested and the cycle starts all over again. Lead posioning is also a major cause of death in waterfowl. The duck eats the lead pellets that have been discarded from shotgun shells. The duck will become weaker over time until it starves to death. Redheads are very susceptible to this because they are bottom-feeders. Also, one of the greatest threats to the Redhead is hunting.

The oldest known wild Redhead lived 22 years 7 months after banding.

(Baldassarre and Bolen, 1994; USGS Bird Banding Laboratory, 2003)

Range lifespan

Status: wild:
22.5 (high) years.

Average lifespan

Status: wild:
271 months.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Lifespan/Longevity

Disease greatly affects the longevity of the Redhead. Duck Virus Enteritis (DVE), caused by the herpes virus, can cause hemorrhaging and death within two weeks of exposure. If the duck survives, it may become a carrier of the disease. Redheads are moderately susceptible to this. Another disease that affects the ducks is avian botulism. The disease affects the peripheral nerves, and one characteristic is a drooping neck. Maggots feed on the birds that died of avian botulism, concentrating toxin inside themselves. When a Redhead eats the maggot, the toxin is ingested and the cycle starts all over again. Lead posioning is also a major cause of death in waterfowl. The duck eats the lead pellets that have been discarded from shotgun shells. The duck will become weaker over time until it starves to death. Redheads are very susceptible to this because they are bottom-feeders. Also, one of the greatest threats to the Redhead is hunting.

The oldest known wild Redhead lived 22 years 7 months after banding.

(Baldassarre and Bolen, 1994; USGS Bird Banding Laboratory, 2003)

Range lifespan

Status: wild:
22.5 (high) years.

Average lifespan

Status: wild:
271 months.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: BioKIDS Critter Catalog

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Lifespan, longevity, and ageing

Maximum longevity: 22.6 years (wild)
Creative Commons Attribution 3.0 (CC BY 3.0)

© Joao Pedro de Magalhaes

Source: AnAge

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Reproduction

During courtship the females take the lead. The female will stand up tall and jerk her head up and down, and then hold it erect. The male she is after will also stand erect and twirl around, showing his backside to her. She may playfully nip at him, or while swimming, dash off and intersect him in his path.

If a female is focusing her attention on more than one male at a time, the males attempt to drive each other away.

Redheads tend to pair in late winter, but courtship behavior can be seen up into the month of April. This is the month where peak pair formation occurs. The males desert the females once incubation begins.

(Bellrose, 1976; Kortright, 1942)

Mating System: monogamous

Redheads tend to begin their breeding season in late April to early June. When a large group of breeding Redheads were studied, it was found that only half of the pairs were breeding. Apparently not all Redhead hens attempt to breed. These non-breeding hens are probably primarily yearlings.

Redheads begin to nest in the midsummer in marshes and potholes of the prairies. Nest sites may be located over water via the support of dense vegetation, on islands, or dry land. If the nest is on land, water must be nearby. Their first choice is to structure the nest using hardstem bulrush followed by cattails. The nest is deeply hollowed and lined with a thick layer of down.

Redheads exhibit interesting egg-laying strategies. Three behaviors are described: normal, semiparasitic, and parasitic. Normal behavior is when the hen lays and incubates her own eggs. Semiparasitic entails normal behavior and laying eggs in other nests. Parasitic is where the hen lays all of her eggs in another duck's nest. Often, the parasitic hen will lay her eggs in another duck's nest after incubation has occurred. This means that the parasitic female's eggs will probably not hatch because they are off schedule from the other eggs. The unhatched eggs are wasted. Sometimes the parasitic female will lay her eggs in the nest of another species.

A female lays, on average, one egg a day, but will skip a few days before the clutch is complete. On average, only 52% of nests have some eggs that have hatched.

(Bellrose, 1976; Kortright, 1942)

Breeding season: late April to early June

Range eggs per season: 9 to 11.

Range time to hatching: 24 to 28 days.

Range fledging age: 55 to 75 days.

Range age at sexual or reproductive maturity (female): 1 (low) years.

Average age at sexual or reproductive maturity (female): 1 years.

Range age at sexual or reproductive maturity (male): 1 (low) years.

Average age at sexual or reproductive maturity (male): 1 years.

Key Reproductive Features: iteroparous ; seasonal breeding ; gonochoric/gonochoristic/dioecious (sexes separate); sexual ; fertilization (Internal ); oviparous

Average eggs per season: 13.

Right before the eggs hatch, the female emits a low kuk-kuk-kuk sound. This sound is extremely important because it imprints on the ducklings to follow her when they are hatched. Redheads are known for their early desertion of their young, and the mother leaves the juveniles when they are able to fly.

(Bellrose, 1976)

Parental Investment: precocial ; female parental care

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Breeding begins in late April in the south to early June in the north. Clutch size is often 7-10 eggs in the redhead's nest, plus commonly several additional eggs laid in the nests of other waterfowl. Incubation lasts 24-28 days, by female (Terres 1980). Brood size averaged 7 in Iowa, 5 in Nevada (Custer 1993). Young are tended by female, which generally deserts the brood when young are about 8 weeks old; the young fledge generally at 10-12 weeks (Custer 1993). Breeding density: 4-10 nests/sq km in the northern Great Plains, 69-214/sq km of marsh in Nevada and Utah (Custer 1993).

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

During courtship the females take the lead. The female will stand up tall and jerk her head up and down, and then hold it erect. The male she is after will also stand erect and twirl around, showing his backside to her. She may playfully nip at him, or while swimming, dash off and intersect him in his path.

If a female is focusing her attention on more than one male at a time, the males attempt to drive each other away.

Redheads tend to pair in late winter, but courtship behavior can be seen up into the month of April. This is the month where peak pair formation occurs. The males desert the females once incubation begins.

(Bellrose, 1976; Kortright, 1942)

Mating System: monogamous

Redheads tend to begin their breeding season in late April to early June. When a large group of breeding Redheads were studied, it was found that only half of the pairs were breeding. Apparently not all Redhead hens attempt to breed. These non-breeding hens are probably primarily yearlings.

Redheads begin to nest in the midsummer in marshes and potholes of the prairies. Nest sites may be located over water via the support of dense vegetation, on islands, or dry land. If the nest is on land, water must be nearby. Their first choice is to structure the nest using hardstem bulrush followed by cattails. The nest is deeply hollowed and lined with a thick layer of down.

Redheads exhibit interesting egg-laying strategies. Three behaviors are described: normal, semiparasitic, and parasitic. Normal behavior is when the hen lays and incubates her own eggs. Semiparasitic entails normal behavior and laying eggs in other nests. Parasitic is where the hen lays all of her eggs in another duck's nest. Often, the parasitic hen will lay her eggs in another duck's nest after incubation has occurred. This means that the parasitic female's eggs will probably not hatch because they are off schedule from the other eggs. The unhatched eggs are wasted. Sometimes the parasitic female will lay her eggs in the nest of another species.

A female lays, on average, one egg a day, but will skip a few days before the clutch is complete. On average, only 52% of nests have some eggs that have hatched.

(Bellrose, 1976; Kortright, 1942)

Breeding season: late April to early June

Range eggs per season: 9 to 11.

Range time to hatching: 24 to 28 days.

Range fledging age: 55 to 75 days.

Range age at sexual or reproductive maturity (female): 1 (low) years.

Average age at sexual or reproductive maturity (female): 1 years.

Range age at sexual or reproductive maturity (male): 1 (low) years.

Average age at sexual or reproductive maturity (male): 1 years.

Key Reproductive Features: iteroparous ; seasonal breeding ; gonochoric/gonochoristic/dioecious (sexes separate); sexual ; fertilization (Internal ); oviparous

Average eggs per season: 13.

Right before the eggs hatch, the female emits a low kuk-kuk-kuk sound. This sound is extremely important because it imprints on the ducklings to follow her when they are hatched. Redheads are known for their early desertion of their young, and the mother leaves the juveniles when they are able to fly.

(Bellrose, 1976)

Parental Investment: precocial ; female parental care

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: BioKIDS Critter Catalog

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Bulky nest constructed in dense marsh area. Nest parasites; females lay their eggs in nests of other Redheads and nests of other ducks. Then most females will lay eggs in their own nest as well. Probably 9-14 eggs per female, difficult to tell because of nest parasitism. Incubation takes 23-29 days. Young can feed themselves, female looks after them.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Gulf of Maine - CoML

Source: Gulf of Maine Area Census of Marine Life

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Barcode data: Aythya americana

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There are 9 barcode sequences available from BOLD and GenBank.

Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.

See the BOLD taxonomy browser for more complete information about this specimen and other sequences.

AATCGATGATTATTCTCTACCAATCACAAAGACATCGGTACCCTATATCTTATCTTTGGGGCATGAGCCGGAATAATCGGCACAGCACTCAGCCTGCTAATCCGCGCAGAACTAGGCCAACCAGGAACCCTCCTGGGTGAT---GACCAGATTTACAACGTAATCGTCACCGCCCACGCCTTTGTAATAATCTTCTTCATAGTGATGCCCATCATAATCGGAGGGTTTGGCAACTGATTAGTCCCCCTAATAATCGGCGCCCCCGACATAGCATTCCCACGAATAAACAACATAAGCTTCTGGCTCCTCCCACCTTCATTCCTCCTCCTACTCGCCTCATCCACCGTAGAAGCTGGCGCCGGCACAGGCTGAACCGTATACCCGCCTCTAGCAGGCAACCTAGCTCACGCTGGGGCCTCAGTAGACCTGGCCATTTTCTCGCTCCACTTAGCCGGTGTTTCCTCCATTCTCGGAGCCATTAACTTCATCACCACAGCCATCAACATAAAACCCCCTGCACTCTCACAATACCAGACCCCACTCTTCGTCTGATCCGTCCTAATCACCGCTATTCTGCTCCTCCTATCGCTACCCGTCCTCGCCGCTGGCATCACAATACTACTAACCGACCGAAACCTAAACACCACATTCTTTGACCCCGCCGGAGGAGGCGACCCAATCCTGTACCAACACCTATTCTGATTCTTCGGCCATCCAGAAGTCTACATCTTAATCCTCCCAGGATTCGGGATTATCTCCCACGTGGTTACATACTACTCAGGCAAAAAAGAACCCTTCGGCTATATAGGAATAGTCTGAGCCATGCTATCCATTGGCTTCCTGGGGTTCATCGTCTGAGCCCACCACATGTTCACCGTAGGGATAGACGTTGACACCCGAG
-- end --

Download FASTA File

Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Statistics of barcoding coverage: Aythya americana

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 11
Specimens with Barcodes: 12
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Conservation

Conservation Status

In the 1970's the Redhead population took a major blow. The vegetation of the Chesapeake Bay area had been declining for years. The combination of agriculture and urban expansion affecting the turbidity of the water, excessive amounts of nutrients, pollution from agriculture, and contamination of toxins added to the disruption of the birds' habitat. As if all of these factors were not enough, Hurricane Agnes greatly affected run-off, thus increasing sediments and decreasing salinity. All these events had a major impact on the vegetation, the primary food source of the Redheads. They were forced to feed on other forms of vegetable life. The states of Maryland and Virginia have created preservation programs in an attempt to reverse the degredation. These programs aim to protect the wildlife and increase research in the area.

In 1908, President Theodore Roosevelt established the Malheur National Wildlife Refuge to protect breeding and migrating waterfowl. It is one of the largest freshwater marshes in the United States. A major breeding population of Redheads resides there.

Because of an overhunting problem, laws were enacted to try to limit these types of deaths.

(Baldassarre and Bolden, 1994)

US Migratory Bird Act: protected

US Federal List: no special status

CITES: appendix ii

State of Michigan List: no special status

IUCN Red List of Threatened Species: least concern

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

IUCN Red List Assessment


Red List Category
LC
Least Concern

Red List Criteria

Version
3.1

Year Assessed
2012

Assessor/s
BirdLife International

Reviewer/s
Butchart, S. & Symes, A.

Contributor/s

Justification
This species has an extremely large range, and hence does not approach the thresholds for Vulnerable under the range size criterion (Extent of Occurrence <20,000 km2 combined with a declining or fluctuating range size, habitat extent/quality, or population size and a small number of locations or severe fragmentation). The population trend appears to be increasing, and hence the species does not approach the thresholds for Vulnerable under the population trend criterion (>30% decline over ten years or three generations). The population size is very large, and hence does not approach the thresholds for Vulnerable under the population size criterion (<10,000 mature individuals with a continuing decline estimated to be >10% in ten years or three generations, or with a specified population structure). For these reasons the species is evaluated as Least Concern.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

National NatureServe Conservation Status

Canada

Rounded National Status Rank: N5B,N5N : N5B: Secure - Breeding, N5N: Secure - Nonbreeding

United States

Rounded National Status Rank: N5B,N5N : N5B: Secure - Breeding, N5N: Secure - Nonbreeding

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

NatureServe Conservation Status

Rounded Global Status Rank: G5 - Secure

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

In the 1970's the Redhead population took a major blow. The vegetation of the Chesapeake Bay area had been declining for years. The combination of agriculture and urban expansion affecting the turbidity of the water, excessive amounts of nutrients, pollution from agriculture, and contamination of toxins added to the disruption of the birds' habitat. As if all of these factors were not enough, Hurricane Agnes greatly affected run-off, thus increasing sediments and decreasing salinity. All these events had a major impact on the vegetation, the primary food source of the Redheads. They were forced to feed on other forms of vegetable life. The states of Maryland and Virginia have created preservation programs in an attempt to reverse the degredation. These programs aim to protect the wildlife and increase research in the area.

In 1908, President Theodore Roosevelt established the Malheur National Wildlife Refuge to protect breeding and migrating waterfowl. It is one of the largest freshwater marshes in the United States. A major breeding population of Redheads resides there.

Because of an overhunting problem, laws were enacted to try to limit these types of deaths.

(Baldassarre and Bolden, 1994)

IUCN Red List of Threatened Species: least concern

US Migratory Bird Act: protected

US Federal List: no special status

CITES: appendix ii

State of Michigan List: no special status

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: BioKIDS Critter Catalog

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Population appears to have declined. There is no official conservation status for the Redhead.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Gulf of Maine - CoML

Source: Gulf of Maine Area Census of Marine Life

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Population

Population Trend
Increasing
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Threats

Comments: Continued losses of easily drained shallow wetlands may impede efforts to maintain current population levels (Woodin and Swanson 1989). Use of permanent and semipermanent wetlands for breeding provides some buffer from the negative effects of drought (Custer 1993). Lack of strong fidelity to breeding sites allows opportunistic use of periodically available suitable water conditions (Custer 1993). Threats in the winter range include loss of shallow shoalgrass "meadows," and increased recreational and industrial use (Custer 1993). Declines in wildcelery have been accompanied by declines in redhead use (Custer 1993).

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Management

Management Requirements: Water levels should be kept constant during the laying and incubation periods to reduce losses from flooding and predators (Custer 1993).

See Marcy (1986) for specifications for the construction and placement of wire nest baskets.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Needs: Protect the large lakes that support large postbreeding populations (Custer 1993). Protect remaining winter habitat in the Laguna Madre (Custer 1993).

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Relevance to Humans and Ecosystems

Benefits

None known.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

The Redhead can be a tasty dinner for humans. Because of the Redhead's diet, it does not have the fishy flavor that other waterfowl have.

These ducks are also common in waterfowl collections because as breeders, they are fairly reliable.

(Kortright, 1942; Todd, 1979)

Positive Impacts: food

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Economic Uses

Comments: Harvest declined from an average of 184,000/year in the 1970s to 37,400 in 1989-1991, paralleling a decline in the number of hunter days and in seasonal bag per hunter (Custer 1993).

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Economic Importance for Humans: Negative

None known.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: BioKIDS Critter Catalog

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Economic Importance for Humans: Positive

The Redhead can be a tasty dinner for humans. Because of the Redhead's diet, it does not have the fishy flavor that other waterfowl have.

These ducks are also common in waterfowl collections because as breeders, they are fairly reliable.

(Kortright, 1942; Todd, 1979)

Positive Impacts: food

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: BioKIDS Critter Catalog

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Wikipedia

Redhead (bird)

This article is about the duck species. For other uses, see Redhead (disambiguation).

The redhead (Aythya americana) is a medium-sized diving duck, 37 cm (15 in) long with an 84 cm (33 in) wingspan.

The adult drake has a blue bill, a red head and neck, a black breast, and yellow eyes. The adult hen has a brown head and body and a darker bluish bill with a black tip. The drake's distinctive call, a mewing weee-ooooo, is given during courtship.

The breeding habitat is marshes and prairie potholes in western North America. Loss of nesting habitat has led to sharply declining populations. Hens regularly lay eggs in the nests of other redheads or other ducks, especially Canvasbacks. Redheads usually take new mates each year, starting to pair in late winter.

Following the breeding season, drakes go through a molt which leaves them flightless for almost a month. Before this happens, they leave their mates and move to large bodies of water, usually flying farther north.

They overwinter in the southern and northeastern United States, the Great Lakes region, northern Mexico and the Caribbean.

This strong migrant is a very rare vagrant to western Europe.

Feeding habits[edit]

These birds feed mainly by diving or dabbling. They mainly eat aquatic plants (74%) with some molluscs (21%).[2] Gastropods include 18% of food and bivalves include 3% of its food.[2]

Gastropods known as food of Aythya americana include:[2] Acteocina canaliculata, Acteon punctostriatus, Anachis avara, Anachis obesa, Caecum nitidum, Calliostoma sp., Cerithidea pliculosa, Cerithium lutosum, Crepidula convexa, Diastoma varium, Melanella sp., Mitrella lunata, Nassarius acutus, Nassarius vibex, Natica sp., Neritina virginea, Odostomia trifida, Olivella minuta, Olivella watermani, Polinices sp., Pyramidellidae, Pyrgocythara plicosa, Rissoina catesbyana, Sayella livida, Turbonilla sp., Turbonilla interrupta and Vitrinella sp.[2]

Gallery[edit]

References[edit]

  1. ^ BirdLife International (2012). "Aythya americana". IUCN Red List of Threatened Species. Version 2013.2. International Union for Conservation of Nature. Retrieved 26 November 2013. 
  2. ^ a b c d Michot T. C., Woodin M. C. & Nault A. J. (2008). "Food habits of redheads (Aythya americana) wintering in seagrass beds of coastal Louisiana and Texas, USA". Acta Zoologica Academiae Scientiarum Hungaricae 54 Suppl. 1): 239-250. PDF
Creative Commons Attribution Share Alike 3.0 (CC BY-SA 3.0)

Source: Wikipedia

Unreviewed

Article rating from 0 people

Default rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!