Articles on this page are available in 1 other language: Chinese (Simplified) (6) (learn more)

Overview

Distribution

occurs (regularly, as a native taxon) in multiple nations

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

National Distribution

United States

Origin: Native

Regularity: Regularly occurring

Currently: Present

Confidence: Confident

Type of Residency: Transient

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Global Range: (>2,500,000 square km (greater than 1,000,000 square miles)) BREEDING: Eurasia. NON-BREEDING: south to Old World tropics, east to Phillipines, occasionally west to Hawaii. Accidental in most of North America (some of these records may be based on escapes) (AOU 1983, Pratt et al. 1987). Regular migrant in Alaska (NGS 1983).

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

North America; Oceania; accidental from Eurasia; many records from Maritimes and East Coast as well as inland
  • North-West Atlantic Ocean species (NWARMS)
Creative Commons Attribution 3.0 (CC BY 3.0)

© WoRMS for SMEBD

Source: World Register of Marine Species

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Range

Palearctic; winters to s Africa and Australasian region.

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Physical Description

Size

Length: 39 cm

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Diagnostic Description

Description

Length: 37-41 cm. Plumage: Breeding male vermiculated grey flanks, dark back, mottled brown breast; Head, neck and breast dark chestnut brown with paler mottling on breast and cheeks; bold white eyebrow stripe from above eye to nape; wing blue-grey, primaries darker, speculum green with white trailing edge above. Female and eclipse male brown with wide pale edges to feathers giving mottled appearance; distinctive white eyebrow and white loral patch; speculum green; belly white in all plumages. Immature like female but with spotted belly. Bare parts: iris dark or umber brown, grey in immature; bill black or grey; feet and legs dull olive grey. Habitat: rare on coastal waters of Red Sea, prefers inland water bodies.<388><391><393>
  • Brown, L.H., E.K. Urban & K. Newman (1982). The Birds of Africa, Volume I. Academic Press, London.
Creative Commons Attribution 3.0 (CC BY 3.0)

© WoRMS for SMEBD

Source: World Register of Marine Species

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Ecology

Habitat

Comments: Shallow inland lakes, ponds, and streams bordered with dense emergent vegetation, reed beds, or marshes; winters primarily on fresh water but also in brackish and marine situations (AOU 1983).

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Migration

Non-Migrant: No. All populations of this species make significant seasonal migrations.

Locally Migrant: No. No populations of this species make local extended movements (generally less than 200 km) at particular times of the year (e.g., to breeding or wintering grounds, to hibernation sites).

Locally Migrant: Yes. At least some populations of this species make annual migrations of over 200 km.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Life History and Behavior

Life Expectancy

Lifespan, longevity, and ageing

Maximum longevity: 14.5 years (wild)
Creative Commons Attribution 3.0 (CC BY 3.0)

© Joao Pedro de Magalhaes

Source: AnAge

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Barcode data: Anas querquedula

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There are 3 barcode sequences available from BOLD and GenBank.

Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.

See the BOLD taxonomy browser for more complete information about this specimen and other sequences.

TCTATACCTTATCTTCGGGGCATGAGCCGGAATAATTGGCACAGCACTAAGCCTACTAATCCGCGCAGAACTTGGTCAACCAGGAACCCTCCTGGGCGATGACCAAATTTACAACGTGATCGTCACCGCTCACGCCTTTGTAATAATTTTCTTCATAGTAATGCCCATCATAATTGGGGGATTTGGCAACTGATTGGTCCCCCTGATAATCGGTGCCCCCGACATAGCATTCCCACGAATAAATAACATAAGCTTCTGACTCCTTCCACCATCATTCCTTCTACTACTCGCCTCATCTACCGTAGAAGCTGGCGCTGGCACAGGTTGAACCGTGTACCCGCCCCTAGCAGGCAACCTAGCCCATGCCGGGGCATCAGTAGACCTGGCCATTTTCTCACTCCACCTAGCCGGTGTTTCCTCCATCCTTGGAGCCATTAACTTCATTACCACAGCCATCAACATAAAACCCCCTGCACTCTCACAGTACCAAACCCCACTTTTCGTCTGATCAGTCCTAATTACCGCCATCCTGCTCCTCCTGTCACTTCCTGTCCTTGCCGCCGGCATTACAATGCTGCTAACCGACCGGAACCTAAACACTACATTCTTTGACCCTGCCGGAGGAGGAGACCCGATCCTGTACCAACACCTATTTTGATTCTTCGGCCACCCAGAAGTTTATATCTTAATTCTT
-- end --

Download FASTA File

Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Statistics of barcoding coverage: Anas querquedula

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 3
Specimens with Barcodes: 5
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Conservation

Conservation Status

National NatureServe Conservation Status

United States

Rounded National Status Rank: NNA - Not Applicable

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

NatureServe Conservation Status

Rounded Global Status Rank: G5 - Secure

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Status in Egypt

Regular passage visitor and winter visitor.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Bibliotheca Alexandrina

Source: Bibliotheca Alexandrina - EOL Ar

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Wikipedia

Garganey

The garganey (Anas querquedula) is a small dabbling duck. It breeds in much of Europe and western Asia, but is strictly migratory, with the entire population moving to southern Africa, India (in particular Santragachi), and Australasia in winter,[2] where large flocks can occur. This species was first described by Linnaeus in 1758 under its current scientific name.[3] Like other small ducks such as the common teal, this species rises easily from the water with a fast twisting wader-like flight.

Their breeding habitat is grassland adjacent to shallow marshes and steppe lakes.

Description[edit]

The adult male is unmistakable, with its brown head and breast with a broad white crescent over the eye. The rest of the plumage is grey, with loose grey scapular feathers It has a grey bill and legs. In flight it shows a pale blue speculum with a white border. When swimming it will show prominent white edges on its tertials. His crown (anatomy) is dark and face is reddish-brown.[4]

Females

Some care is needed in separating the brown female from the similar common teal, but the stronger face markings and more frequent head-shaking when dabbling are good indicators. Confusion with the female of the blue-winged teal is also possible, but the head and bill shape is different, and the latter species has yellow legs. Pale eyebrow, dark eye line, pale lore spot bordered by a second dark line.[4]

These birds feed mainly by skimming rather than upending.

The male has a distinctive crackling mating call; the female is rather silent for a female duck, but can manage a feeble quack.

Garganey are rare breeding birds in the British Isles, with most breeding in quiet marshes in Norfolk and Suffolk. In Ireland a few pairs now breed in Wexford, with occasional breeding elsewhere.

The garganey is one of the species to which the Agreement on the Conservation of African-Eurasian Migratory Waterbirds (AEWA) applies. The status of the garganey on the IUCN Red List is Least Concern.[1]

Etymology[edit]

The common English name dates from the 17th century and comes from dialect Italian gargenei, a variant of garganello, which ultimately comes from the Late Latin gargala "tracheal artery".[5] The English usage owes its origins to Conrad Gesner who used the Italian name in the third volume of his Historiae Animalium (History of Animals) of 1555.[6]

References[edit]

  1. ^ a b BirdLife International (2012). "Anas querquedula". IUCN Red List of Threatened Species. Version 2013.2. International Union for Conservation of Nature. Retrieved 26 November 2013. 
  2. ^ Clements, James, (2007) The Clements Checklist of the Birds of the World, Cornell University Press, Ithaca
  3. ^ Linnaeus, C. (1758). Systema Naturae (in Latin). Holmiae. (Laurentii Salvii). p. 126. "A. macula alarum viridi, linea alba supra oculos.." 
  4. ^ a b Dunn, J. & Alderfer, J. (2006) National Geographic Field Guide to the Birds of North America 5th Ed.
  5. ^ American Heritage Dictionary: . Accessed 1/6/07
  6. ^ Oxford English Dictionary, online edition. Accessed 1/6/07
Creative Commons Attribution Share Alike 3.0 (CC BY-SA 3.0)

Source: Wikipedia

Unreviewed

Article rating from 0 people

Default rating: 2.5 of 5

Names and Taxonomy

Taxonomy

Comments: See Livezey (1991) for a phylogenetic analysis and classification (supergenera, subgenera, infragenera, etc.) of dabbling ducks based on comparative morphology.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!