Articles on this page are available in 1 other language: Spanish (12) (learn more)

Overview

Brief Summary

Anas discors

Like all teals, the Blue-winged Teal is smaller than most ducks (15-16 inches). The male is easily identified by the large, crescent-shaped white patches on the sides of its head and by its specked breast and sides. Like many male ducks, the male Blue-winged Teal takes on an ‘eclipse’ plumage in fall and early winter that is drab-brown overall and resembles the plumage of female and juvenile Blue-winged Teals. Both sexes have large blue patches on the wings. Blue-winged Teals breed across the United States and Canada, although somewhat further south than many related duck species. In summer, this species may be found from southern Alaska across to southeastern Canada south to the Mid-Atlantic region, the Ohio River Valley, the southern Great Plains, and in the mountain west. Blue-winged Teals also migrate further south than most North American ducks, wintering along the southern Atlantic and Pacific, and Gulf coasts, in Florida, in Texas, and south into Mexico, Central America, and the West Indies. In summer, Blue-winged Teals breed in small ponds with plentiful insects, larvae, mollusks, and crustaceans, all of which feature highly in this duck’s diet during the breeding season. In winter, this species may be found on mudflats and in fresh and brackish marshes. In the tropics, Blue-winged Teals may also be found in saltwater wetlands dominated by mangroves. Blue-winged Teals may be seen either on land or in the water, where they may be observed foraging for food. This species may also be observed undertaking straight, swift flights on migration or between breeding or foraging grounds. Blue-winged Teals are most active during the day.

Threat Status: Least concern

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Unknown

Supplier: DC Birds

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Comprehensive Description

Description of Anas discors

Het mannetje heeft een okergele buik en het vrouwtje een witte.
Creative Commons Attribution 3.0 (CC BY 3.0)

1geron

Source: BioPedia

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Distribution

occurs (regularly, as a native taxon) in multiple nations

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

National Distribution

Canada

Origin: Native

Regularity: Regularly occurring

Currently: Present

Confidence: Confident

Type of Residency: Breeding

United States

Origin: Native

Regularity: Regularly occurring

Currently: Present

Confidence: Confident

Type of Residency: Year-round

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Global Range: (>2,500,000 square km (greater than 1,000,000 square miles)) BREEDS: southern Canada south to southern California, New Mexico, central Texas, Louisiana, and North Carolina; also recently in Hawaii (Aimakapa Pond, Hawaii). Breeding abundance is highest in the prairie pothole region of the north-central U.S. and south-central Canada. NORTHERN WINTER: southern U.S. south to southern Peru, central Argentina, and southern Brazil (mainly to nothern South America); the most common and widespread migrant duck in Colombia and Costa Rica); common in Puerto Rico and the Virgin Islands; regular in recent years in Hawaii. Major wintering concentrations occur along the Gulf Coast of Mexico and in Caribbean coastal areas of Venezuela, Colombia, and Guyana (Gammonley and Fredrickson 1995). In the U.S., the highest winter densities occur in southern Texas and peninsular Florida (Root 1988).

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

North America; from Newfoundland to the Gulf of Mexico
  • North-West Atlantic Ocean species (NWARMS)
Creative Commons Attribution 3.0 (CC BY 3.0)

© WoRMS for SMEBD

Source: World Register of Marine Species

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Geographic Range

During the summer months, blue-winged teal can be found throughout North America, from southeastern Alaska to the Atlantic coast. They are found in as far south as the Gulf Coast of Texas and Louisiana. In the winter months they migrate to the southern parts of the U.S. and into Central and South America.

Biogeographic Regions: nearctic (Native ); neotropical (Native ); australian

  • Lemaster, R. 1985. The Great Gallery of Ducks and Other Waterfowl. Mechanicburg, PA: Stackpole Books.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: BioKIDS Critter Catalog

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Range

North America; winters s US to central Argentina.

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

The blue-winged teal breeds from east-central Alaska and southern
Mackenzie District east to southern Quebec and southwestern
Newfoundland. In the contiguous United States it breeds from northeast
California east to central Louisiana, central Tennessee, and the
Atlantic Coast [4,10]. The western blue-winged teal inhabits that part
of the breeding range west of the Appalachian Mountains. The Atlantic
blue-winged teal nests along the Atlantic Coast from New Brunswick to
Pea Island, North Carolina [1].

The blue-winged teal winters from southern California to western and
southern Texas, the Gulf Coast to the Atlantic Coast and south to
Central and South America. It is often seen wintering as far south as
Brazil and central Chile [4,11,16].
  • 1. Bellrose, Frank C. 1980. Ducks, geese and swans of North America. Harrisburg, PA: Stackpole Books. 3rd ed. 540 p. [19802]
  • 10. Johnsgard, Paul A. 1979. A guide to North American waterfowl. Bloomington, IN: Indiana University Press. 274 p. [20026]
  • 4. DeGraaf, Richard M.; Scott, Virgil E.; Hamre, R. H.; [and others]
  • 11. Johnson, Douglas H.; Grier, James W. 1988. Determinants of breeding distribution of ducks. Wildlife Monographs. 100: 1-37. [21350]
  • 16. Musgrove, Jack W.; Musgrove, Mary R. 1943. Waterfowl in Iowa. Des Moines, IA: State Convservation Committee. 113 p. + index. [20028]

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Regional Distribution in the Western United States

More info on this topic.

This species can be found in the following regions of the western United States (according to the Bureau of Land Management classification of Physiographic Regions of the western United States):

1 Northern Pacific Border
2 Cascade Mountains
3 Southern Pacific Border
4 Sierra Mountains
5 Columbia Plateau
6 Upper Basin and Range
7 Lower Basin and Range
8 Northern Rocky Mountains
9 Middle Rocky Mountains
10 Wyoming Basin
11 Southern Rocky Mountains
12 Colorado Plateau
13 Rocky Mountain Piedmont
14 Great Plains
15 Black Hills Uplift
16 Upper Missouri Basin and Broken Lands

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Occurrence in North America

AL AK AZ AR CA CO CT DE FL GA HI
ID IL IN IA KS KY LA ME MD MA
MI MN MS MO MT NE NV NH NJ SD
TN TX UT VT VA WA WV WI WY


AB BC MB NB NF NT NS ON PE PQ
SK YT



MEXICO

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Geographic Range

During the summer months, blue-winged teal can be found throughout North America, from southeastern Alaska (western limit) to the Atlantic coast (eastern limit). They are also found in the continental U.S. in the Great Plains as far south as the Gulf Coast of Texas and Louisiana. In the winter months they migrate southwards to the Carolinas, southern California, and New Mexico and into tropical South America. Although Anas discors is commonly found in Neartic regions, it is also found in Australia. These ducks breed in southern Alaska and western Canada and south to northwestern California, New Mexico, and New York.

Biogeographic Regions: nearctic (Native ); neotropical (Native ); australian

  • Lemaster, R. 1985. The Great Gallery of Ducks and Other Waterfowl. Mechanicburg, PA: Stackpole Books.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Physical Description

Morphology

Physical Description

These ducks are called blue-winged teal because both sexes have blue spots on their forewings. They also have large white patches on the front of the wing, best visible when in flight. Males are smaller than females. Males have a large white crescent on their face, between the eye and the bill, and a white patch on their rear. Females lack the crescent and white patch, they have dull gray-brown coloration.

Wingspans range from 56 to 62 cm, and total lengths are typically 36 to 41 cm. Adults weigh 280 to 499 g.

Range mass: 280 to 499 g.

Range length: 36 to 41 cm.

Range wingspan: 56 to 62 cm.

Other Physical Features: endothermic ; homoiothermic; bilateral symmetry

Sexual Dimorphism: female larger; male more colorful

  • Guillemain, M., C. Arzel, P. Legagneux, H. Fritz. 2007. Predation risk constrains the plasticity of foraging behaviour in teals, Anas crecca: a flyway-level circumannual approach. Animal Behavior, 73/5: 845-854.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: BioKIDS Critter Catalog

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Physical Description

Anas discors are called blue-winged teal because both sexes have blue spots on their forewings. They also have large white patches on the front of the wing, best visible when in flight. Males are smaller than females. Males have a large vertical white crescent on their face, between the eye and the bill, and a white patch on their rear flank. Females lack the crescent and white patch, with dull gray-brown coloration.

Wingspans range from 56 to 62 cm, and total lengths are typically 36 to 41 cm. Adults weigh 280 to 499 g.

Range mass: 280 to 499 g.

Range length: 36 to 41 cm.

Range wingspan: 56 to 62 cm.

Other Physical Features: endothermic ; homoiothermic; bilateral symmetry

Sexual Dimorphism: female larger; male more colorful

  • Guillemain, M., C. Arzel, P. Legagneux, H. Fritz. 2007. Predation risk constrains the plasticity of foraging behaviour in teals, Anas crecca: a flyway-level circumannual approach. Animal Behavior, 73/5: 845-854.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Size

Length: 39 cm

Weight: 409 grams

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Type Information

Type for Anas discors
Catalog Number: USNM 463091
Collection: Smithsonian Institution, National Museum of Natural History, Department of Vertebrate Zoology, Division of Birds
Sex/Stage: Male; Adult
Preparation: Skin: Whole
Collector(s): R. Stewart & W. Nicholson
Year Collected: 1954
Locality: Elliott, Dorchester, Maryland, United States, North America
  • Type: Stewart & Aldrich. May 21, 1956. Proc. Biol. Soc. Washington. 69 (4): 31.
Creative Commons Attribution 3.0 (CC BY 3.0)

© Smithsonian Institution, National Museum of Natural History, Department of Vertebrate Zoology, Division of Birds

Source: National Museum of Natural History Collections

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Ecology

Habitat

Marismas Nacionales-San Blas Mangroves Habitat

This taxon is found in the Marismas Nacionales-San Blas mangroves ecoregion contains the most extensive block of mangrove ecosystem along the Pacific coastal zone of Mexico, comprising around 2000 square kilometres. Mangroves in Nayarit are among the most productive systems of northwest Mexico. These mangroves and their associated wetlands also serve as one of the most important winter habitat for birds in the Pacific coastal zone, by serving about eighty percent of the Pacific migratory shore bird populations.

Although the mangroves grow on flat terrain, the seven rivers that feed the mangroves descend from mountains, which belong to the physiographic province of the Sierra Madre Occidental. The climate varies from temperate-dry to sub-humid in the summer, when the region receives most of its rainfall (more than 1000 millimetres /year).

Red Mangrove (Rhizophora mangle), Black Mangrove (Avicennia germinans), Buttonwood (Conocarpus erectus) and White Mangrove trees (Laguncularia racemosa) occur in this ecoregion. In the northern part of the ecoregion near Teacapán the Black Mangrove tree is dominant; however, in the southern part nearer Agua Brava, White Mangrove dominates. Herbaceous vegetation is rare, but other species that can be found in association with mangrove trees are: Ciruelillo (Phyllanthus elsiae), Guiana-chestnut (Pachira aquatica), and Pond Apple (Annona glabra).

There are are a number of reptiles present, which including a important population of Morelet's Crocodile (Crocodylus moreletii) and American Crocodile (Crocodylus acutus) in the freshwater marshes associated with tropical Cohune Palm (Attalea cohune) forest. Also present in this ecoregion are reptiles such as the Green Iguana (Iguana iguana), Mexican Beaded Lizard (Heloderma horridum) and Yellow Bellied Slider (Trachemys scripta). Four species of endangered sea turtle use the coast of Nayarit for nesting sites including Leatherback Turtle (Dermochelys coriacea), Olive Ridley Turtle (Lepidochelys olivacea), Hawksbill Turtle (Eretmochelys imbricata) and Green Turtle (Chelonia mydas).

A number of mammals are found in the ecoregion, including the Puma (Puma concolor), Ocelot (Leopardus pardalis), Jaguar (Panthera onca), Southern Pygmy Mouse (Baiomys musculus), Saussure's Shrew (Sorex saussurei). In addition many bat taxa are found in the ecoregion, including fruit eating species such as the Pygmy Fruit-eating Bat (Artibeus phaeotis); Aztec Fruit-eating Bat (Artibeus aztecus) and Toltec Fruit-eating Bat (Artibeus toltecus); there are also bat representatives from the genus myotis, such as the Long-legged Myotis (Myotis volans) and the Cinnamon Myotis (M. fortidens).

There are more than 252 species of birds, 40 percent of which are migratory, including 12 migratory ducks and approximately 36 endemic birds, including the Bumblebee Hummingbird, (Atthis heloisa) and the Mexican Woodnymph (Thalurania ridgwayi). Bojórquez considers the mangroves of Nayarit and Sinaloa among the areas of highest concentration of migratory birds. This ecoregion also serves as wintering habitat and as refuge from surrounding habitats during harsh climatic conditions for many species, especially birds; this sheltering effect further elevates the conservation value of this habitat.

Some of the many representative avifauna are Black-bellied Whistling Duck (Dendrocygna autumnalis), Great Blue Heron (Ardea herodias), Roseate Spoonbill (Ajaia ajaja), Snowy Egret (Egretta thula), sanderling (Calidris alba), American Kestrel (Falco sparverius), Blue-winged Teal (Anas discors), Mexican Jacana (Jacana spinosa), Elegant Trogan (Trogan elegans), Summer Tanager (Piranga rubra), White-tailed Hawk (Buteo albicaudatus), Merlin (Falco columbarius), Plain-capped Starthroat (Heliomaster constantii), Painted Bunting (Passerina ciris) and Wood Stork (Mycteria americana).

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© World Wildlife Fund & C. Michael Hogan

Supplier: C. Michael Hogan

Trusted

Article rating from 1 person

Average rating: 5.0 of 5

Comments: Marshes, ponds, sloughs, lakes, and sluggish streams. In migration and when not breeding, in both freshwater and brackish situations (AOU 1983); prefers freshwater marshes, ponds, and sloughs, but occurs also in river pools, salt ponds, coastal lagoons, estuaries, and flooded pastures (Costa Rica, Stiles and Skutch 1989; Gammonley and Fredrickson 1995). Commonly colonizes newly available habitats.

Optimal nesting habitats include semi-permanent wetlands, ponds, and seasonal wetlands surrounded by grassland (Brewer et al. 1991). Nests usually on the ground among tall grasses or sedges, usually near water; seems to prefer to nest in native grass comunities in good range condition (Gammonley and Fredrickson 1995). Nest cover is provided by matted residual herbaceous vegetation (Gammonley and Fredrickson 1995). In the Midwest, bluegrass is the preferred nesting cover; also commonly uses hayfields and sedge meadows within 100 m of water (Brewer et al. 1991). Broods often use semi-permanent wetlands that include about 50% open water and a good supply of aquatic insects and other invertebrates (Brewer et al. 1991). Stock ponds with well-developed emergent vegetation provide locally important brood habitat (Gammonley and Fredrickson 1995). Females change breeding sites from year to year in response to changes in wetland condtitions (Gammonley and Fredrickson 1995). Male breeding territories include one or two small ponds within the home range (Gammonley and Fredrickson 1995).

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

shallow pools and marshes
  • North-West Atlantic Ocean species (NWARMS)
Creative Commons Attribution 3.0 (CC BY 3.0)

© WoRMS for SMEBD

Source: World Register of Marine Species

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Habitat and Ecology

Systems
  • Terrestrial
  • Freshwater
  • Marine
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Freshwater habitats for blue-winged teal include shallow ponds and wetlands. During breeding season, blue-winged teal remain near the water's edge in ponds and wetlands, preferring to breed in areas of calm, sluggish water.

Habitat Regions: temperate ; freshwater

Aquatic Biomes: lakes and ponds; temporary pools

Wetlands: marsh ; swamp

  • Bennett, L. 1938. The blue-winged teal: its ecology and management. Boston: Collegiate Press.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: BioKIDS Critter Catalog

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Cover Requirements

More info for the term: cover

Blue-winged teal often use heavy growth of bulrushes and cattails as
escape cover [2]. Grasses, sedges, and hayfields provide nesting cover
for these ducks [6]. Fritzell [6] reported that blue-winged teal nests
located in light to sparse cover were more successful than those in
heavy cover. Nesting success was 47 percent on grazed areas and 14
percent on ungrazed areas [6].
  • 6. Fritzell, Erik K. 1975. Effects of agricultural burning on nesting waterfowl. Canadian Field-Naturalist. 89: 21-27. [14635]
  • 2. Bennett, Logan J. 1938. The blue-winged teal: Its ecology and management. Ames, IA: Collegiate Press, Inc. 144 p. [20025]

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Preferred Habitat

Breeding habitat - Blue-winged teal inhabit shoreline more often than
open water and prefer calm water or sluggish currents to fast water.
They inhabit inland marshes, lakes, ponds, pools, and shallow streams
with dense emergent vegetation [4]. In coastal areas, breeding occurs
in salt-marsh meadows with adjoining ponds or creeks [10]. Blue-winged
teal use rocks protruding above water, muskrat houses, trunks or limbs
of fallen trees, bare stretches of shoreline, or mud flats for resting
sites [4].

Winter habitat - Blue-winged teal winter on shallow inland freshwater
marshes and brackish and saltwater marshes [4].

Nesting habitat - Blue-winged teal build their nests on dry ground in
grassy sites such as bluegrass meadows, hayfields, and sedge meadows.
They will also nest in areas with very short, sparse vegetation [6].
Blue-winged teal generally nest within several hundred yards of open
water; however, nests have been found as far as 1 mile (1.6 km) away
from water [1]. Where the habitat is good, they nest communally [4].
  • 1. Bellrose, Frank C. 1980. Ducks, geese and swans of North America. Harrisburg, PA: Stackpole Books. 3rd ed. 540 p. [19802]
  • 10. Johnsgard, Paul A. 1979. A guide to North American waterfowl. Bloomington, IN: Indiana University Press. 274 p. [20026]
  • 4. DeGraaf, Richard M.; Scott, Virgil E.; Hamre, R. H.; [and others]
  • 6. Fritzell, Erik K. 1975. Effects of agricultural burning on nesting waterfowl. Canadian Field-Naturalist. 89: 21-27. [14635]

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Associated Plant Communities

The blue-winged teal is primarily found in the northern prairies and
parklands. It is the most abundant duck in the mixed-grass prairies of
the Dakotas and the prairie provinces of Canada. The blue-winged teal
is also found in wetlands of boreal forest associations, shortgrass
prairies, tallgrass prairies, and deciduous woodlands [1].

This duck commonly inhabits wetland communities dominated by bulrush
(Scirpus spp.), cattail (Typha spp.), pondweed (Potamogeton spp.),
sedges (Carex spp.), widgeongrass (Ruppia maritima), and other emergent
and aquatic vegetation [1,2,8,17]. During molting, it often remains
among extensive beds of bulrushes and cattails. The blue-winged teal
favors areas dominated by bluegrass (Poa spp.) for nesting. Hayfields
and plant communities of buckbrush (Ceonothus cuneatus) and sedges are
also important as nest sites [1]. In the winter, blue-winged teal often
inhabits mangrove (Rhizophora spp.) swamps [14].

REFERENCES :
NO-ENTRY
  • 1. Bellrose, Frank C. 1980. Ducks, geese and swans of North America. Harrisburg, PA: Stackpole Books. 3rd ed. 540 p. [19802]
  • 2. Bennett, Logan J. 1938. The blue-winged teal: Its ecology and management. Ames, IA: Collegiate Press, Inc. 144 p. [20025]
  • 8. Harris, Stanley W. 1954. An ecological study of the waterfowl of the Potholes Area, Grant County, Washington. American Midland Naturalist. 52(2): 403-432. [11207]
  • 14. Madge, Steve; Burn, Hilary. 1988. Waterfowl: An indentification guide to the ducks, geese and swans of the world. Boston, MA: Houghton Mifflin Company. 298 p. [20029]
  • 17. Smith, Loren M.; Kadlec, John A. 1986. Habitat management for wildlife in marshes of Great Salt Lake. Trans., North American Wildlife and Natural Resource Conference. 51: 222-231. [11428]

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Habitat: Cover Types

More info on this topic.

This species is known to occur in association with the following cover types (as classified by the Society of American Foresters):

More info for the term: swamp

5 Balsam fir
12 Black spruce
13 Black spruce - tamarack
16 Aspen
17 Pin cherry
18 Paper birch
19 Gray birch - red maple
38 Tamarack
63 Cottonwood
88 Willow oak - water oak - diamondleaf oak
89 Live oak
91 Swamp chestnut oak - cherrybark oak
95 Black willow
106 Mangrove
201 White spruce
202 White spruce - paper birch
203 Balsam poplar
204 Black spruce
205 Mountain hemlock
206 Engelmann spruce - subalpine fir
217 Aspen
235 Cottonwood - willow
253 Black spruce - white spruce
254 Black spruce - paper birch
252 Paper birch

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Habitat: Plant Associations

More info on this topic.

This species is known to occur in association with the following plant community types (as classified by Küchler 1964):

More info for the term: bog

K001 Spruce - cedar - hemlock forest
K002 Cedar - hemlock - Douglas-fir forest
K003 Silver fir - Douglas-fir forest
K004 Fir - hemlock forest
K005 Mixed conifer forest
K008 Lodgepole pine - subalpine forest
K013 Cedar - hemlock - pine forest
K025 Alder - ash forest
K029 California mixed evergreen forest
K033 Chaparral
K034 Montane chaparral
K047 Fescue - oatgrass
K048 California steppe
K049 Tule marshes
K050 Fescue - wheatgrass
K051 Wheatgrass - bluegrass
K053 Grama - galleta steppe
K054 Grama - tobosa prairie
K056 Wheatgrass - needlegrass shrubsteppe
K057 Galleta - three-awn shrubsteppe
K058 Grama - tobosa shrubsteppe
K063 Foothills prairie
K064 Grama - needlegrass - wheatgrass
K065 Grama - buffalograss
K066 Wheatgrass - needlegrass
K067 Wheatgrass - bluestem - needlegrass
K068 Wheatgrass - grama - buffalograss
K069 Bluestem - grama prairie
K070 Sandsage - bluestem prairie
K072 Sea oats prairie
K073 Northern cordgrass prairie
K074 Bluestem prairie
K075 Nebraska Sandhills prairie
K076 Blackland prairie
K077 Bluestem - sacahuista prairie
K078 Southern cordgrass prairie
K079 Palmetto prairie
K080 Marl - everglades
K081 Oak savanna
K082 Mosaic of K074 and K100
K088 Fayette prairie
K090 Live oak - sea oats
K091 Cypress savanna
K092 Everglades
K093 Great Lakes spruce - fir forest
K094 Conifer bog
K095 Great Lakes pine forest
K096 Northeastern spruce - fir forest
K097 Southeastern spruce - fir forest
K098 Northern floodplain forest
K100 Oak - hickory forest
K105 Mangrove
K107 Northern hardwoods - fir forest
K108 Northern hardwoods - spruce forest
K109 Transition between K104 and K106
K110 Northeastern oak - pine forest
K111 Oak - hickory - pine forest
K113 Southern floodplain forest

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Habitat: Ecosystem

More info on this topic.

This species is known to occur in the following ecosystem types (as named by the U.S. Forest Service in their Forest and Range Ecosystem [FRES] Type classification):

FRES11 Spruce-fir
FRES14 Oak-pine
FRES15 Oak-hickory
FRES17 Elm-ash-cottonwood
FRES18 Maple-beech-birch
FRES19 Aspen-birch
FRES20 Douglas-fir
FRES21 Ponderosa pine
FRES22 Western white pine
FRES23 Fir-spruce
FRES24 Hemlock-Sitka spruce
FRES26 Lodgepole pine
FRES34 Chaparral-mountain shrub
FRES36 Mountain grasslands
FRES37 Mountain meadows
FRES38 Plains grasslands
FRES39 Prairie
FRES41 Wet grasslands
FRES42 Annual grasslands

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Freshwater habitats for Anas discors include shallow ponds and seasonal and permanent wetlands. They often use both temporary and permanent ponds. During breeding season, blue-winged teal remain near the water's edge in ponds and wetlands, preferring to breed in areas of calm, sluggish water.

Habitat Regions: temperate ; freshwater

Aquatic Biomes: lakes and ponds; temporary pools

Wetlands: marsh ; swamp

  • Bennett, L. 1938. The blue-winged teal: its ecology and management. Boston: Collegiate Press.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Depth range based on 8 specimens in 1 taxon.

Environmental ranges
  Depth range (m): 0 - 0
 
Note: this information has not been validated. Check this *note*. Your feedback is most welcome.

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Migration

Non-Migrant: No. All populations of this species make significant seasonal migrations.

Locally Migrant: No. No populations of this species make local extended movements (generally less than 200 km) at particular times of the year (e.g., to breeding or wintering grounds, to hibernation sites).

Locally Migrant: Yes. At least some populations of this species make annual migrations of over 200 km.

Migrates north to breeding areas in late northern spring. Arrives in prairie breeding areas mainly in late April and May. Southward migration is relatively early. Begins to migrate south in August-September (Terres 1980), with males generally preceding females and immatures; most are gone from the upper Midwest by early October. Present in South America from early September to late April, rarely to early June (Hilty and Brown 1986). Arrives in Costa Rica September-October, departs by end of April or May (Stiles and Skutch 1989). Those wintering in South America begin moving northward through Mexico in January (Gammonley and Fredrickson 1995). Migrates usually in conspecific flocks.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Trophic Strategy

Comments: Omnivorous; feeds mainly in shallowly flooded wetlands. Feeds on vegetative parts of aquatic plants (algae, duckweeds, pondweeds, etc.) as well as seeds (sedges, pondweeds, grasses, etc.). Also consumes large amounts of aquatic invertebrates, which are especially important in the breeding season and in the diet of the young. See Gammonley and Fredrickson (1995) for further details.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Food Habits

Blue-winged teal eat a variety of aquatic invertebrates and vegetation. Invertebrate prey include Insecta, Crustacea, Gastropoda, and small Bivalvia. They also eat seeds. When females are breeding they require a diet higher in protein, so they eat more invertebrates and seeds.

Animal Foods: insects; mollusks; aquatic crustaceans; other marine invertebrates

Plant Foods: leaves; seeds, grains, and nuts; algae; phytoplankton

  • Rohwer, F. 1986. Composition of Blue Winged Teal Eggs in Relation to eggs size, Clutch Timing of Laying. The Condor, 88: 513-519.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: BioKIDS Critter Catalog

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Food Habits

Blue-winged teal are surface feeders and prefer to feed on mud flats, in
fields, or in shallow water where there is floating and shallowly
submerged vegetation plus abundant small aquatic animal life. They
mostly eat vegetative matter consisting of seeds or stems and leaves of
sedge, grass, pondweed, smartweed (Polygonum spp.), duckweed (Lemna
spp.), widgeongrass, and muskgrass (Chara spp.) [1,4,10]. The seeds of
plants that grow on mud flats, such as nutgrass (Cyperus spp.),
smartweed, millet (Panicum spp.), and rice cut-grass (Leersia
oryzoides), are avidly consumed by this duck [1]. One-fourth of the
food consumed by blue-winged teals is animal matter such as mollusks,
crustaceans, and insects [1,4,10].
  • 1. Bellrose, Frank C. 1980. Ducks, geese and swans of North America. Harrisburg, PA: Stackpole Books. 3rd ed. 540 p. [19802]
  • 10. Johnsgard, Paul A. 1979. A guide to North American waterfowl. Bloomington, IN: Indiana University Press. 274 p. [20026]
  • 4. DeGraaf, Richard M.; Scott, Virgil E.; Hamre, R. H.; [and others]

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Food Habits

Blue-winged teal consume a variety of aquatic invertebrates, including insects, crustaceans, snails, and small clams, and aquatic vegetation, including seeds. When females are breeding they require a diet higher in protein, so they eat more invertebrates and seeds.

Animal Foods: insects; mollusks; aquatic crustaceans; other marine invertebrates

Plant Foods: leaves; seeds, grains, and nuts; algae; phytoplankton

Primary Diet: carnivore (Insectivore , Eats non-insect arthropods, Molluscivore ); herbivore (Folivore )

  • Rohwer, F. 1986. Composition of Blue Winged Teal Eggs in Relation to eggs size, Clutch Timing of Laying. The Condor, 88: 513-519.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Associations

Ecosystem Roles

Blue-winged teal impact populations of aquatic invertebrates and vegetation by eating them. They are a source of prey for many predators. Blue-winged teal often flock with other species of Anas.

Mutualist Species:

  • other dabbling ducks (Anas)

Commensal/Parasitic Species:

  • Avian cholera (Pasteurella_multocida)
  • protozoans (Cyanthocotyle_bushiensis)
  • protozoans (Spahaeridotreme_globulus)

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: BioKIDS Critter Catalog

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Predation

Mustela frenata often consume blue-wing teal eggs. Females are preyed on by Falconiformes when they are on their nests. In prairies, these ducks are captured by Vulpes vulpes. Females and ducklings are cryptically colored to avoid detection by prey.

Other predators include: Falco peregrinus, Mustela vison, Procyon lotor, Haliaeetus leucocephalus, Bubo virginianus, Buteo jamaicensis, Canis latrans, Mephitis mephitis, Taxidea taxus, Corvus brachyrhynchos, Pica hudsonia, and Spermophilus franklinii.

Known Predators:

  • peregrine falcons (Falco_peregrinus)
  • mink (Mustela_vison)
  • red foxes (Vulpes_vulpes)
  • raccons (Procyon_lotor)
  • bald eagles (Haliaeetus_leucocephalus)
  • great horned owls (Bubo_virginianus)
  • red-tailed hawks (Buteo_jamaicensis)
  • striped skunks (Mephitis_mephitis)
  • American badgers (Taxidea_taxus)
  • American crows (Corvus_brachyrhynchos)
  • black-billed magpies (Pica_hudsonia)
  • Franklin's ground squirrels (Spermophilus_franklinii)
  • long-tailed weasels (Mustela_frenata)

Anti-predator Adaptations: cryptic

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: BioKIDS Critter Catalog

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Predators

Common predators of blue-winged teal include humans, snakes, snapping
turtles (Chlycha serpentina), dogs (Canidae), eastern crows (Corvus
brachyrhnchos), magpies (Pica spp.), ground squirrels (Citellus spp.),
coyotes (Canis latrans), red foxes (Vulpes fulva), gray foxes (Urocyon
cinereoargenteus), raccoons (Procyon lotor), long-tailed weasels
(Mustela frenata), minks (Mustela vison), striped skunk (Mephitis
mephitis), spotted skunks (Spilogale putorius), and badgers (Taxidea
taxus) [1,2].

During one study, about half of the nest failures of blue-winged teal
were caused by mammals. Striped and spotted skunks were responsible for
two-thirds of these losses. All nest losses caused by birds were
attributed to either crows or magpies [1].
  • 1. Bellrose, Frank C. 1980. Ducks, geese and swans of North America. Harrisburg, PA: Stackpole Books. 3rd ed. 540 p. [19802]
  • 2. Bennett, Logan J. 1938. The blue-winged teal: Its ecology and management. Ames, IA: Collegiate Press, Inc. 144 p. [20025]

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Ecosystem Roles

Most blue-winged teal live mutualistically with other dabbling ducks. There are many parasites that infect this species, including Pasteurella multocida (avian cholera), and protozoans, such as Cyanthocotyle bushiensis and Spahaeridotreme globulus.

Mutualist Species:

  • other dabbling ducks (Anas)

Commensal/Parasitic Species:

  • Avian cholera (Pasteurella multocida)
  • protozoans (Cyanthocotyle bushiensis)
  • protozoans (Spahaeridotreme globulus)

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Predation

Long-tailed weasels Mustela frenata often consume blue-wing teal eggs. Females are susceptible to predation by raptors when incubating and when walking near nests between incubation bouts. In prairies, these ducks are captured by red foxes Vulpes vulpes. Females and ducklings are cryptically colored to avoid detection by prey.

Other predators include: peregrine falcons (Falco peregrinus), minks (Neovison vison), raccons (Procyon lotor), bald eagles (Haliaeetus leucocephalus), great horned owls (Bubo virginianus), red-tailed hawks (Buteo jamaicensis), coyotes (Canis latrans), striped skunks (Mephitis mephitis), American badgers (Taxidea taxus), American crows (Corvus brachyrhynchos), black-billed magpies (Pica hudsonia), and Franklin's ground squirrels (Spermophilus franklinii).

Known Predators:

Anti-predator Adaptations: cryptic

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Known prey organisms

Anas discors (Herbivorous ducks) preys on:
Halodule wrightii
Macro-epiphytes
Brachiodontes exustus
Bivalvia
Crepidula fornicata
Crepidula convexa
Argopecten irradians
Chione cancellata
Acteon punctostriatus
Cadulus carolinesis
Swartziella catesbyana
Acetocina candei
Truncatella pulchella
Nassarius vibex
Olivella mutica
Haminoea succinea

Based on studies in:
USA: Florida (Estuarine)

This list may not be complete but is based on published studies.
  • Christian RR, Luczkovich JJ (1999) Organizing and understanding a winter’s seagrass foodweb network through effective trophic levels. Ecol Model 117:99–124
Creative Commons Attribution 3.0 (CC BY 3.0)

© SPIRE project

Source: SPIRE

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Population Biology

Global Abundance

>1,000,000 individuals

Comments: Breeding population estimates, subject to considerable bias and error, ranged between 2.7 million and 5.8 million between 1955 and 1990, with no clear long-term trend (Gammonley and Fredrickson 1995). The May 1996 breeding population survey yielded an estimate of 6.4 birds, greater than the 1995 estimate of 5.1 million and 53% above the long-term average (USFWS 1996).

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

General Ecology

Nonbreeding: usually in flocks. A few weeks after incubation begins, males form molting flocks in or away from breeding areas. May feed with other dabbling ducks, coots, and shorebirds. The size of local breeding populations varies annually in response to habitat conditions. Has the highest annual mortality rate (reaching 65%) of all the dabbling ducks; this probably is due to hunting and the long over-ocean migration that most individuals experience. Large numbers of nests are lost to mammalian and avian predators. Most post-hatching mortality occurs in the first two weeks. Annual survival rate is somwehat over 50% in adults and 32-44% in juveniles (Gammonley and Fredrickson 1995).

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Habitat-related Fire Effects

More info for the terms: cover, marsh

Fire can remove blue-winged teal nesting cover [19]. Although
blue-winged teal do not show a preference for burned cover, they use
burned areas more often than do other dabbling ducks [6]. Fritzell [6]
found 16 of 19 nests in burned areas to be those of blue-winged teal.
Large-scale autumn burning may have a detrimental effect on marshes by
reducing their ability to catch and retain drifting snow, which adds
heavily to spring run-off. The ability of marsh vegetation to catch and
hold snow can be vital to marsh survival [19]. Fire often removes
excessive accumulations of fast-growing hydrophytes, permitting better
waterfowl access and growth of more desirable duck foods. Fire can be
used to convert forested uplands adjacent to aquatic habitats to grasses
and sedges, thus increasing the nesting potential for some waterfowl
[18].
  • 6. Fritzell, Erik K. 1975. Effects of agricultural burning on nesting waterfowl. Canadian Field-Naturalist. 89: 21-27. [14635]
  • 18. Vogl, Richard J. 1967. Controlled burning for wildlife in Wisconsin. In: Proceedings, 6th annual Tall Timbers Fire Ecology Conference; 1967 March 6-7; Tallahassee, FL. No. 6. Tallahassee, FL: Tall Timbers Research Station: 47-96. [18726]
  • 19. Ward, P. 1968. Fire in relation to waterfowl habitat of the delta marshes. In: Proceedings, annual Tall Timbers fire ecology conference; 1968 March 14-15; Tallahassee, FL. No. 8. Tallahassee, FL: Tall Timbers Research Station: 255-267. [18932]

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Timing of Major Life History Events

More info for the term: cover

Courtship and pair bonding - The onset of courtship among immature
blue-winged teal often starts in late January or early February. In
areas south of the breeding grounds, blue-winged teal are more active in
courtship during the spring migration than are most other ducks [1].

Nesting - Blue-winged teal are among the last dabbling ducks to nest
[1], generally nesting between April 15 and May 15 [1,2]. Few nests are
started after mid-July [1]. Chronology of nesting can vary from year to
year as a result of weather conditions. At Delta Marshes, Manitoba,
blue-winged teal nesting was delayed a week in 1950 due to abnormally
cold weather [1].

Clutch/incubation - Blue-winged teal generally lay 10 to 12 eggs [10].
Delayed nesting and renesting efforts have substantially smaller
clutches, averaging five to six eggs [10]. Clutch size can also vary
with the age of the hen. Yearlings tend to lay smaller clutches [1].
Incubation takes 21 to 27 days [1,2,10].

Age at sexual maturity - Blue-winged teal are sexually mature after
their first winter [10].

Fledging - Blue-winged teal ducklings can walk to water within 12 hours
after hatching but do not fledge until 6 to 7 weeks [2,10].

Molting - During incubation, the drake leaves its mate and moves to
suitable molting cover where it becomes flightless for a period of 3 to
4 weeks [10].

Migration - Blue-winged teal are generally the first ducks south in the
fall and the last ones north in the spring [1]. Adult drakes depart the
breeding grounds well before adult hens and immatures. Most blue-winged
teal flocks seen after mid-September are composed largely of adult hens
and immatures [1].

The northern regions experience a steady decline in blue-winged teal
populations from early September until early November. Blue-winged teal
in central migration areas tend to remain through September, then
diminish rapidly during October, with small numbers remaining until
December. Large numbers of blue-winged teal appear on wintering grounds
in Florida, Louisiana, and Texas in September [1].
  • 1. Bellrose, Frank C. 1980. Ducks, geese and swans of North America. Harrisburg, PA: Stackpole Books. 3rd ed. 540 p. [19802]
  • 10. Johnsgard, Paul A. 1979. A guide to North American waterfowl. Bloomington, IN: Indiana University Press. 274 p. [20026]
  • 2. Bennett, Logan J. 1938. The blue-winged teal: Its ecology and management. Ames, IA: Collegiate Press, Inc. 144 p. [20025]

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Life History and Behavior

Behavior

Diet

seeds, plants, insects, molluscs
  • North-West Atlantic Ocean species (NWARMS)
Creative Commons Attribution 3.0 (CC BY 3.0)

© WoRMS for SMEBD

Source: World Register of Marine Species

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Communication and Perception

Male blue-winged teal make a set of sounds to attract females, including a high-pitched whistle "peew" and low-pitched nasal "paay."

Females use loud quacks during the breeding season to communicate with their mates and with their young.

Communication Channels: visual ; acoustic

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: BioKIDS Critter Catalog

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Communication and Perception

Males that are unpaired usually make a loud, high-pitched whistle "peew" or a low-pitched nasal "paay." A male's decrescendo begins with a single call that is followed by a short series of low-pitched "pews." These types of calls are broadcast during fall and early winter, but rarely after pair formation.

During the mating season, females give a short series of loud, evenly- spaced, single quacks, which vary in volume and duration. When a female that has already found a mate is being pursued by another male, she makes a quack sound followed by a "gaek" note to warm them off. Females also quack to communicate with their young.

Communication Channels: visual ; acoustic

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Cyclicity

Comments: Broods are more active and more easily observed in early morning and late afternoon (Gammonley and Fredrickson 1995). Molting males, flightless for about a month, tend to feed at night.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Life Expectancy

Lifespan/Longevity

Most blue-winged teal ducklings do not survive through their first few years. They get parasites and diseases as young birds or do not survive their first migration attempt. Botulism (Clostridium_botulinum) and avian cholera (Pasteurella_multocida), both bacterial diseases, kill blue-winged teals when they are found in the water where they live. Blue-winged teal that do survive to adulthood can live up to 17 years.

Range lifespan

Status: wild:
17.4 (high) years.

Typical lifespan

Status: wild:
17.4 (high) years.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: BioKIDS Critter Catalog

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Lifespan/Longevity

Ducklings are susceptible to parasites and diseases, and often do not reach maturity. Botulism (Clostridium botulinum) and avian cholera (Pasteurella multocida), both bacterial diseases, impact blue-winged teal populations heavily through ingestion of the bacteria. Migration is another source of mortality, particularly in young teal. Blue-winged teal that do survive to adulthood have been known to live up to 17 years.

Range lifespan

Status: wild:
17.4 (high) years.

Typical lifespan

Status: wild:
17.4 (high) years.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Lifespan, longevity, and ageing

Maximum longevity: 23.2 years (wild)
Creative Commons Attribution 3.0 (CC BY 3.0)

© Joao Pedro de Magalhaes

Source: AnAge

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Reproduction

Nesting begins in late April in the Midwest. Peak nesting occurs usually in late May in the U.S., in early June in Canada (Gammonley and Fredrickson 1995). Clutch size 6-15 (usually 9-11). Incubation 23-27 days, by female. Nestlings precocial, tended by female. First flight of young occurs 35-44 days after hatching (Terres 1980). First breeds at one year; most yearling females nest. Renesting is likely if nest loss occurs early in laying period and/or when wetland conditions are good (Gammonley and Fredrickson 1995).

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Blue-winged teal have a single mate during the breeding season, but they usually change mates between breeding seasons. Pairs are formed on wintering grounds and during spring migration.

Males perform courtship displays to attract females. Usually, courtship begins in flight, when males call and pursue females. A typical on-water display would be: a male swims in front of a female and with his body at an angle to her and his head pointing away. The female accepts a male by stretching her head outward. Then her head is lowered and her bill is pointed toward the male. At the end they both bob their heads up and down.

Mating System: monogamous

Blue-winged teal nest from late April through early May. They breed in wetland areas within grasslands, shallow marshes, sloughs, flooded ditches, and temporary ponds. Females lay 6 to 14 eggs, which take 21 to 40 days to hatch. Young reach the fledgling stage at about 24 days and are independent after 40 days.

Breeding interval: Blue-winged teal breed once yearly.

Breeding season: Blue-winged teal mate from late spring to early summer.

Range eggs per season: 6 to 14.

Range time to hatching: 21 to 40 days.

Range fledging age: 24 to 25 days.

Range time to independence: 40 (low) days.

Key Reproductive Features: seasonal breeding ; gonochoric/gonochoristic/dioecious (sexes separate)

Females are in charge of nest maintenance and rearing the young, males do not help out. Females make a nest by digging a bowl-shaped depression and pulling in dried grass. She lays one egg per day, up to around 10 or more eggs. When the eggs hatch the female preens her hatchlings until they are dry and clean. She then leads her ducklings to a nearby wetland and does not return to the nest. The young remain with their mother until they are ready to fly, about 40 days post-hatching.

Parental Investment: precocial ; pre-fertilization (Provisioning, Protecting: Female); pre-hatching/birth (Provisioning: Female, Protecting: Female); pre-weaning/fledging (Provisioning: Female, Protecting: Female); pre-independence (Provisioning: Female, Protecting: Female)

  • Livezey, B. 1980. Effects of selected observers-related factors on fates of ducks nests. Journal of Wildlife Management, 8: 123-128.
  • Glover, F. 1986. Nesting and Production of the Blue-Winged Teal (Anas discors Linnaeus) in Northwest Iowa. The Journal of Wildlife Management, 20: 28-46.
  • Kear, J. 2005. Ducks, Goose and Swans. United Kingdom: Oxford University Press.
  • Bailey, R., N. Seymour, G. Stewart. 1973. Rape behavior in blue-winged teal. Auk, 95: 188-190.
  • Rohwer, F., W. Johnson, E. Loos. 2002. Blue-winged teal. The Birds of North American, 625: 1-35.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: BioKIDS Critter Catalog

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Blue-winged teal are seasonally monogamous. Pairs usually form on wintering grounds and during spring migration. Most female are paired when they arrive on breeding grounds.

A group of males will court one female. Males swim after females and perform a variety of courtship displays. Usually, courtship begins in flight, when males call and pursue females in an erratic flight. A typical on-water display would be: a male swims in front of a female and with his body at an angle to her line of her movement, but his head is up so that the bill points away from the female. The female accepts a male by stretching her head outward. Then her head is lowered and her bill is pointed toward the male. They both perform a head pump.

Mating System: monogamous

Blue-winged teal nest from late April through early May. They tend to breed in northern prairie potholes and parklands. Nesting habitat includes wetland areas within grasslands, such as shallow marshes, sloughs, flooded ditches, and temporary ponds. Females lay 6 to 14 eggs, which take 21 to 40 days to hatch. Young reach the fledgling stage at about 24 days and are independent after 40 days.

Breeding interval: Blue-winged teal breed once yearly.

Breeding season: Blue-winged teal mate from late spring to early summer.

Range eggs per season: 6 to 14.

Range time to hatching: 21 to 40 days.

Range fledging age: 24 to 25 days.

Range time to independence: 40 (low) days.

Key Reproductive Features: seasonal breeding ; gonochoric/gonochoristic/dioecious (sexes separate)

Females are in charge of nest maintenance and rearing the young, males play no apparent part. Females change their breeding locality each year. To create a nest, a female digs a bowl-shaped depression with her feet and pulls in dried grass that is available around the nest bowl. She lays one egg per day, typically totalling more than 10 eggs. Upon returning to the nest, she lands a short distance from the nest so that predators do not know the nest location. When the eggs hatch the female preens her hatchlings until they are dry and clean. She then leads her ducklings to a nearby wetland and does not return to the nest. The young remain with their mother until they are ready to fly, about 40 days post-hatching.

Parental Investment: precocial ; pre-fertilization (Provisioning, Protecting: Female); pre-hatching/birth (Provisioning: Female, Protecting: Female); pre-weaning/fledging (Provisioning: Female, Protecting: Female); pre-independence (Provisioning: Female, Protecting: Female)

  • Livezey, B. 1980. Effects of selected observers-related factors on fates of ducks nests. Journal of Wildlife Management, 8: 123-128.
  • Glover, F. 1986. Nesting and Production of the Blue-Winged Teal (Anas discors Linnaeus) in Northwest Iowa. The Journal of Wildlife Management, 20: 28-46.
  • Kear, J. 2005. Ducks, Goose and Swans. United Kingdom: Oxford University Press.
  • Bailey, R., N. Seymour, G. Stewart. 1973. Rape behavior in blue-winged teal. Auk, 95: 188-190.
  • Rohwer, F., W. Johnson, E. Loos. 2002. Blue-winged teal. The Birds of North American, 625: 1-35.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Barcode data: Anas discors

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There are 8 barcode sequences available from BOLD and GenBank.  Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.  See the BOLD taxonomy browser for more complete information about this specimen and other sequences.

NNTCTATACCTTATCTTCGGGGCATGAGCCGGAATAATTGGCACAGCACTGAGCCTACTAATCCGCGCAGAGCTTGGTCAACCCGGGACTCTCCTGGGCGATGACCAAATTTACAACGTGATCGTCACCGCTCACGCCTTTGTAATAATCTTCTTCATAGTAATACCCATCATAATTGGAGGATTTGGCAACTGATTAGTCCCCCTGATAATCGGTGCCCCAGACATAGCATTCCCACGAATAAATAACATAAGCTTCTGACTCCTTCCACCATCATTCCTTCTGCTACTCGCCTCATCCACCGTAGAAGCTGGCGCTGGTACAGGTTGGACCGTGTACCCACCCCTAGCAGGCAACCTGGCCCACGCCGGAGCCTCAGTAGACCTGGCCATTTTCTCGCTCCACCTAGCCGGTGTTTCCTCCATCCTCGGAGCCATTAACTTCATTACCACAGCCATCAACATAAAACCCCCTGCACTCTCACAGTACCAAACCCCACTTTTCGTCTGATCAGTCCTAATTACCGCCATCCTGCTTCTCCTGTCACTTCCTGTCCTTGCCGCCGGCATCACAATGCTGCTAACCGACCGAAACCTAAACACCACATTCTTCGACCCTGCTGGAGGGGGAGACCCGATCCTGTATCAACACCTATTTTGATTCTTCGGCCACCCAGAAGTCTACATCTTAATTCTT
-- end --

Download FASTA File
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Statistics of barcoding coverage: Anas discors

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 8
Specimens with Barcodes: 9
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Conservation

Conservation Status

National NatureServe Conservation Status

Canada

Rounded National Status Rank: N5B - Secure

United States

Rounded National Status Rank: N5B,N5N : N5B: Secure - Breeding, N5N: Secure - Nonbreeding

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

NatureServe Conservation Status

Rounded Global Status Rank: G5 - Secure

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

IUCN Red List Assessment


Red List Category
LC
Least Concern

Red List Criteria

Version
3.1

Year Assessed
2012

Assessor/s
BirdLife International

Reviewer/s
Butchart, S. & Symes, A.

Contributor/s

Justification
This species has an extremely large range, and hence does not approach the thresholds for Vulnerable under the range size criterion (Extent of Occurrence <20,000 km2 combined with a declining or fluctuating range size, habitat extent/quality, or population size and a small number of locations or severe fragmentation). Despite the fact that the population trend appears to be decreasing, the decline is not believed to be sufficiently rapid to approach the thresholds for Vulnerable under the population trend criterion (>30% decline over ten years or three generations). The population size is extremely large, and hence does not approach the thresholds for Vulnerable under the population size criterion (<10,000 mature individuals with a continuing decline estimated to be >10% in ten years or three generations, or with a specified population structure). For these reasons the species is evaluated as Least Concern.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Blue-winged teal, although not rare, are protected under the Migratory Bird Act. Teal are hunted throughout much of their range, although hunting is generally regulated. Blue-winged teal populations have been harmed by pesticides such as dieldrin and by eating or being trapped in plastic trash. They are also hit by cars and can become entangled in power lines, fences, and other human structures. Blue-winged teal populations, along with the populations of many other duck species, have declined because of human destruction of wetlands.

IUCN Red List of Threatened Species: least concern

US Migratory Bird Act: protected

US Federal List: no special status

CITES: no special status

State of Michigan List: no special status

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: BioKIDS Critter Catalog

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Blue-winged teal, although not rare, are protected under the Migratory Bird Act. Bag limits are set to maintain healthy populations. Also, the U.S. and Canada have banned pesticides and other contaminants that had been killing blue-winged teals. For instance, mercury levels and also organochlorine residue found in lakes and ponds are controlled/limited by these governments. Dieldrin is a type of insecticide that can concentrate in migratory birds--it has since been banned.

Humans often negatively affect Anas discors. Human littering can cause suffocation in this bird--from consuming or getting stuck in plastic trash and fishing lines. Also, blue-winged teal can collide with power lines, fences, and barbed wire in flight, or with vehicles. However, the most important negative influence is habitat degradation and loss due to human activities, especially wetland draining and conversion to agriculture.

US Migratory Bird Act: protected

US Federal List: no special status

CITES: no special status

State of Michigan List: no special status

IUCN Red List of Threatened Species: least concern

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Status in Egypt

Accidental visitor.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Bibliotheca Alexandrina

Source: Bibliotheca Alexandrina - EOL Ar

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Global Short Term Trend: Relatively stable (=10% change)

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Population

Population Trend
Decreasing
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Management

Management Requirements: Restoration of temporary and seasonal wetlands is particularly needed in agricultural landscapes (Gammonley and Fredrickson 1995). Maintenance of optimal nesting habitat may require active management (allowing dead vegetation to accumulate; periodic burning, mowing, or grazing to prevent it from becoming too dense); disturbance should be performed after the peak hatching period; seeded dense nesting cover used by mallards and gadwalls seems to be less attractive to blue-winged teal (Gammonley and Fredrickson 1995).

See Barker et al. (1990) for information on the effects of different livestock grazing systems on nesting success in North Dakota.

See Marcy (1986) for specifications for the construction and placement of wire nest baskets.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Needs: Minimize loss and degradation of wetlands in winter range.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Use of Fire in Population Management

More info for the term: cover

Prescribed fire can be used to create nesting edge for ducks. Removal
of dense vegetation and woody encroachment is vital if prairie marshes
are to remain in this successional state [19]. According to Ward [19],
spring burning in marshlands is primarily done to remove vegetation and
create more nesting edge. Summer fires are used to create more
permanent changes in the plant community. If prescribed burning is used
as a management technique in marshes, burning must be completed well
before or after the nesting season [19]. For blue-winged teal, summer
burning should occur after July [19]. Fire can also be used to reduce
predator activity through the elimination of hiding cover [6].

Fire can be used to remove fast-growing undesirable species, such as
common reed (Phragmites australis), and increase production of desirable
blue-winged teal foods such as pondweed and duckweed [20]. The best way
to reduce common reed with prescribed burning is to burn during the
summer when carbohydrate reserves in the plant are low and the soil is
dry [9].
  • 6. Fritzell, Erik K. 1975. Effects of agricultural burning on nesting waterfowl. Canadian Field-Naturalist. 89: 21-27. [14635]
  • 9. Higgins, Kenneth F.; Kruse, Arnold D.; Piehl, James L. 1989. Effects of fire in the Northern Great Plains. Ext. Circ. EC-761. Brookings, SD: South Dakota State University, Cooperative Extension Service, South Dakota Cooperative Fish and Wildlife Research Unit. 47 p. [14749]
  • 19. Ward, P. 1968. Fire in relation to waterfowl habitat of the delta marshes. In: Proceedings, annual Tall Timbers fire ecology conference; 1968 March 14-15; Tallahassee, FL. No. 8. Tallahassee, FL: Tall Timbers Research Station: 255-267. [18932]
  • 20. Schlichtemeier, Gary. 1967. Marsh burning for waterfowl. In: Proceedings, 6th annual Tall Timbers fire ecology conference; 1967 March 6-7; Tallahassee, FL. No. 6. Tallahassee, FL: Tall Timbers Research Station: 40-46. [16450]

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Management Considerations

Farm activities such as mowing of hayfields, plowing, fence-building,
and trampling by cattle can destroy blue-winged teal nests [1].

In spite of low hunting losses, blue-winged teals have a higher annual
mortality than other dabbling ducks. Perhaps the high nonhunting losses
occur because of the blue-winged teal's lengthy overwater flights to
South America [1].

REFERENCES :
NO-ENTRY
  • 1. Bellrose, Frank C. 1980. Ducks, geese and swans of North America. Harrisburg, PA: Stackpole Books. 3rd ed. 540 p. [19802]

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Relevance to Humans and Ecosystems

Benefits

Economic Uses

Comments: Hunted especially during special early seasons, with the greatest harvest in the Mississippi and Central flyways; harvest rate south of the U.S. is poorly known, but probably at least 21% of the total harvest occurs there (Gammonley and Fredrickson 1995).

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Economic Importance for Humans: Negative

Blue-winged teal don't negatively impact humans directly. However, many ducks species, including blue-winged teal, can carry and transmit avian influenza.

Negative Impacts: injures humans (carries human disease)

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: BioKIDS Critter Catalog

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Economic Importance for Humans: Positive

Blue-winged teal are game birds.

Positive Impacts: food

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: BioKIDS Critter Catalog

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Economic Importance for Humans: Negative

One concern about blue-winged teals is the spread of avian influenza, which can decimate bird populations and be transmitted to humans.

Negative Impacts: injures humans (carries human disease)

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Economic Importance for Humans: Positive

Blue-winged teal are game birds.

Positive Impacts: food

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Wikipedia

Blue-winged Teal

The blue-winged teal (Anas discors) is a small dabbling duck from North America.

Description[edit]

The blue-winged teal is 40 cm (16 in) long, with a wingspan of 58 cm (23 in), and a weight of 370 g (13 oz).[2] The adult male has a greyish blue head with a white facial crescent, a light brown body with a white patch near the rear and a black tail. The adult female is mottled brown, and has a whitish area at base of bill. Both sexes have sky-blue wing coverts, a green speculum, and yellow legs.[2][3] They have two molts per year and a third molt in their first year.[2] The call of the male is a short whistle; the female's call is a soft quack.[2]

Taxonomy[edit]

The placement of the blue-winged teal in the genus Anas is by no means certain; a member of the "blue-winged" group also including the shovelers, it may be better placed with them in a separate genus Spatula. It is not a teal in the strict sense, and also does not seem closely related to the garganey as was for some time believed. Indeed, its color pattern is strikingly reminiscent of the Australasian shoveler.[citation needed] DNA analysis of this species has revealed it is very close genetically to the cinnamon teal, another American teal with blue wings.[citation needed]

Distribution[edit]

The range is all of North America except western and northern Alaska, northern Yukon Territory, northern Northwest Territories and the northeastern area of Canada. Blue-winged teal are rare in the desert southwest, and the west coast. The breeding habitat of the blue-winged teal is marshes and ponds.[2][3]

The breeding range extends from east-central Alaska and southern Mackenzie District east to southern Quebec and southwestern Newfoundland. In the contiguous United States it breeds from northeast California east to central Louisiana, central Tennessee, and the Atlantic Coast.[4][5] The western blue-winged teal inhabits that part of the breeding range west of the Appalachian Mountains. The Atlantic blue-winged teal nests along the Atlantic Coast from New Brunswick to Pea Island, North Carolina.[6][clarification needed]

They migrate in flocks to winter in to the south of its breeding range. During migration, some birds may fly long distances over open ocean. They are occasional vagrants to Europe, where their yellow legs are a distinction from other small ducks like the common teal and Garganey,[2][3] and in recent years have been annual vagrants in Britain and Ireland.[7] The blue-winged teal winters from southern California to western and southern Texas, the Gulf Coast to the Atlantic Coast and south to Central and South America. It is often seen wintering as far south as Brazil and central Chile.[2][3][4]

Habitat[edit]

Blue-winged teal inhabit shoreline more often than open water and prefer calm water or sluggish currents to fast water. They inhabit inland marshes, lakes, ponds, pools, and shallow streams with dense emergent vegetation.[4] In coastal areas, breeding occurs in salt-marsh meadows with adjoining ponds or creeks.[5] Blue-winged teal use rocks protruding above water, muskrat houses, trunks or limbs of fallen trees, bare stretches of shoreline, or mud flats for resting sites.[4]

Blue-winged teal winter on shallow inland freshwater marshes and brackish and saltwater marshes.[4] They build their nests on dry ground in grassy sites such as bluegrass meadows, hayfields, and sedge meadows. They will also nest in areas with very short, sparse vegetation.[8] Blue-winged teal generally nest within several hundred yards of open water; however, nests have been found as far as 1.61 km (1 mi) away from water.[6] Where the habitat is good, they nest communally.[4]

Blue-winged teal often use heavy growth of bulrushes and cattails as escape cover.[9] Grasses, sedges, and hayfields provide nesting cover for these ducks.[8] Erik Fritzell reported that blue-winged teal nests located in light to sparse cover were more successful than those in heavy cover. Nesting success was 47% on grazed areas and 14% on ungrazed areas.[8]

The blue-winged teal is primarily found in the northern prairies and parklands. It is the most abundant duck in the mixed-grass prairies of the Dakotas and the prairie provinces of Canada. The blue-winged teal is also found in wetlands of boreal forest associations, shortgrass prairies, tallgrass prairies, and deciduous woodlands.[6]

This duck commonly inhabits wetland communities dominated by bulrush (Scirpus spp.), cattail (Typha spp.), pondweed (Potamogeton spp.), sedges (Carex spp.), widgeongrass (Ruppia maritima), and other emergent and aquatic vegetation.[6][9] During molting, it often remains among extensive beds of bulrushes and cattails. The blue-winged teal favors areas dominated by bluegrass (Poa spp.) for nesting. Hayfields and plant communities of buckbrush (Ceonothus cuneatus) and sedges are also important as nest sites.[6]

Behavior[edit]

Males and a female, Richmond, British Columbia

These birds feed by dabbling in shallow water at the edge of marshes or open water.[2] They mainly eat plants; their diet may include molluscs and aquatic insects.

Blue-winged teal are generally the first ducks south in the fall and the last ones north in the spring. Adult drakes depart the breeding grounds well before adult hens and immatures. Most blue-winged teal flocks seen after mid-September are composed largely of adult hens and immatures.[6] The northern regions experience a steady decline in blue-winged teal populations from early September until early November. Blue-winged teal in central migration areas tend to remain through September, then diminish rapidly during October, with small numbers remaining until December. Large numbers of blue-winged teal appear on wintering grounds in Florida, Louisiana, and Texas in September.[6]

Reproduction[edit]

The onset of courtship among immature blue-winged teal often starts in late January or early February. In areas south of the breeding grounds, blue-winged teal are more active in courtship during the spring migration than are most other ducks.[6]

Blue-winged teal are among the last dabbling ducks to nest,[6] generally nesting between April 15 and May 15.[6][9] Few nests are started after mid-July.[6] Chronology of nesting can vary from year to year as a result of weather conditions. At Delta Marshes, Manitoba, blue-winged teal nesting was delayed a week in 1950 due to abnormally cold weather.[6] The nest is a shallow depression on the ground lined with grass and down, usually surrounded by vegetation.[citation needed]

Blue-winged teal generally lay 10 to 12 eggs. Delayed nesting and renesting efforts have substantially smaller clutches, averaging five to six eggs. Clutch size can also vary with the age of the hen. Yearlings tend to lay smaller clutches.[6] Incubation takes 21 to 27 days.[5][6][9] Blue-winged teal are sexually mature after their first winter. During incubation, the drake leaves its mate and moves to suitable molting cover where it becomes flightless for a period of 3 to 4 weeks.[citation needed]

Blue-winged teal ducklings can walk to water within 12 hours after hatching but do not fledge until 6 to 7 weeks.[5][9]

Food habits[edit]

Blue-winged teal are surface feeders and prefer to feed on mud flats, in fields, or in shallow water where there is floating and shallowly submerged vegetation plus abundant small aquatic animal life. They mostly eat vegetative matter consisting of seeds or stems and leaves of sedge, grass, pondweed, smartweed (Polygonum spp.), duckweed (Lemna spp.), Widgeongrass, and muskgrass (Chara spp.).[4][5][6] The seeds of plants that grow on mud flats, such as nutgrass (Cyperus spp.), smartweed, millet (Panicum spp.), and Rice Cut-grass (Leersia oryzoides), are avidly consumed by this duck.[6] One-fourth of the food consumed by blue-winged teal is animal matter such as mollusks, crustaceans, and insects.[4][5][6]

Predators[edit]

Common predators of blue-winged teal include humans, snakes, snapping turtles (Chlycha serpentina), dogs, American crows (Corvus brachyrhnchos), magpies (Pica spp.), ground squirrels, coyotes (Canis latrans), red foxes (Vulpes fulva), gray foxes (Urocyon cinereoargenteus), raccoons (Procyon lotor), long-tailed weasels (Mustela frenata), American minks (Mustela vison), striped skunks (Mephitis mephitis), spotted skunks (Spilogale putorius), and American badgers (Taxidea taxus).[6][9]

During one study, about half of the nest failures of blue-winged teal were caused by mammals. Striped and Spotted Skunks were responsible for two-thirds of these losses. All nest losses caused by birds were attributed to either crows or magpies.[6]

See also[edit]

References[edit]

 This article incorporates public domain material from the United States Department of Agriculture document "Anas discors".

  1. ^ BirdLife International (2012). "Anas discors". IUCN Red List of Threatened Species. Version 2013.2. International Union for Conservation of Nature. Retrieved 26 November 2013. 
  2. ^ a b c d e f g h Floyd, T. (2008). Smithsonian Field Guide to the Birds of North America. New York: Harper Collins. ISBN 0-06-112040-5. 
  3. ^ a b c d Dunn, J.; Alderfer, J. (2006). National Geographic Field Guide to the Birds of North America (5th ed.). ISBN 0-7922-5314-0. 
  4. ^ a b c d e f g h DeGraaf, Richard M.; et al. (1991). "Forest and rangeland birds of the United States: Natural history and habitat use". Agric. Handb. (Washington, DC: U.S. Department of Agriculture, Forest Service) (688). 
  5. ^ a b c d e f Johnsgard, Paul A. (1979). A guide to North American waterfowl. Bloomington, IN: Indiana University Press. ISBN 0253127890. 
  6. ^ a b c d e f g h i j k l m n o p q r s Bellrose, Frank C. (1980). Ducks, geese and swans of North America (3rd ed.). Harrisburg, PA: Stackpole Books. ISBN 0811705358. 
  7. ^ Irish Birds Vol.7 (2003) p. 552, Vol. 8 (2006–7) pp. 397, 585, Vol. 9 (2008) p. 79
  8. ^ a b c Fritzell, Erik K. (1975). "Effects of agricultural burning on nesting waterfowl". Canadian Field-Naturalist 89: 21–27. 
  9. ^ a b c d e f Bennett, Logan J. (1938). The blue-winged teal: Its ecology and management. Ames, IA: Collegiate Press. 

Further reading[edit]

Creative Commons Attribution Share Alike 3.0 (CC BY-SA 3.0)

Source: Wikipedia

Unreviewed

Article rating from 0 people

Average rating: 2.5 of 5

Names and Taxonomy

Taxonomy

Comments: May hybridize in the wild with A. cyanoptera (AOU 1983). See Livezey (1991) for a phylogenetic analysis and classification (supergenera, subgenera, infragenera, etc.) of dabbling ducks based on comparative morphology. See Jackson (1991) for information on identification of North American teal.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Common Names

blue-winged teal
bluewing
summer teal
white-faced teal

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

The currently accepted scientific name for the blue-winged teal is Anas
discors Linnaeus [21]. The two subspecies recognized are listed below
[1,10]:

A. discors spp. discors (western blue-winged teal)
A. discors spp. orphna Stewart and Aldrich (Atlantic blue-winged teal)

The blue-winged teal hybridizes with the cinnamon teal (A. cyanoptera) [21].
  • 1. Bellrose, Frank C. 1980. Ducks, geese and swans of North America. Harrisburg, PA: Stackpole Books. 3rd ed. 540 p. [19802]
  • 10. Johnsgard, Paul A. 1979. A guide to North American waterfowl. Bloomington, IN: Indiana University Press. 274 p. [20026]
  • 21. Donohoe, Robert W. 1974. American hornbeam Carpinus caroliniana Walt. In: Gill, John D.; Healy, William M., eds. Shrubs and vines for northeastern wildlife. Gen. Tech. Rep. NE-9. Upper Darby, PA: U.S. Department of Agriculture, Forest Service, Northeastern Forest Experiment Station: 86-88. [13714]

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!