Articles on this page are available in 1 other language: Chinese (Simplified) (6) (learn more)

Overview

Distribution

Range

Palearctic; winters to s Africa and Australasian region.
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

 

Partner Web Site: Cornell Laboratory of Ornithology

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Djibouti, Eritrea, Gulf of Maine, Gulf of Mexico, North West Atlantic, Polish Exclusive Economic Zone, Portuguese Exclusive Economic Zone, Red Sea, Somalia, Spanish Exclusive Economic Zone, United Kingdom Exclusive Economic Zone
Creative Commons Attribution 3.0 (CC BY 3.0)

© WoRMS for SMEBD

Source: World Register of Marine Species

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

North America; Oceania; accidental from Eurasia; many records from Maritimes and East Coast as well as inland
Creative Commons Attribution 3.0 (CC BY 3.0)

© WoRMS for SMEBD

Source: World Register of Marine Species

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

occurs (regularly, as a native taxon) in multiple nations

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

National Distribution

United States

Origin: Native

Regularity: Regularly occurring

Currently: Present

Confidence: Confident

Type of Residency: Transient

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Global Range: (>2,500,000 square km (greater than 1,000,000 square miles)) BREEDING: Eurasia. NON-BREEDING: south to Old World tropics, east to Phillipines, occasionally west to Hawaii. Accidental in most of North America (some of these records may be based on escapes) (AOU 1983, Pratt et al. 1987). Regular migrant in Alaska (NGS 1983).

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Physical Description

Size

Length: 39 cm

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Diagnostic Description

Description

Length: 37-41 cm. Plumage: Breeding male vermiculated grey flanks, dark back, mottled brown breast; Head, neck and breast dark chestnut brown with paler mottling on breast and cheeks; bold white eyebrow stripe from above eye to nape; wing blue-grey, primaries darker, speculum green with white trailing edge above. Female and eclipse male brown with wide pale edges to feathers giving mottled appearance; distinctive white eyebrow and white loral patch; speculum green; belly white in all plumages. Immature like female but with spotted belly. Bare parts: iris dark or umber brown, grey in immature; bill black or grey; feet and legs dull olive grey. Habitat: rare on coastal waters of Red Sea, prefers inland water bodies.<388><391><393>
Creative Commons Attribution 3.0 (CC BY 3.0)

© WoRMS for SMEBD

Source: World Register of Marine Species

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Ecology

Habitat

Habitat and Ecology

Habitat and Ecology
Behaviour This species is highly migratory, breeding widely across Western Eurasia and wintering within the northern tropics16. It migrates on a broad front, the autumn migration beginning in late July and peaking in August or early September (in Europe and Egypt), with birds beginning to arrive in East and West Africa in early September, peaking in October16. Once the species reaches Africa it migrates in relation to seasonal flooding, the central point of its occurrence shifting gradually along the course of rivers as the winter progresses17. The spring migration begins in February, with birds beginning to arrive on breeding grounds from mid-March to early-May16. It is a highly sociable and gregarious species3, 4, and whilst breeding can be found in single pairs or small groups, but regularly forms large congregations of several hundred on passage, and flocks of up to several thousand are common in African and Asiatic winter quarters3, 4. Adults undergo a post-breeding moult period that leaves them flightless for 3-4 weeks, with males moulting between mid-July and mid-August, and females between mid-August and September4, 5. The Volga Delta, in particular, is a major moulting area for this species15. Birds of this species are both diurnal and nocturnal feeders, and when migrating often travel by night and rest on open water during the day1. Habitat Breeding In the breeding season this species frequents small, shallow ponds and lakes with abundant floating, emergent and fringing vegetation1, 2 (that is not too tall or dense, such as bulrush - Typha spp.)4, 10, in grass dominated environments, like swampy meadows, flooded fields, shallow freshwater marshes1, 2, 18. Non-breeding During this season the species shows a preference for large freshwater or occasionally brackish lakes, again with abundant floating, emergent and fringing vegetation5, also shallow flood plains, shallow dams, pans and sewage ponds (in South Africa)11. The species also frequents coastal saltmarshes and lagoons on passage2 and may spend the day resting on marine inshore waters when migrating3. Diet Breeding When breeding this species is omnivorous1. In spring and summer its diet is dominated by animal matter: chiefly molluscs, aquatic insects and their larvae (waterbugs, caddisfly, waterbeetles, midges), crustaceans (ostracods and phyllopods especially), worms, leeches, young and spawn of frogs, and small fish1, 11. Seeds, roots, tubers, stems, leaves and buds of plants such as Hornwort Ceratophyllum, Naiad Najas, sedge, grass and other aquatic plants are also important at this time1, 2, 4. Non-breeding During this season the birds are mainly vegetarian, with a diet dominated by the seeds of pondweeds, smartweeds Polygonum, sedges, dock Rumex, wild rice and grass5, (with the seeds of Echinochloa colona, Nymphea micranthia and Nymphea lotus being the most preferred food items)19. Breeding site Meadows are the favoured nesting areas of this species, with nests rarely located more than 150 m from water (usually within 20 m)4. The nest itself is a depression in the ground, typically situated under rushes or tall grasses (such as manna grass, Glyceria), but not generally under shrubs1, 2.

Systems
  • Terrestrial
  • Freshwater
  • Marine
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Comments: Shallow inland lakes, ponds, and streams bordered with dense emergent vegetation, reed beds, or marshes; winters primarily on fresh water but also in brackish and marine situations (AOU 1983).

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Migration

Non-Migrant: No. All populations of this species make significant seasonal migrations.

Locally Migrant: No. No populations of this species make local extended movements (generally less than 200 km) at particular times of the year (e.g., to breeding or wintering grounds, to hibernation sites).

Locally Migrant: Yes. At least some populations of this species make annual migrations of over 200 km.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Life History and Behavior

Life Expectancy

Lifespan, longevity, and ageing

Maximum longevity: 14.5 years (wild)
Creative Commons Attribution 3.0 (CC BY 3.0)

© Joao Pedro de Magalhaes

Source: AnAge

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Barcode data: Anas querquedula

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There are 3 barcode sequences available from BOLD and GenBank.  Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.  See the BOLD taxonomy browser for more complete information about this specimen and other sequences.

TCTATACCTTATCTTCGGGGCATGAGCCGGAATAATTGGCACAGCACTAAGCCTACTAATCCGCGCAGAACTTGGTCAACCAGGAACCCTCCTGGGCGATGACCAAATTTACAACGTGATCGTCACCGCTCACGCCTTTGTAATAATTTTCTTCATAGTAATGCCCATCATAATTGGGGGATTTGGCAACTGATTGGTCCCCCTGATAATCGGTGCCCCCGACATAGCATTCCCACGAATAAATAACATAAGCTTCTGACTCCTTCCACCATCATTCCTTCTACTACTCGCCTCATCTACCGTAGAAGCTGGCGCTGGCACAGGTTGAACCGTGTACCCGCCCCTAGCAGGCAACCTAGCCCATGCCGGGGCATCAGTAGACCTGGCCATTTTCTCACTCCACCTAGCCGGTGTTTCCTCCATCCTTGGAGCCATTAACTTCATTACCACAGCCATCAACATAAAACCCCCTGCACTCTCACAGTACCAAACCCCACTTTTCGTCTGATCAGTCCTAATTACCGCCATCCTGCTCCTCCTGTCACTTCCTGTCCTTGCCGCCGGCATTACAATGCTGCTAACCGACCGGAACCTAAACACTACATTCTTTGACCCTGCCGGAGGAGGAGACCCGATCCTGTACCAACACCTATTTTGATTCTTCGGCCACCCAGAAGTTTATATCTTAATTCTT
-- end --

Download FASTA File
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Statistics of barcoding coverage: Anas querquedula

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 1
Specimens with Barcodes: 5
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Conservation

Conservation Status

IUCN Red List Assessment


Red List Category
LC
Least Concern

Red List Criteria

Version
3.1

Year Assessed
2009

Assessor/s
BirdLife International

Reviewer/s
Bird, J., Butchart, S.

Contributor/s

Justification
This species has an extremely large range, and hence does not approach the thresholds for Vulnerable under the range size criterion (Extent of Occurrence <20,000 km2 combined with a declining or fluctuating range size, habitat extent/quality, or population size and a small number of locations or severe fragmentation). Despite the fact that the population trend appears to be decreasing, the decline is not believed to be sufficiently rapid to approach the thresholds for Vulnerable under the population trend criterion (>30% decline over ten years or three generations). The population size is extremely large, and hence does not approach the thresholds for Vulnerable under the population size criterion (<10,000 mature individuals with a continuing decline estimated to be >10% in ten years or three generations, or with a specified population structure). For these reasons the species is evaluated as Least Concern.

History
  • 2008
    Least Concern
  • 2004
    Least Concern
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Status in Egypt

Regular passage visitor and winter visitor.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Bibliotheca Alexandrina

Source: Bibliotheca Alexandrina - EOL Ar

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

National NatureServe Conservation Status

United States

Rounded National Status Rank: NNA - Not Applicable

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

NatureServe Conservation Status

Rounded Global Status Rank: G5 - Secure

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Threats

Major Threats
Breeding The most significant threat encountered by this species on its breeding grounds in Europe is habitat deterioration through the drainage and reclamation of wetlands5, the increasing climatic aridity and subsequent lowering of the water table, and the transformation of wetlands to dammed reservoirs16. Other threats to this species include the destruction of nests during the early mowing of meadows5, increased human disturbance5, lead poisoning, botulism during hot summers5 and hunting disturbance in Africa and Europe7 (> 500,000 are shot annually in Russia, Ukraine, France and Poland)5. The invasive species American Mink Mustela vison also poses a threat through nest predation6, and the species is susceptible to avian influenza (particularly strain H5N1) so is therefore threatened by outbreaks of the virus12. Non-breeding On its wintering grounds in Nigeria and Senegal the species is threatened by habitat destruction through dam construction, vegetation overgrowth and desertification2, 8, 9, and in West Africa it is threatened by large-scale river diversion and irrigation schemes16. The species is also at risk from avain influenza in its African wintering grounds21 as well as in its breeding areas12. The proportion of the species which migrates via the West Siberian flyway is susceptible to West Nile Virus, and is therefore threatened by future outbreaks20. Utilisation This species is hunted in Denmark , but there is evidence that this may be sustainable13. The species is also hunted for commercial and recreational purposes in Gilan Province, northern Iran22.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Wikipedia

Garganey

The Garganey (Anas querquedula) is a small dabbling duck. It breeds in much of Europe and western Asia, but is strictly migratory, with the entire population moving to southern Africa, India (in particular Santragachi), and Australasia in winter,[2] where large flocks can occur. This species was first described by Linnaeus in 1758 under its current scientific name.[3] Like other small ducks such as the Common Teal, this species rises easily from the water with a fast twisting wader-like flight.

Their breeding habitat is grassland adjacent to shallow marshes and steppe lakes.

Contents

Description

The adult male is unmistakable, with its brown head and breast with a broad white crescent over the eye. The rest of the plumage is grey, with loose grey scapular feathers It has a grey bill and legs. In flight it shows a pale blue speculum with a white border. When swimming it will show prominent white edges on its tertials. His crown (anatomy) is dark and face is reddish-brown.[4]

Females

Some care is needed in separating the brown female from the similar Common Teal, but the stronger face markings and more frequent head-shaking when dabbling are good indicators. Confusion with the female of the Blue-winged Teal is also possible, but the head and bill shape is different, and the latter species has yellow legs. Pale eyebrow, dark eye line, pale lore spot bordered by a second dark line.[4]

These birds feed mainly by skimming rather than upending.

The male has a distinctive crackling mating call; the female is rather silent for a female duck, but can manage a feeble quack.

Garganey are rare breeding birds in the British Isles, with most breeding in quiet marshes in Norfolk and Suffolk. In Ireland a few pairs now breed annually in Wexford.

The Garganey is one of the species to which the Agreement on the Conservation of African-Eurasian Migratory Waterbirds (AEWA) applies. The status of the Garganey on the IUCN Red List is Least Concern.[1]

Etymology

The common English name dates from the 17th century and comes from dialect Italian gargenei, a variant of garganello, which ultimately comes from the Late Latin gargala "tracheal artery".[5] The English usage owes its origins to Conrad Gesner who used the Italian name in the third volume of his Historiae Animalium (History of Animals) of 1555.[6]

References

  1. ^ a b BirdLife International (2009). "Anas querquedula". IUCN Red List of Threatened Species. Version 2010.3. International Union for Conservation of Nature. http://www.iucnredlist.org/apps/redlist/details/141529/0. Retrieved 25 August 2010.
  2. ^ Clements, James, (2007) The Clements Checklist of the Birds of the World, Cornell University Press, Ithaca
  3. ^ Linnaeus, C. (1758) (in Latin). Systema Naturae. Holmiae. (Laurentii Salvii).. p. 126. "A. macula alarum viridi, linea alba supra oculos.."
  4. ^ a b Dunn, J. & Alderfer, J. (2006) National Geographic Field Guide to the Birds of North America 5th Ed.
  5. ^ American Heritage Dictionary: . Accessed 1/6/07
  6. ^ Oxford English Dictionary, online edition. Accessed 1/6/07
Creative Commons Attribution Share Alike 3.0 (CC BY-SA 3.0)

 

Source: Wikipedia

Unreviewed

Article rating from 0 people

Average rating: 2.5 of 5

Names and Taxonomy

Taxonomy

Comments: See Livezey (1991) for a phylogenetic analysis and classification (supergenera, subgenera, infragenera, etc.) of dabbling ducks based on comparative morphology.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!