Articles on this page are available in 1 other language: Spanish (10) (learn more)

Overview

Brief Summary

Anas americana

Known by duck hunters as the “Baldpate,” the American Widgeon may be readily identified by the large white forehead patch which gives this species its nickname. A medium-sized (18-23 inches) species of duck, the male American Widgeon is also characterized by a large green head patch, brown sides, and large white wing patches visible in flight. The female is less ornate, being mostly brown overall with less white on the wings. American Widgeons breed primarily from west-central Alaska east to the Hudson Bay, and from just south of the tundra in Canada south to the upper Great Plains. Recently, this species has expanded eastward, and smaller breeding areas may be encountered along the Great Lakes, around the St. Lawrence River, and in the Maritime Provinces in eastern Canada. This species migrates south for the winter, where it may be found along the Pacific, Atlantic, and Gulf coasts of the U.S., in the southern Plains, and points south. The American Widgeon breeds in shallow wetlands throughout its breeding range. Preferring freshwater in summer, this species is less constrained in winter, when it may be found on rivers and lakes or in saltwater estuaries and bays. American Widgeons feed primarily on aquatic plants and grasses in winter, but they may also consume insects and other small invertebrates during the breeding season. American Widgeons may be seen either on land or in the water, where they may be observed foraging for food. This species may also be observed taking off straight up from the water or undertaking straight, swift flights on migration or between breeding or foraging grounds. American Widgeons are most active during the day.

Threat Status: Least Concern

  • American Wigeon (Anas americana). The Internet Bird Collection. Lynx Edicions, n.d. Web. 20 July 2012. .
  • Anas americana. Xeno-canto. Xeno-canto Foundation, n.d. Web. 20 July 2012. .
  • Mowbray, Thomas. 1999. American Wigeon (Anas americana), The Birds of North America Online (A. Poole, Ed.). Ithaca: Cornell Lab of Ornithology; Retrieved from the Birds of North America Online: http://bna.birds.cornell.edu/bna/species/401
  • Peterson, Roger Tory. Birds of Eastern and Central North America. Boston: Houghton Mifflin, 1980. Print.
  • eBird Range Map - American Wigeon. eBird. Cornell Lab of Ornithology, N.d. Web. 20 July 2012. .
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Smithsonian Institution

Supplier: DC Birds

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Distribution

North America
translation missing: en.license_cc_by_4_0

© WoRMS for SMEBD

Source: World Register of Marine Species

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

The American wigeon has very large winter and breeding ranges that spread north to the tips of Alaska and Canada, and south through Mexico to the northern parts of South America. Winter distribution is concentrated in the lower 48 states and all of Mexico, excluding high elevation Rocky Mountain and Appalachian areas. Breeding takes place mostly in western Canada but is spread throughout northwestern North America.

Biogeographic Regions: nearctic (Native )

  • Mowbray, T. 1999. American Wigeon, No. 401. Pp. 1-32 in A Poole, F Gill, eds. The Birds of North America. Washington, DC: The Academy of Natural Sciences, Philadelphia, PA, and The American Ornithologists' Union.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

occurs (regularly, as a native taxon) in multiple nations

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

National Distribution

Canada

Origin: Native

Regularity: Regularly occurring

Currently: Present

Confidence: Confident

Type of Residency: Year-round

United States

Origin: Native

Regularity: Regularly occurring

Currently: Present

Confidence: Confident

Type of Residency: Year-round

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Global Range: (>2,500,000 square km (greater than 1,000,000 square miles)) BREEDS: mainly Alaska east to Manitoba, south to northeastern California, northern Nevada, northern Colorado, northern Nebraska, northern Minnesota. NORTHERN WINTER: mainly southern Alaska-Mexico; central U.S. to southern Great Lakes and Ohio Valley; Nova Scotia south along coast to Gulf of Mexico, West Indies, Panama, northern Colombia, Trinidad, rarely northwestern Venezuela; uncommon but regular in Hawaii. In the U.S., the highest winter densities generally occur in the coastal Pacific Northwest and the vicinity of the Texas-New Mexico border (Root 1988).

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Geographic Range

The American wigeon has very large winter and breeding ranges that spread north to the tips of Alaska and Canada, and south through Mexico to the northern parts of South America. Winter distribution is concentrated in the lower 48 states and all of Mexico, excluding high elevation Rocky Mountain and Appalachian areas. Breeding takes place mostly in western Canada but is spread throughout northwestern North America.

Biogeographic Regions: nearctic (Native )

  • Mowbray, T. 1999. American Wigeon, No. 401. Pp. 1-32 in A Poole, F Gill, eds. The Birds of North America. Washington, DC: The Academy of Natural Sciences, Philadelphia, PA, and The American Ornithologists' Union.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: BioKIDS Critter Catalog

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Range

Alaska to s US; winters to nw South America.
  • Clements, J. F., T. S. Schulenberg, M. J. Iliff, D. Roberson, T. A. Fredericks, B. L. Sullivan, and C. L. Wood. 2014. The eBird/Clements checklist of birds of the world: Version 6.9. Downloaded from http://www.birds.cornell.edu/clementschecklist/download/

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Physical Description

Morphology

In alternate plumage adult males have a white crown and forehead and a broad, dark green patch surrounding the eye and nape. The bill is blue-gray with a black tip. The rest of the neck, face and upper back is buffy white with heavy black speckling. The breast and flanks are reddish brown with a bright white underbelly. Upperwing-coverts are white so that there is a large white patch when wings are extended. In alternate plumage adult females have a brownish black crown, streaked with creamy white. The bill is grayish with a black tip. The rest of the head and neck is white with heavy streaking and the back is grayish brown with light barring. Flanks are reddish brown and the belly is white. The white wing patch is poorly defined in the female. In basic plumage adult males resemble females but may have slightly brighter sides and flanks.

The American wigeon is most likely to be confused with the Eurasian wigeon, which is seen only rarely in North America. In alternate plumage, the adult male Eurasian wigeon is most easily distinguished from the adult male American wigeon by its red head and gray back and sides. Females and juveniles are very similar but can be distinguished by the axillars, which are finely speckled with dark gray in the Eurasian wigeon, but pure white in the American wigeon. (Mowbray, 1999)

Range mass: 665 to 1330 g.

Range length: 45 to 58 cm.

Average wingspan: 86.4 cm.

Other Physical Features: endothermic ; homoiothermic; bilateral symmetry

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Physical Description

In alternate plumage adult males have a white crown and forehead and a broad, dark green patch surrounding the eye and nape. The bill is blue-gray with a black tip. The rest of the neck, face and upper back is buffy white with heavy black speckling. The breast and flanks are reddish brown with a bright white underbelly. Upperwing-coverts are white so that there is a large white patch when wings are extended. In alternate plumage adult females have a brownish black crown, streaked with creamy white. The bill is grayish with a black tip. The rest of the head and neck is white with heavy streaking and the back is grayish brown with light barring. Flanks are reddish brown and the belly is white. The white wing patch is poorly defined in the female. In basic plumage adult males resemble females but may have slightly brighter sides and flanks.

The American wigeon is most likely to be confused with the Eurasian wigeon, which is seen only rarely in North America. In alternate plumage, the adult male Eurasian wigeon is most easily distinguished from the adult male American wigeon by its red head and gray back and sides. Females and juveniles are very similar but can be distinguished by the axillars, which are finely speckled with dark gray in the Eurasian wigeon, but pure white in the American wigeon. (Mowbray, 1999)

Range mass: 665 to 1330 g.

Range length: 45 to 58 cm.

Average wingspan: 86.4 cm.

Other Physical Features: endothermic ; homoiothermic; bilateral symmetry

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: BioKIDS Critter Catalog

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Size

Length: 48 cm

Weight: 792 grams

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Ecology

Habitat

Habitat and Ecology

Systems
  • Terrestrial
  • Freshwater
  • Marine
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Depth range based on 9149 specimens in 1 taxon.

Environmental ranges
  Depth range (m): 0 - 0
 
Note: this information has not been validated. Check this *note*. Your feedback is most welcome.
All rights reserved

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

lake, grasslands, river, marsh, estuarine, intertidal or littoral
translation missing: en.license_cc_by_4_0

© WoRMS for SMEBD

Source: World Register of Marine Species

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

In the winter, the wigeon is found most often in lacustrine and intertidal areas where the emergence of plants material is abundant. It inhabits freshwater marshes, rivers, lakes, estuaries, saltwater bays, and agricultural lands.

During the breeding season it prefers areas with vegetation cover near lakes or marshy sloughs. Mixed grass and short grass prairies are preferred for breeding.

(Mowbray, 1999)

Habitat Regions: temperate ; terrestrial ; freshwater

Aquatic Biomes: lakes and ponds; rivers and streams

Wetlands: marsh

Other Habitat Features: agricultural ; estuarine ; intertidal or littoral

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Comments: Large marshes and lakes; when not breeding, in both freshwater and brackish areas and foraging in marsh edges, sloughs and sheltered bays (AOU 1983). Nests in freshwater situations with exposed shorelines; on dry land on islands, near lakes, ponds or sloughs; but often relatively far from water.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

In the winter, the wigeon is found most often in lacustrine and intertidal areas where the emergence of plants material is abundant. It inhabits freshwater marshes, rivers, lakes, estuaries, saltwater bays, and agricultural lands.

During the breeding season it prefers areas with vegetation cover near lakes or marshy sloughs. Mixed grass and short grass prairies are preferred for breeding.

(Mowbray, 1999)

Habitat Regions: temperate ; terrestrial ; freshwater

Aquatic Biomes: lakes and ponds; rivers and streams

Wetlands: marsh

Other Habitat Features: agricultural ; estuarine ; intertidal or littoral

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: BioKIDS Critter Catalog

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Depth range based on 9149 specimens in 1 taxon.

Environmental ranges
  Depth range (m): 0 - 0
 
Note: this information has not been validated. Check this *note*. Your feedback is most welcome.

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Migration

Non-Migrant: No. All populations of this species make significant seasonal migrations.

Locally Migrant: No. No populations of this species make local extended movements (generally less than 200 km) at particular times of the year (e.g., to breeding or wintering grounds, to hibernation sites).

Locally Migrant: Yes. At least some populations of this species make annual migrations of over 200 km.

Migrates slowly northward through U.S. March-April, arriving in northern nesting areas April-May (late May-early June in Beaufort Sea region). Migrates southward in fall. Present in Puerto Rico and Colombia (uncommon) October-April, Costa Rica October-March (may leave early in very dry years) (Stiles and Skutch 1989). Migrates in small dense flocks. In late spring or early summer, males make long-distance molt migrations to marshes with broad expanses of open water.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Trophic Strategy

Shallow, freshwater wetlands, marshes, mudflats, slow moving rivers, and ponds are all potential areas for foraging for wigeons. These are areas where the abundance of emergent plant life and insects is the greatest. They will feed on a variety of aquatic insects such as damselflies and caddisflies, as well as terrestrial insects such as beetles. This type of food comprises a small part of their diet however. The largest food source is stems and leafy parts of aquatic plants, grasses, and agricultural plants. They particularly prefer muskgrasses and bushy pondweed. Differences between juvenile and adult food preferences have been noted.

These birds are better adapted morphologically and physiologically for grazing on aquatic and terrestrial plants than most other North American birds. They use the strength in the tip of their bill to pluck vegetation and also filter feed with the lamellae on the upper mandible. They are opportunistic and aggressive feeders, often foraging in open water on materials brought to the surface by diving ducks and coots.

Common foods eaten include: stems and leafy parts of aquatic plants, leafy parts of upland grasses, leafy parts and seeds of agricultural plants, aquatic insects, beetles, mollusks and crustaceans.

(Mowbray, 1999; Knapton and Pauls, 1994)

Animal Foods: insects; terrestrial non-insect arthropods; mollusks

Plant Foods: leaves; wood, bark, or stems; seeds, grains, and nuts; fruit

Primary Diet: herbivore (Folivore , Granivore )

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Comments: Feeds on leaves, stems, buds, and some seeds of pondweeds, wigeon grass, grasses, and sedges. Forages in shallow water and grazes in fields. May also take some snails, beetles, and crickets (Terres 1980).

On the water, primarily in wintering areas, they may be closely associated with American Coots (Fulica americana) and various species of diving ducks, pilfering plant material brought to the surface by these species as they themselves are not proficient divers (Birds of North America online, accessed December 2012).

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Food Habits

Shallow, freshwater wetlands, marshes, mudflats, slow moving rivers, and ponds are all potential areas for foraging for wigeons. These are areas where the abundance of emergent plant life and insects is the greatest. They will feed on a variety of aquatic insects such as damselflies and caddisflies, as well as terrestrial insects such as beetles. This type of food comprises a small part of their diet however. The largest food source is stems and leafy parts of aquatic plants, grasses, and agricultural plants. They particularly prefer muskgrasses and bushy pondweed. Differences between juvenile and adult food preferences have been noted.

These birds are better adapted morphologically and physiologically for grazing on aquatic and terrestrial plants than most other North American birds. They use the strength in the tip of their bill to pluck vegetation and also filter feed with the lamellae on the upper mandible. They are opportunistic and aggressive feeders, often foraging in open water on materials brought to the surface by diving ducks and coots.

Common foods eaten include: stems and leafy parts of aquatic plants, leafy parts of upland grasses, leafy parts and seeds of agricultural plants, aquatic insects, beetles, mollusks and crustaceans.

(Mowbray, 1999; Knapton and Pauls, 1994)

Animal Foods: insects; terrestrial non-insect arthropods; mollusks

Plant Foods: leaves; wood, bark, or stems; seeds, grains, and nuts; fruit

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: BioKIDS Critter Catalog

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Associations

If a female senses a predator while incubating she will rise silently and fly far away from the nest or toward the water to distract the predator. Females also perform a distraction display where they will feign injury, flap their wings over water, vocalize, and possibly become aggressive toward an intruder.(Mowbray, 1999)

Known Predators:

  • California gulls (Larus californicus)
  • American crows (Corvus brachyrhynchos)
  • striped skunks (Mephitis mephitis)
  • Franklin's ground squirrels (Spermophilus franklinii)
  • red foxes (Vulpes vulpes)
  • short tailed weasels (Mustela erminea)
  • northern harriers (Circus cyaneus)
  • American badgers (Taxidea taxus)

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Predation

If a female senses a predator while incubating she will rise silently and fly far away from the nest or toward the water to distract the predator. Females also perform a distraction display where they will feign injury, flap their wings over water, vocalize, and possibly become aggressive toward an intruder.(Mowbray, 1999)

Known Predators:

  • California gulls (Larus_californicus)
  • American crows (Corvus_brachyrhynchos)
  • striped skunks (Mephitis_mephitis)
  • Franklin's ground squirrels (Spermophilus_franklinii)
  • red foxes (Vulpes_vulpes)
  • short tailed weasels (Mustela_erminea)
  • northern harriers (Circus_cyaneus)
  • American badgers (Taxidea_taxus)

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: BioKIDS Critter Catalog

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Known predators

Anas americana is prey of:
Circus cyaneus
Larus californicus
Corvus brachyrhynchos
Spermophilus franklinii
Mustela erminea
Mephitis mephitis
Taxidea taxus
Vulpes vulpes

This list may not be complete but is based on published studies.
Creative Commons Attribution 3.0 (CC BY 3.0)

© SPIRE project

Source: SPIRE

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Known prey organisms

Anas americana preys on:
Mollusca
Arthropoda
Insecta

This list may not be complete but is based on published studies.
Creative Commons Attribution 3.0 (CC BY 3.0)

© SPIRE project

Source: SPIRE

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Life History and Behavior

Behavior

Diet

plant life and aquatic insects
translation missing: en.license_cc_by_4_0

© WoRMS for SMEBD

Source: World Register of Marine Species

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Perception Channels: visual ; tactile ; acoustic ; chemical

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Life Expectancy

Reports of longevity vary considerably between sources. There have been recorded accounts of American wigeons up to 21 years of age. The average lifespan for a female is 1.7 years and the average lifespan for a male is 2.3 years.(Mowbray, 1999)

Range lifespan

Status: wild:
21 (high) years.

Typical lifespan

Status: wild:
20.68 to 27.98 months.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Lifespan/Longevity

Reports of longevity vary considerably between sources. There have been recorded accounts of American wigeons up to 21 years of age. The average lifespan for a female is 1.7 years and the average lifespan for a male is 2.3 years.(Mowbray, 1999)

Range lifespan

Status: wild:
21 (high) years.

Typical lifespan

Status: wild:
20.68 to 27.98 months.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: BioKIDS Critter Catalog

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Lifespan, longevity, and ageing

Maximum longevity: 21.3 years (wild)
Creative Commons Attribution 3.0 (CC BY 3.0)

© Joao Pedro de Magalhaes

Source: AnAge

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Reproduction

Mating System: monogamous

Pair formation can begin with the arrival on wintering grounds. Breeding is not controlled strictly by photoperiod, but is also infleunced by habitat quality and food availability on the wintering grounds. Presumably the female selects the nest site, which is well concealed on dry ground and away from the water. Nests are typically found in areas of tall grasses and brush cover and in fairly close proximity to a food supply. They are constructed primarily of grasses and weed stems and lined with down. Incubation begins at the completion of the clutch and usually continues for an average of 25 days. The female spends almost 90% of the day on the nest; when the paired male is not accompanying the female in feeding, he spends the majority of his time on the water. He remains with the female only until the second week of incubation.

Young are precocial at hatching. They are able to leave the nest with the female less than 24 hours after hatching. They feed eagerly by dabbling and off the surface. Fledgling age is estimated at between 37 and 48 days. This period varies depending on factors such as habitat and climatic conditions, age and condition of female, and time of hatching.

Breeding season: Spring

Range eggs per season: 3 to 12.

Average time to hatching: 25 days.

Range fledging age: 37 to 48 days.

Average age at sexual or reproductive maturity (female): 1 years.

Average age at sexual or reproductive maturity (male): 1 years.

Key Reproductive Features: iteroparous ; seasonal breeding ; gonochoric/gonochoristic/dioecious (sexes separate); sexual ; oviparous

Average time to hatching: 23 days.

Average eggs per season: 10.

Females provide care of the offspring once they hatch. (Ehrlich et al., 1988)

Parental Investment: precocial ; pre-fertilization (Provisioning, Protecting: Female); pre-hatching/birth (Protecting: Female)

  • Ehrlich, P., D. Dobkin, D. Wheye. 1988. "Birds of Stanford: American Wigeon" (On-line). Accessed 23 September 2002 at http://www.stanfordalumni.org/birdsite/text/species/American_Wigeon.html.
  • Mowbray, T. 1999. American Wigeon, No. 401. Pp. 1-32 in A Poole, F Gill, eds. The Birds of North America. Washington, DC: The Academy of Natural Sciences, Philadelphia, PA, and The American Ornithologists' Union.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Breeding begins early May in south to early June in north. Clutch size is 6-12 (usually 9-11). Incubation, by female, lasts 22-24 days (Terres 1980). Young are tended by female, independent in about 6-7 weeks (Harrison 1978).

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Mating System: monogamous

Pair formation can begin with the arrival on wintering grounds. Breeding is not controlled strictly by photoperiod, but is also infleunced by habitat quality and food availability on the wintering grounds. Presumably the female selects the nest site, which is well concealed on dry ground and away from the water. Nests are typically found in areas of tall grasses and brush cover and in fairly close proximity to a food supply. They are constructed primarily of grasses and weed stems and lined with down. Incubation begins at the completion of the clutch and usually continues for an average of 25 days. The female spends almost 90% of the day on the nest; when the paired male is not accompanying the female in feeding, he spends the majority of his time on the water. He remains with the female only until the second week of incubation.

Young are precocial at hatching. They are able to leave the nest with the female less than 24 hours after hatching. They feed eagerly by dabbling and off the surface. Fledgling age is estimated at between 37 and 48 days. This period varies depending on factors such as habitat and climatic conditions, age and condition of female, and time of hatching.

Breeding season: Spring

Range eggs per season: 3 to 12.

Average time to hatching: 25 days.

Range fledging age: 37 to 48 days.

Average age at sexual or reproductive maturity (female): 1 years.

Average age at sexual or reproductive maturity (male): 1 years.

Key Reproductive Features: seasonal breeding ; gonochoric/gonochoristic/dioecious (sexes separate)

Average time to hatching: 23 days.

Average eggs per season: 10.

Females provide care of the offspring once they hatch. (Ehrlich et al., 1988)

Parental Investment: precocial ; pre-fertilization (Provisioning, Protecting: Female); pre-hatching/birth (Protecting: Female)

  • Ehrlich, P., D. Dobkin, D. Wheye. 1988. "Birds of Stanford: American Wigeon" (On-line). Accessed 23 September 2002 at http://www.stanfordalumni.org/birdsite/text/species/American_Wigeon.html.
  • Mowbray, T. 1999. American Wigeon, No. 401. Pp. 1-32 in A Poole, F Gill, eds. The Birds of North America. Washington, DC: The Academy of Natural Sciences, Philadelphia, PA, and The American Ornithologists' Union.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: BioKIDS Critter Catalog

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Barcode data: Anas americana

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There are 8 barcode sequences available from BOLD and GenBank.

Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.

See the BOLD taxonomy browser for more complete information about this specimen and other sequences.

NNNNNNCCTTATCTTCGGGGCATGANCTGGAATAATTGGCACAGCACTCAGCCTGCTAATCCGCGCAGAACTAGGCCAACCAGGGACCCTCCTGGGCGACGACCAAATTTATAACGTGATCGTCACCGCTCACGCCTTTGTAATAATCTTCTTCATAGTAATGCCCATCATAATTGGGGGATTTGGCAACTGACTGGTCCCCCTAATAATCGGTGCCCCCGACATAGCATTCCCACGAATAAACAACATAAGCTTCTGACTCCTCCCGCCGTCATTCCTCCTACTACTCGCCTCATCCACCGTAGAAGCTGGCGCTGGCACAGGTTGAACCGTGTACCCACCCCTAGCAGGCAACCTGGCCCACGCCGGAGCCTCGGTAGACCTGGCTATCTTCTCACTTCACCTAGCCGGTGTCTCCTCCATCCTCGGAGCCATTAACTTCATTACCACGGCCATCAACATAAAACCCCCCGCACTCTCACAATACCAAACCCCACTTTTCGTTTGATCGGTCCTAATTACCGCCATCCTACTCCTCCTATCACTCCCCGTCCTCGCCGCCGGCATCACAATACTATTAACCGACCGAAACCTAAACACCACATTCTTTGACCCCGCCGGAGGAGGAGACCCAATCCTGTACCAACACCTATTTTGATTCTTTGGCCACCCAGAAGTCTATATCTTAATTCTC
-- end --

Download FASTA File

Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Statistics of barcoding coverage: Anas americana

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 8
Specimens with Barcodes: 8
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Conservation

Conservation Status

IUCN Red List Assessment


Red List Category
LC
Least Concern

Red List Criteria

Version
3.1

Year Assessed
2012

Assessor/s
BirdLife International

Reviewer/s
Butchart, S. & Symes, A.

Contributor/s

Justification
This species has an extremely large range, and hence does not approach the thresholds for Vulnerable under the range size criterion (Extent of Occurrence <20,000 km2 combined with a declining or fluctuating range size, habitat extent/quality, or population size and a small number of locations or severe fragmentation). The population trend appears to be stable, and hence the species does not approach the thresholds for Vulnerable under the population trend criterion (>30% decline over ten years or three generations). The population size is extremely large, and hence does not approach the thresholds for Vulnerable under the population size criterion (<10,000 mature individuals with a continuing decline estimated to be >10% in ten years or three generations, or with a specified population structure). For these reasons the species is evaluated as Least Concern.

History
  • Least Concern (LC)
  • Least Concern (LC)
  • Least Concern (LC)
  • Lower Risk/least concern (LR/lc)
  • Lower Risk/least concern (LR/lc)
  • Lower Risk/least concern (LR/lc)
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5