Articles on this page are available in 2 other languages: Chinese (Simplified) (6), Dutch (1) (learn more)

Overview

Brief Summary

Anas penelope

The Eurasian Widgeon is the Old World counterpart to the American Widgeon (Anas americana). The male of this species may be separated from the male American Widgeon by its buff crown, reddish-brown head, pink breast and grey body. The female Eurasian Widgeon is more similar in appearance to the female American Widgeon, but has a slight reddish cast to the head. The Eurasian Widgeon is slightly smaller than the American Widgeon at 18-20 inches long. The Eurasian Widgeon breeds across northern Eurasia. In winter, this species may be found from Europe south to Southeast Asia, India, and North Africa. The Eurasian Widgeon is also a rare visitor to coastal North America in winter. On its breeding grounds in the Old World, the Eurasian Widgeon inhabits freshwater marshes and slow-moving rivers. In winter, this species becomes more amenable to saltwater, and may be found on sheltered bays and lagoons. Like the American Widgeon, Eurasian Widgeons feed primarily on aquatic plants and grasses in winter, but they may also consume insects and other small invertebrates during the breeding season. Eurasian Widgeons may be seen either on land or in the water, where they may be observed foraging for food. Winter visitors to North America are often found in small numbers mixed in with larger flocks of American Widgeons. Eurasian Widgeons are most active during the day.

Threat Status: Least concern

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Unknown

Supplier: DC Birds

Trusted

Article rating from 2 people

Average rating: 4.625 of 5

Wigeons can whistle. At least, the 'wew wew' made by the males sounds sort of like a flute. They are pure herbivores. The birds graze at night preferably in wet fields and sleep during the day in large open waters.
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© Copyright Ecomare

Source: Ecomare

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Biology

The wigeon is a grazer but will take grain when available. In May, the drakes erect their small crests and display to females, but once mating has taken place, they take no further part in rearing the young. The female constructs a nest on the ground amongst bracken or heather, and lines it with dried grass and down from her own breast. The eggs are buff-coloured, and there may be eight in the clutch. They are incubated for 25 days and the ducklings leave the nest soon after hatching. Attended by their mother, they fly after about 40 days.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Description

The wigeon is a medium-sized duck with a well-known whistling call - 'wheeooo' - familiar to all who have witnessed their huge winter flocks on the fens and coastal marshes of Norfolk. Drakes (males) in breeding plumage have grey backs, white bellies and pink chests. The head is chestnut in colour with a buff forehead, while the tail is predominantly black. After moulting, when the plumage is said to be in 'eclipse', the drakes resemble the females, which are grey or buff-coloured birds with a white underside. The drakes are rather more rufous than the females, however. Juveniles look very similar to females.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Comprehensive Description

Description of Anas penelope

Het mannetje heeft een oranjerode kop en het vrouwtje is grotendeels bruin.
Creative Commons Attribution 3.0 (CC BY 3.0)

1geron

Source: BioPedia

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Distribution

occurs (regularly, as a native taxon) in multiple nations

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

National Distribution

Canada

Origin: Native

Regularity: Regularly occurring

Currently: Present

Confidence: Confident

Type of Residency: Non-breeding

United States

Origin: Native

Regularity: Regularly occurring

Currently: Present

Confidence: Confident

Type of Residency: Non-breeding

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Global Range: (>2,500,000 square km (greater than 1,000,000 square miles)) BREEDING: in Eurasia from Iceland, British Isles, and Scandinavia east to eastern Siberia and Kamchatka, south to northern Europe, central Russia, and Transcaucasia. NON-BREEDING: in Old World from Iceland, British Isles, northern Europe, southern Russia, and Japan south to the eastern Atlantic islands, Africa, Arabia, India, Malay Peninsula, southern China, Formosa, and the Philippines. In North America on the Pacific coast from southeastern Alaska to northern Baja California and on the Atlantic-Gulf coast from Labrador and Newfoundland south to Florida and west to southern Texas. Casual in Ceylon, Borneo, Celebes, Greenland, and Hawaii (AOU 1983).

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

North America; regular visitor to the Atlantic Provinces
  • North-West Atlantic Ocean species (NWARMS)
Creative Commons Attribution 3.0 (CC BY 3.0)

© WoRMS for SMEBD

Source: World Register of Marine Species

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Range

N and central Eurasia; winters to Africa and s Asia.

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Range

Although there is a population that winters along the east coast of the USA, most wigeon are Eurasian birds, ranging from the Mediterranean north to Scandinavia, Russia and Siberia, north to the Barents Sea. These northern populations migrate south to spend winter in southern Europe and the UK. The birds also breed in northern Britain, principally in the Scottish uplands.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Physical Description

Size

Length: 51 cm

Weight: 819 grams

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Diagnostic Description

Description

Length: 45-51 cm. Plumage: body vermiculated grey; head chestnut with buffy-cream forehead and crown and pinkish chest; flight feathers , tail and undertail coverts black with a white line dividing undertail coverts from grey flanks; speculum green and black. Eclipse male and female greyish or rufous brown (male with rich chestnut breast and sides) with paler edges to feathers; head paler with black around eyes; belly white and prominent white forewing in all plumages. Immature like female. Bare parts: iris brown; bill pale blue grey with darker edges and tip; feet and legs dark grey. Habitat: salt marshes, tidal flats, estuaries, or lagoons; also inland waters; space and good visibility required.<388><391>
  • Brown, L.H., E.K. Urban & K. Newman (1982). The Birds of Africa, Volume I. Academic Press, London.
Creative Commons Attribution 3.0 (CC BY 3.0)

© WoRMS for SMEBD

Source: World Register of Marine Species

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Ecology

Habitat

Comments: Winters primarily in freshwater (marshes, lakes) and brackish situations in coastal areas but migrates extensively through inland regions; occurs in shallow water and fields and meadows. Nests on ground among concealing vegetation, usually near freshwater but often some distance away, in areas of taiga, forest, and less commonly in open moors and cultivated country (AOU 1983).

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Habitat and Ecology

Habitat and Ecology
Behaviour The species is strongly migratory, undertaking significant cold weather movements of varying magnitude (Scott and Rose 1996). It leaves its breeding grounds in late summer (September) to arrive in its wintering grounds across Europe and Asia in October and November (Scott and Rose 1996, Kear 2005b). Populations leave their winter quarters again between March and April, and arrive in their breeding grounds in northern Russia during the second half of May (Scott and Rose 1996, Kear 2005b). Both the males and females of the species undergo a flightless moult period after breeding and whilst still in their breeding range, during which they congregate at moult gatherings (Scott and Rose 1996, Kear 2005b) (males moult their flight feathers between late May and July, females between late June and early September) (Scott and Rose 1996). Birds of this species are dispersive during the breeding season and nest in pairs or small groups (Brown et al. 1982, Madge and Burn 1988, Kear 2005b). On passage to their wintering grounds individuals come together in large numbers, and during the non-breeding season the species is highly gregarious, forming close aggregations (4,200 birds were recorded in one wintering flock in Ethiopia) (Brown et al. 1982, Madge and Burn 1988). It is chiefly a diurnal feeder (Myrfyn and Thomas 1979), but is sometimes nocturnal (depending on local disturbances and tides, especially in its non-breeding marine habitats) (Kear 2005b). Habitat Breeding This species breeds in lowland freshwater marshes, slow-flowing large rivers (Kretchmar 1994) and shallow lakes and lagoons with ample submerged, floating and emerging vegetation (Kear 2005b). Ideal wetland habitats for this species are those surrounded by sparse open forest, woodland and especially agricultural land (Kretchmar 1994, Kear 2005b), in the boreal and subarctic zone (Cramp and Simmons 1977, Kear 2005b). It avoids tundra, densely forested and mountainous country, as well as fast flowing rivers and streams, but tolerates saline or alkaline steppe lakes and wetlands (Cramp and Simmons 1977, Madge and Burn 1988). Non-breeding In the non-breeding season this species shows a preference for coastal salt-marshes, freshwater, brackish and saline lagoons (Cramp and Simmons 1977), flooded grasslands (Cramp and Simmons 1977), estuaries, intertidal mudflats (Cramp and Simmons 1977), and other sheltered marine habitats (Kear 2005b). Diet It is vegetarian and consumes the leaves, seeds, stems and root bulbs of pond weeds, fine grasses (Myrfyn and Thomas 1979) (especially from agricultural land surrounding lakes) (Jacobsen 1993), horsetails (Kretchmar 1994) and eelgrass, as well as algae (Johnsgard 1978). Animal material is taken rarely and usually incidentally along with vegetation or seeds (Myrfyn and Thomas 1979, Kear 2005b). Breeding site The nests of this species are shallow depressions in the ground lined with vegetation, usually positioned not far from water and well concealed under overhanging vegetation, in grass tussocks, scrub (Kear 2005b), and especially in heather (Jacobsen and Ugelvik 1998). Management information Removing red foxes Vulpes vulpes and pine martens Martes martes from regions in Finland significantly increased the breeding success of this species (Kauhala 2004).


Systems
  • Terrestrial
  • Freshwater
  • Marine
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Depth range based on 13 specimens in 1 taxon.
Water temperature and chemistry ranges based on 5 samples.

Environmental ranges
  Depth range (m): 0 - 0
  Temperature range (°C): 9.539 - 10.213
  Nitrate (umol/L): 1.473 - 3.328
  Salinity (PPS): 34.096 - 35.040
  Oxygen (ml/l): 6.386 - 6.538
  Phosphate (umol/l): 0.317 - 0.397
  Silicate (umol/l): 1.720 - 2.125

Graphical representation

Temperature range (°C): 9.539 - 10.213

Nitrate (umol/L): 1.473 - 3.328

Salinity (PPS): 34.096 - 35.040

Oxygen (ml/l): 6.386 - 6.538

Phosphate (umol/l): 0.317 - 0.397

Silicate (umol/l): 1.720 - 2.125
 
Note: this information has not been validated. Check this *note*. Your feedback is most welcome.

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Wigeons breed on upland moors near shallow lochs, and occasionally on coastal marshes. Outside the breeding season, they congregate around estuaries, coastal lagoons, reservoirs and lakes with close access to grazing meadows.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Migration

Non-Migrant: No. All populations of this species make significant seasonal migrations.

Locally Migrant: No. No populations of this species make local extended movements (generally less than 200 km) at particular times of the year (e.g., to breeding or wintering grounds, to hibernation sites).

Locally Migrant: Yes. At least some populations of this species make annual migrations of over 200 km.

Generally arrives on winter range in western contiguous U.S. in October, departs by April (Cogswell 1977). Irregular in migration in interior North America.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Trophic Strategy

Comments: Eats mainly pondweeds, eelgrass, other aquatic plants, and grass. Forages in shallow water and in fields and meadows (Terres 1980, Cogswell 1977).

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Associations

Known prey organisms

Anas penelope (Anas penelope wigeon) preys on:
Enteromorpha

Based on studies in:
Scotland (Estuarine)

This list may not be complete but is based on published studies.
  • Hall SJ, Raffaelli D (1991) Food-web patterns: lessons from a species-rich web. J Anim Ecol 60:823–842
  • Huxham M, Beany S, Raffaelli D (1996) Do parasites reduce the chances of triangulation in a real food web? Oikos 76:284–300
Creative Commons Attribution 3.0 (CC BY 3.0)

© SPIRE project

Source: SPIRE

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Known predators

Anas penelope (Anas penelope wigeon) is prey of:
Catatropis terrucosa

Based on studies in:
Scotland (Estuarine)

This list may not be complete but is based on published studies.
  • Huxham M, Beany S, Raffaelli D (1996) Do parasites reduce the chances of triangulation in a real food web? Oikos 76:284–300
Creative Commons Attribution 3.0 (CC BY 3.0)

© SPIRE project

Source: SPIRE

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

General Ecology

Usually among American wigeons wintering flocks in West (Cogswell 1977).

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Life History and Behavior

Life Expectancy

Lifespan, longevity, and ageing

Maximum longevity: 34.7 years (wild) Observations: Maximum longevity from banding studies is 34.7 years (http://www.euring.org/data_and_codes/longevity.htm).
Creative Commons Attribution 3.0 (CC BY 3.0)

© Joao Pedro de Magalhaes

Source: AnAge

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Reproduction

Lays clutch of usually 7-10 eggs, May-June. Incubation, by female, lasts 24-25 days. Young first fly at 40-45 days. Male may reunite with female when she takes ducklings to water.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Barcode data: Anas penelope

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There are 7 barcode sequences available from BOLD and GenBank.

Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.

See the BOLD taxonomy browser for more complete information about this specimen and other sequences.

ACAAAGACATTGGCACTCTATACCTTATCTTCGGGGCATGGGCCGGAATAATTGGCACAGCACTCAGCCTGCTAATCCGCGCAGAACTGGGCCAGCCAGGGACCCTCCTGGGCGACGACCAAATTTACAACGTGATCGTCACCGCCCACGCCTTCGTAATAATCTTCTTCATAGTAATGCCCATCATAATTGGGGGATTTGGCAACTGATTGGTCCCCCTAATAATCGGTGCCCCCGACATAGCATTCCCACGAATAAACAACATAAGCTTCTGACTCCTCCCACCGTCATTCCTCCTACTACTCGCCTCATCCACCGTAGAAGCTGGCGCTGGCACAGGTTGAACCGTGTACCCACCCCTAGCAGGCAATCTAGCCCACGCCGGAGCCTCAGTAGACCTGGCTATCTTCTCACTTCACCTAGCCGGAGTCTCCTCCATCCTCGGGGCCATTAACTTCATTACCACGGCCATCAACATAAAACCCCCCGCACTCTCACAATACCAAACCCCACTTTTCGTCTGATCGGTCCTAATTACCGCCATCCTACTCCTCCTATCACTCCCCGTCCTCGCCGCCGGCATCACAATACTATTAACCGACCGAAACCTAAACACCACATTCTTTGACCCTGCCGGAGGAGGAGACCCAATCCTGTACCAACACCTATTTTGATTCTTTGGCCACCCAGAAGTCTATATCTTAATTCTCCCAGGATTTGGAATTT
-- end --

Download FASTA File

Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Statistics of barcoding coverage: Anas penelope

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 8
Specimens with Barcodes: 11
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Conservation

Conservation Status

National NatureServe Conservation Status

Canada

Rounded National Status Rank: N4N - Apparently Secure

United States

Rounded National Status Rank: N3N - Vulnerable

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

NatureServe Conservation Status

Rounded Global Status Rank: G5 - Secure

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

IUCN Red List Assessment


Red List Category
LC
Least Concern

Red List Criteria

Version
3.1

Year Assessed
2012

Assessor/s
BirdLife International

Reviewer/s
Butchart, S. & Symes, A.

Contributor/s

Justification
This species has an extremely large range, and hence does not approach the thresholds for Vulnerable under the range size criterion (Extent of Occurrence <20,000 km2 combined with a declining or fluctuating range size, habitat extent/quality, or population size and a small number of locations or severe fragmentation). Despite the fact that the population trend appears to be decreasing, the decline is not believed to be sufficiently rapid to approach the thresholds for Vulnerable under the population trend criterion (>30% decline over ten years or three generations). The population size is extremely large, and hence does not approach the thresholds for Vulnerable under the population size criterion (<10,000 mature individuals with a continuing decline estimated to be >10% in ten years or three generations, or with a specified population structure). For these reasons the species is evaluated as Least Concern.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Status in Egypt

Regular passage visitor and winter visitor.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Bibliotheca Alexandrina

Source: Bibliotheca Alexandrina - EOL Ar

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Status

Receives general protection under the Wildlife and Countryside Act (as amended) in the UK. Included in the Birds of Conservation Concern Amber List (medium conservation concern).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Population

Population
The global population is estimated to number c.2,800,000-3,300,000 individuals (Wetlands International 2006), while national population sizes have been estimated at c.100-10,000 breeding pairs and c.1,000-10,000 wintering individuals in China and c.50-10,000 wintering individuals in Taiwan (Brazil 2009).

Population Trend
Decreasing
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Threats

Major Threats
This species is susceptible to disturbance from freshwater recreational activities (del Hoyo et al. 1992, Grishanov 2006) (e.g. tourists walking) (Mathers et al. 2000), pollution (including thallium contamination [Mochizuki, et al. 2005], petroleum pollution [Grishanov 2006]), wetland drainage (del Hoyo et al. 1992, Grishanov 2006), peat-extraction (e.g. in the Kaliningrad region of Russia) (Grishanov 2006), changing wetland management practices (decreased grazing and mowing in meadows leading to scrub over-growth) (Grishanov 2006) and the burning and mowing of reeds (Grishanov 2006). Avian influenza virus (strain H5N1) is also a potential threat (Melville and Shortridge 2006, Jonassen and Handeland 2007), as is poisoning from the ingestion of lead shot pellets (Mondain-Monval et al. 2002). Utilisation This species is hunted for sport (e.g. in the UK) (del Hoyo et al. 1992, Kear 2005b), and although population numbers in an area decrease significantly after a period of shooting, there is no current evidence that such utilisation poses and immediate threat to the species (Vaananen 2001, Bregnballe et al. 2006). The eggs of this species used to be (and possibly still are) harvested in Iceland (Gudmundsson 1979). This species is also hunted for commercial and recreational purposes in Gilan Province, northern Iran (Balmaki and Barati 2006).

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

The wigeon is not an especially threatened species; the UK breeding population has numbered at least 300 pairs for nearly thirty years. There have been local declines, thought to have been caused by acidification of upland lakes and loss of nesting habitat through afforestation.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Management

Conservation

There are two Special Protection Areas (SPAs) for breeding wigeon supporting some 80 pairs, about 27% of the UK breeding population. The bulk of the world's wigeon breed in Scandinavia and Russia. The largest concentrations of the birds in Britain occur during winter with the arrival of migrants from northern Europe and Asia. Estimates suggest that over 300,000 wigeon over winter in the UK, this figure is thought to represent fewer than 18% of the world population. There are 38 SPAs throughout Britain designated for wintering wigeon. Of these, by far the largest numbers are found on the Ribble and Alt Estuaries in Lancashire and the Ouse Washes in Cambridgeshire.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Wikipedia

Eurasian wigeon

The Eurasian wigeon, also known as widgeon or Eurasian widgeon (Anas penelope, previously Mareca penelope) is one of three species of wigeon in the dabbling duck genus Anas. It is common and widespread within its range. This species was first described by Linnaeus in his Systema naturae in 1758 under its current scientific name.[2]

Description[edit]

This dabbling duck is 42–52 cm (17–20 in) long with a 71–80 cm (28–31 in) wingspan, and a weight of 500–1,073 g (1.102–2.366 lb).[3][4] The breeding male has grey flanks and back, with a black rear end and a dark green speculum and a brilliant white patch on upper wings, obvious in flight or at rest. It has a pink breast, white belly, and a chestnut head with a creamy crown.[5] In non-breeding (eclipse) plumage, the drake looks more like the female. The female is light brown, with plumage much like a female American wigeon. It can be distinguished from most other ducks, apart from American wigeon, on shape. However, that species has a paler head and white axillaries on its underwing. The female can be a rufous morph with a redder head, and a gray morph with a more gray head.[5]

Distribution[edit]

It breeds in the northernmost areas of Europe and Asia.[6] It is the Old World counterpart of North America's American wigeon. It is strongly migratory and winters further south than its breeding range. It migrates to southern Asia and Africa.[6] In Great Britain and Ireland, the Eurasian wigeon is common as a winter visitor, but scarce as a breeding bird in Scotland, the Lake District, the Pennines and occasionally further south, with only a handful of breeding pairs in Ireland. It can be found as an uncommon winter visitor in the United States on the mid-Atlantic and Pacific coasts. It is a rare visitor to the rest of the United States except for the Four Corners and the southern Appalachians.[3][5]

Behaviour and habitat[edit]

A male Eurasian wigeon in a marsh along N67, Ireland

The Eurasian wigeon is a bird of open wetlands, such as wet grassland or marshes with some taller vegetation, and usually feeds by dabbling for plant food or grazing, which it does very readily. It nests on the ground, near water and under cover. It is highly gregarious outside of the breeding season and will form large flocks. They will join with flocks of the American wigeon in the United States, and they also hybridize with them.[3] This is a noisy species. The male has a clear whistle that sounds like: "pjiew pjiew", whereas the female has a low growl : "rawr".

The Eurasian wigeon is one of the species to which the Agreement on the Conservation of African-Eurasian Migratory Waterbirds (AEWA) applies. Its conservation status is Least Concern.[1]

Footnotes[edit]

  1. ^ a b BirdLife International (2012). "Anas penelope". IUCN Red List of Threatened Species. Version 2013.2. International Union for Conservation of Nature. Retrieved 26 November 2013. 
  2. ^ Linnaeus, C. (1758)
  3. ^ a b c Floyd, T. (2008)
  4. ^ CRC Handbook of Avian Body Masses by John B. Dunning Jr. (Editor). CRC Press (1992), ISBN 978-0-8493-4258-5.
  5. ^ a b c Dunn, J. (2006)
  6. ^ a b Clements, J. (2007)

References[edit]

  • Clements, James, (2007) The Clements Checklist of the Birds of the World, Cornell University Press, Ithaca
  • Dunn, J. & Alderfer, J. (2006) National Geographic Field Guide to the Birds of North America 5th Ed.
  • Floyd, T (2008) Smithsonian Field Guide to the Birds of North America Harper Collins, NY
  • IUCN (2009) BirdLife International Anas penelope Downloaded on 08 Jan 2009
  • Linnaeus, C (1758). Systema naturae per regna tria naturae, secundum classes, ordines, genera, species, cum characteribus, differentiis, synonymis, locis. Tomus I. Editio decima, reformata. Holmiae. (Laurentii Salvii). p. 126. "A. cauda acutiufcula subtus nigra, carite brunneo, fronte alba." (Latin)

Identification[edit]

Creative Commons Attribution Share Alike 3.0 (CC BY-SA 3.0)

Source: Wikipedia

Unreviewed

Article rating from 0 people

Default rating: 2.5 of 5

Names and Taxonomy

Taxonomy

Comments: Occasionally hybridizes with A. americana (AOU 1983). See Livezey (1991) for a phylogenetic analysis and classification (supergenera, subgenera, infragenera, etc.) of dabbling ducks based on comparative morphology.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!