Overview

Comprehensive Description

Mostly mid-brown in colour, with each feather edged buff. The head pattern is characteristic, with a dark brown line through the eye, bordered with cream above and below and a dark brown crown. The upper wing colour is the same as the back, with a bright glossy green patch in the secondary flight feathers. The white underwing is conspicuous in flight. Young Pacific Black Ducks are similar to the adults in plumage.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© New Guinea Birds

Source: Birds of Papua New Guinea

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Distribution

Range Description

This species breeds in Indonesia from south Sumatra, Java and Sulawesi, through to Irian Jaya, Papua New Guinea (including New Britain and New Ireland), Solomon Islands, Vanuatu, New Caledonia (to France), Australia, Caroline Islands (Federated States of Micronesia), Palau, Fiji, Tonga, Samoa and American Samoa, Cook Islands (New Zealand), Society Islands (French Polynesia) and New Zealand. It occurs as three subspecies, with pelewensis found in the south-west Pacific Islands and north New Guinea, rogersi found in the Indonesian region, south New Guinea and Australia, and the nominate superciliosa occurring in New Zealand and associated larger offshore islands (del Hoyo et al. 1992).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Subspecies and Distribution:


    *pelewensis Hartlaub & Finsch, 1872 - SW Pacific Is, N New Guinea.*rogersi Mathews, 1912 - Indonesian region, S New Guinea, Australia. *superciliosa Gmelin, 1789 - New Zealand and larger offshore islands.


Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© New Guinea Birds

Source: Birds of Papua New Guinea

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Physical Description

Size

50-60 cm

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© New Guinea Birds

Source: Birds of Papua New Guinea

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Diagnostic Description

Mostly mid-brown in colour, with each feather edged buff. The head pattern is characteristic, with a dark brown line through the eye, bordered with cream above and below and a dark brown crown. The upper wing colour is the same as the back, with a bright glossy green patch in the secondary flight feathers. The white underwing is conspicuous in flight. Young Pacific Black Ducks are similar to the adults in plumage.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© New Guinea Birds

Source: Birds of Papua New Guinea

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Ecology

Habitat

Habitat and Ecology

Habitat and Ecology
The species has a broad habitat tolerance, breeding and feeding in a wide range of terrestrial and marine wetlands and estuaries. It also utilises artificial habitats such as farm dams and drains. In New Zealand, however, agricultural regions are now largely dominated by the introduced Mallard A. platyrhynchos, and A. superciliosa has become increasingly restricted to undeveloped areas. Nests tend to be built away from water, and are often in tree holes. Ten to 12 eggs are usually laid. Young are capable of breeding in the first year, but about 65% of young die before starting to breed. Adults live 21 months on average in New Zealand, but the oldest bird in the wild was at least 20 years of age.

Systems
  • Terrestrial
  • Freshwater
  • Marine
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Depth range based on 7942 specimens in 1 taxon.

Environmental ranges
  Depth range (m): 0 - 0
 
Note: this information has not been validated. Check this *note*. Your feedback is most welcome.

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

It frequents all types of water, from isolated forest pools to tidal mudflats. Pacific Black Ducks are usually seen in pairs or small flocks and readily mix with other ducks. In the wild, birds are often very wary of humans and seldom allow close approach. Birds in urban ponds become quite tame, however.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© New Guinea Birds

Source: Birds of Papua New Guinea

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Trophic Strategy

Mainly vegetarian, feeding on seeds of aquatic plants. This diet is supplemented with small crustaceans, molluscs and aquatic insects. Food is obtained by 'dabbling', where the bird plunges its head and neck underwater and upends, raising its rear end vertically out of the water. Occasionally, food is sought on land in damp grassy areas.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© New Guinea Birds

Source: Birds of Papua New Guinea

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Life History and Behavior

Behavior

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© New Guinea Birds

Source: Birds of Papua New Guinea

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Reproduction

Mating in Pacific Black Ducks coincides with availability of sufficient food and water, and often with the onset of heavy rains or when waterways are at their peaks. Courtship is accompanied by ritualised displays including preening, bobbing and wing-flapping. This behaviour is often initiated by the female, and, other than copulation, the male helps little in the breeding process. Often, two broods will be raised in a year. The number of offspring produced may seem quite high, but only 20% of these will survive past two years of age.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© New Guinea Birds

Source: Birds of Papua New Guinea

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Barcode data: Anas superciliosa

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There is 1 barcode sequence available from BOLD and GenBank.   Below is the sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.  See the BOLD taxonomy browser for more complete information about this specimen.  Other sequences that do not yet meet barcode criteria may also be available.

AGCACTCAGCCTACTGATCCGGGCAGAACTAGGCCAKCCAGGGACCCTCCTGGGCGACGACCAAATTTATAACGTGATCGTCACCGCTCACGCCTTCGTAATAATCTTCTTCATGGTAATGCCCATCATAATTGGAGGGTTCGGCAACTGATTGGTCCCCCTGATAATCGGTGCCCCCGACATAGCATTCCCACGAATAAACAACATAAGCTTCTGACTCCTCCCACCATCATTCCTCCTTCTACTCGCCTCATCCACTGTAGAAGCTGGCGCTGGTACAGGTTGAACCGTATACCCACCTCTAGCAGGCAACCTAGCCCACGCCGGAGCCTCAGTGGACCTGGCTATCTTCTCACTTCACCTGGCCGGTGTCTCCTCCATCCTCGGAGCCATTAACTTCATTACCACAGCCATCAACATAAAACCCCCCGCACTCTCACAATACCAAACCCCACTTTTCGTCTGATCAGTCCTAATTACCGCCATCCTGCTCCTCCTATCACTCCCCGTCCTCGCCGCCGGCATCACAATGCTACTAACCGACCGAAACCTAAACACCACATTCTTTGATCCTGCCGGAGGGGGAGACCCAATCCTGTACCAACACCTATTTTGATTCTTCGGCCACCCAGAAGTCTATATCTTAATCCTCCCTGGATTCGGAATCATCTCACATGTAGTA
-- end --

Download FASTA File
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Statistics of barcoding coverage: Anas superciliosa

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 1
Specimens with Barcodes: 2
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Conservation

Conservation Status

IUCN Red List Assessment


Red List Category
LC
Least Concern

Red List Criteria

Version
3.1

Year Assessed
2012

Assessor/s
BirdLife International

Reviewer/s
Butchart, S. & Symes, A.

Contributor/s

Justification
This species has an extremely large range, and hence does not approach the thresholds for Vulnerable under the range size criterion (Extent of Occurrence <20,000 km2 combined with a declining or fluctuating range size, habitat extent/quality, or population size and a small number of locations or severe fragmentation). The population trend is not known, but the population is not believed to be decreasing sufficiently rapidly to approach the thresholds under the population trend criterion (>30% decline over ten years or three generations). The population size is very large, and hence does not approach the thresholds for Vulnerable under the population size criterion (<10,000 mature individuals with a continuing decline estimated to be >10% in ten years or three generations, or with a specified population structure). For these reasons the species is evaluated as Least Concern.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Not Threatened.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© New Guinea Birds

Source: Birds of Papua New Guinea

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Population

Population
The species currently has a large global population estimated to be 180,000-1,200,000 individuals (Wetlands International 2006). Both superciliosa and rogersi have undergone significant declines in the last 20 years (Marchant and Higgins 1990). In New Zealand, the superciliosa population was estimated at 1.5 million birds in 1970, decreasing to 1.2 million by 1981, and less than 500,000 in the 1990s (Heather and Robertson 1997). A second estimate placed numbers at between 80,000 and 150,000 in 1993 (Rose and Scott 1997). Subspecies pelewensis was estimated at 10,000-25,000 birds and is considered stable (Rose and Scott 1997).

Population Trend
Unknown
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Threats

Major Threats
The species is believed to be declining throughout its range due to a combination of competition and hybridisation with A. platyrhynchos (Heather and Robertson 1997). This introduced species is most common in developed areas and, in New Zealand at least, numbers are still increasing (Marchant and Higgins 1990). Also in New Zealand, loss of wild habitats is considered to be a leading cause in declines (Heather and Robertson 1997), and there is a slow decline through Melanesia due to hunting and habitat degradation (G. Dutson in litt. 1999). Such habitat destruction is also occuring in Australia, but birds there have proved to be more able to utilise artificial habitats (Marchant and Higgins 1990).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Wikipedia

Mariana Mallard

The Mariana mallard (Anas oustaleti) or Oustalet's duck is an extinct type of duck of the genus Anas that was endemic to the Mariana Islands. Its taxonomic status is debated, and it has variously been treated as a full species, a subspecies of the mallard or the Pacific black duck, or sometimes as a subspecies of the Indian spot-billed duck.

Taxonomy[edit]

Illustration by Allan Brooks (third bird)

The taxonomic status of the Mariana mallard is disputed, since it resembles an intermediate of the mallard and the Pacific black duck, two closely related allopatric species which frequently hybridise. Its males had two intergrading color morphs, called the "platyrhynchos" and the "superciliosa" types after the species they resembled more.[1] It was first scientifically described by Tommaso Salvadori as full species in the genus Anas, named after its collector, the French zoologist Emile Oustalet. Salvadori suggested it was related to the Pacific black duck.[2][3] It was previously known to the Chamorro people, who called it ngånga' (palao) in Chamorro, and to the Carolinian people, who called it ghereel'bwel in Carolinian.[citation needed]

After Salvadori, most taxonomists, such as Dean Amadon and Ernst Mayr, considered it a subspecies of the mallard.[3] Yoshimaro Yamashina examined those specimens in Japanese museums in 1948, and decided that the Mariana mallard was an example of hybrid speciation, and was descended from the mallard and the Pacific black duck's Palau subspecies (Anas superciliosa pelewensis).[3][4] However, no molecular genetic evidence is available to support this hypothesis.[citation needed] Some scientists, such as Jean Delacour, have considered the Mariana mallard a simple hybrid, so it was absent from Delacour's four-volume monograph on the ducks and from the IUCN Red List.[3] If Yamashina's hypothesis is correct, the Mariana mallard would have presumably evolved into near species status in only about ten thousand years.[citation needed]

Neither Mariana mallards nor their progenitor species are known from fossils on the Marianas, casting into doubt the assumption that a resident black duck population had been long established on the islands. However, most rock shelters and caves on the Marianas were obliterated in the 1944 Battle of Guam.[5] A species of flightless duck is known from a prehistoric bone found on Rota in 1994; was apparently not closely related to the Mariana mallard.[6]

Description[edit]

Photo published in 1949

Mariana mallards were 51–56 cm long and weighed approximately one kilogram, making them marginally smaller than mallards. Two intergrading color morphs were found in males, called the "platyrhynchos" and the "superciliosa" type after the species they resembled more.

Only the former had a distinct nuptial (breeding) plumage: the head was green as in mallard drakes, but less glossy, with some buff feathers on the sides, a dark brown eyestripe and a faint whitish ring at the base of the neck. The upper breast was dark ruddish chestnut brown with blackish-brown spots. The wing patch (speculum) and the tail was also like in mallard drakes' nuptial plumage, including curled-up central tail feathers, but the tips of the speculum feathers were buff. The underside was a mix between the vermiculated grey feathers of the mallard and the brown ones of the Pacific black duck. The remainder of the bird looked like a male Pacific black duck with lighter underwings. The bill was black at the base and olive at the tip, the feet reddish orange with darker webs and the iris brown. The eclipse plumage looked similar to a dark eclipse mallard drake.

Males of the "superciliosa" type resembled a Pacific black duck with a less distinctly marked head, the supercilium and cheeks being buffy and the cheek (malar) stripe hardly visible. The upper breast, flank and scapular feathers had broader buff edges, and the underwings were lighter. The speculum was usually as in the "platyrhynchos" type, i.e. mallard-like, but at least two specimens have the green speculum of the Pacific black duck. The bill was like that of A. superciliosa, and the iris and legs similar to the "platyrhynchos" type.

Females looked essentially like a dark mallard female with the orange of the feet and near the bill tip usually a bit more pure.

Distribution[edit]

It occurred, in recent times at least, on the islands of Guam, Saipan and Tinian. Two unidentified ducks were seen on Rota in 1945,[1] but as no movement of A. oustaleti between Saipan and Tinian, which are just 8 kilometres (5.0 mi) apart, was recorded,[7] these were probably vagrant migrating ducks, although Marshall (1949) suspected from circumstantial evidence that such movement did indeed take place.[8] However, the distance between Guam and Rota is nearly 80 kilometres (50 mi), making intentional migration between these islands not likely.

Ecology[edit]

The Mariana mallard inhabited wetlands, mostly inland but occasionally also in coastal areas. On Guam, it was most abundant in the Talofofo River valley, on Tinian on Lake Hagoi and Lake Makpo (now Makpo Swamp) before it was drained, and on Saipan on the Garpan lagoon and on and around Lake Susupe. The birds were rather reclusive, preferring sheltered habitat with plenty of wetland/water plants – fern thickets (Acrostichum aureum) and reed beds (Scirpus, Cyperus and Phragmites (australis) karka),[9][10] where they also nested. Usually, pairs or small flocks were encountered, but in the key habitats larger groups of dozens and rarely up to 50–60 individuals could be found. Apart from possible inter-island movement, the birds were not migratory.

Feeding and reproduction are not well documented, but cannot expected to differ significantly from its immediate relatives. The Mariana mallard fed on aquatic invertebrates, small vertebrates and plants, and although up-ending was not observed, they probably utilized it too.

Breeding was recorded from at least January to July, with a peak in June–July at the end of the dry season. One male specimen taken in October was also in breeding condition;[8] thus, the birds may have bred nearly year-round at least on occasion. Unfortunately, the courtship behavior, which in the strongly sexually dimorphic mallard is focused more on presentation of visual cues than in the monomorphic Pacific black duck (although it is generally similar in both species), was never recorded. Clutches consisted of 7–12 pale grey-green oval eggs, measuring 61.6 x 38.9 mm on average.[7] Incubation lasted around 28 days, males took no part in it and neither in caring for the ducklings. The precocial and nidifugous young fledged when about eight weeks old and became sexually mature the following year.

Extinction[edit]

The birds declined due to draining of wetlands for agriculture and construction. Hunting pressure was probably heavy, despite a ban on gun ownership under Japanese control (1914–1945), as the birds were unwary[verification needed] to be trapped, and at any rate the gun ban was lifted after World War II (see also below). By the 1940s, flocks of more than a dozen birds were seldom seen. On Guam, the last sightings were in 1949 and 1967—the latter being a single, possibly vagrant, bird—and on Tinian in 1974. As Lake Susupe offered the most plentiful and least accessible habitat, although it too suffered from pollution by sugar mill wastes, the Saipan population lingered on for a few more years. The Mariana mallard was listed as federally endangered on June 2, 1977.[11] In 1979, two males and a female were found on Saipan and caught; one male was later released, the last wild bird ever to be encountered. The pair was brought to Pohakuloa Training Area, Hawaii, and later to SeaWorld San Diego, where it was attempted to have them reproduce in captivity. However, this was unsuccessful and the species became extinct with the death of the last individual in 1981. Surveys were conducted in the following years, but the species was certainly gone by then. It was removed from the USFWS Endangered Species List on February 23, 2004, due to extinction.[12][13]

Collection of specimens for museums and private collections must have had a temporary impact during the Japanese control over the islands.[citation needed] Although fewer than 100 specimens are on record, most were taken in the 1930s and 1940s for Japanese collectors; given the rather sedentary habits and small population size of the species, this may have jeopardized local populations to the point of extinction.[citation needed] Outside Japan, 7 specimens (including the type) are in the MNHN, Paris, one in the Walter Rothschild Zoological Museum, Tring, two in the USNM, Washington D.C. and six in the AMNH, New York City.[14] There are reports of additional specimens in Cambridge, Massachusetts and Lisbon.[15]

References[edit]

  1. ^ a b Madge, Steve; Burn, Hilary (1988). Waterfowl: an Identification Guide to the Ducks, Geese, and Swans of the World. Boston: Houghton Mifflin. p. 213. ISBN 0-395-46727-6. 
  2. ^ Salvadori, Tommaso (1894). Bulletin of the British Ornithologists' Club 20: 1. 
  3. ^ a b c d Weller, Milton W. (1980). The Island Waterfowl. Ames, Iowa: Iowa State University Press. pp. 17–19. ISBN 0813813107. 
  4. ^ Yamashina, Y. (1948). "Notes on the Marianas mallard". Pacific Science 2: 121–124. hdl:10125/9101. 
  5. ^ Steadman, David William (2006). Extinction and Biogeography of Tropical Pacific Birds. University of Chicago Press. ISBN 0-226-77142-3. 
  6. ^ Steadman, David William (1999). "The Prehistory of Vertebrates, Especially Birds, on Tinian, Aguiguan, and Rota, Northern Mariana Islands". Micronesica 31 (2): 319–345 (338, 340). 
  7. ^ a b Kuroda, N. (1941–1942). "[A study of the Marianas Mallard, Anas oustaleti]". Tori (in Japanese) 11. pp. 99–119 (part 1), 443–448 (part 2). 
  8. ^ a b Marshall, Joe T., Jr. (1949). "The endemic avifauna of Saipan, Tinian, Guam and Palau". Condor 51 (5): 200–221. doi:10.2307/1364563. 
  9. ^ Tenorio, J. (1979). Ornithological surveys of wetlands in Guam, Saipan, Tinian, and Pagan. Honolulu: U.S. Army Corps of Engineers, Pacific Ocean Division. 
  10. ^ Stemmermann, L. (1981). A guide to Pacific wetland plants. Honolulu: U.S. Army Corps of Engineers, Honolulu District. 
  11. ^ Fish and Wildlife Service (1977). "Endangered and Threatened Wildlife and Plants: Determination that the Mariana Mallard is an Endangered Species". Federal Register 42: 28136–28137. 
  12. ^ Fish and Wildlife Service (2004). "Endangered and Threatened Wildlife and Plants; Removing the Mariana Mallard and the Guam Broadbill From the Federal List of Endangered and Threatened Wildlife". Federal Register 69: 8116–8119. 
  13. ^ Ravelo, John (25 February 2004). "CNMI's Mariana mallard now extinct". Saipan Tribune. Retrieved 14 August 2006. 
  14. ^ Fish and Wildlife Information Exchange (1996–1997). "Mariana Mallard, ESIS101048 (draft)". Virginia Tech. Archived from the original on 19 January 2000. 
  15. ^ Greenway, James C. (1967). "Marianas Island Duck". Extinct and Vanishing Birds of the World (2nd ed.). New York: Dover Publications. pp. 169–171. 
Creative Commons Attribution Share Alike 3.0 (CC BY-SA 3.0)

Source: Wikipedia

Unreviewed

Article rating from 0 people

Default rating: 2.5 of 5

Pacific Black Duck

The Pacific black duck (Anas superciliosa) is a dabbling duck found in much of Indonesia, New Guinea, Australia, New Zealand, and many islands in the southwestern Pacific, reaching to the Caroline Islands in the north and French Polynesia in the east. It is usually called the grey duck in New Zealand, where it is also known by its Maori name, Pārera.

Description[edit]

Pacific black ducks—Durack Lakes, Palmerston, Northern Territory, Australia

This sociable duck is found in a variety of wetland habitats, and its nesting habits are much like those of the mallard, which is encroaching on its range in New Zealand.[2] It feeds by upending, like other Anas ducks.

It has a dark body, and a paler head with a dark crown and facial stripes. In flight, it shows a green speculum and pale underwing. All plumages are similar. The size range is 54–61 cm; males tend to be larger than females, and some island forms are smaller and darker than the main populations.[3] It is not resident on the Marianas islands, but sometimes occurs there during migration. The now extinct Mariana mallard was probably originally derived from hybrids between this species and the mallard, which came to the islands during migration and settled down there.

There are three subspecies of Anas superciliosa:

Wagga Wagga, New South Wales, Australia

The New Zealand subspecies has declined sharply in numbers, at least in its pure form, due to competition from and hybridisation with the introduced mallard.[4] Rhymer et al. (1994) say their data "points to the eventual loss of identity of the grey duck as a separate species in New Zealand, and the subsequent dominance of a hybrid swarm akin to the Mariana Mallard."

It was assumed that far more mallard drakes mate with grey duck females than vice versa based on the fact that most hybrids show a mallard-type plumage, but this is not correct; it appears that the mallard phenotype is dominant, and that the degree to which species contributed to a hybrid's ancestry cannot be determined from the plumage.[5] The main reasons for displacement of the Pārera seem to be physical dominance of the larger mallards, combined with a marked population decline of the Pārera due to overhunting in the mid-20th century.[6]

Various views and plumages[edit]

References[edit]

  1. ^ BirdLife International (2012). "Anas superciliosa". IUCN Red List of Threatened Species. Version 2013.2. International Union for Conservation of Nature. Retrieved 26 November 2013. 
  2. ^ Rhymer, Judith M.; and Simberloff, Daniel (1996). "Extinction by hybridization and introgression". 83–109 27: 83. doi:10.1146/annurev.ecolsys.27.1.83. 
  3. ^ Madge, Steve; Burn, Hilary (1988). Waterfowl: an Identification Guide to the Ducks, Geese, and Swans of the World. Boston: Houghton Mifflin. ISBN 0-395-46727-6. 
  4. ^ Gillespie, Grant D (1985). "Hybridization, introgression, and morphometric differentiation between Mallard (Anas platyrhynchos) and Grey Duck (Anas superciliosa) in Otago, New Zealand". The Auk 102 (3): 459–469. 
  5. ^ Rhymer, Judith M.; Williams, Murray J.; and Braun, Michael J (1994). "Mitochondrial analysis of gene flow between New Zealand Mallards (Anas platyrhynchos) and Grey Ducks (A. superciliosa)". The Auk 111 (4): 970–978. doi:10.2307/4088829. 
  6. ^ Williams, Murray; and Basse, Britta (2006). "Indigenous gray ducks, Anas superciliosa, and introduced mallards, A. platyrhynchos, in New Zealand: processes and outcome of a deliberate encounter". Acta Zoologica Sinica 52 (Supplement): 579–582. 

Further reading[edit]

  • Heather, Barrie D.; and Robertson, Hugh A. (1996). The Field Guide to the Birds of New Zealand. Auckland: Viking. ISBN 0-670-86911-2. 
Creative Commons Attribution Share Alike 3.0 (CC BY-SA 3.0)

Source: Wikipedia

Unreviewed

Article rating from 0 people

Default rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!