Articles on this page are available in 1 other language: Chinese (Simplified) (6) (learn more)

Overview

Brief Summary

Biology

In areas south of the Arctic Circle, laying begins at the end of May, whereas further north the birds wait until June. Between four and ten eggs are laid, which take 24 to 25 days to hatch. Males and non-breeding female moult shortly after the eggs hatch, but females, who continue to care for the ducklings, begin their moult later, towards the end of July. The ducklings learn to fly by August, and become independent of their parents (7). The Baikal teal feeds mainly on seeds and grain, as well as water snails, algae and other water plants (2).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Description

With such a bold and eye-catching head pattern, this teal is easily discernable from other dabbling duck species. Comprised of distinct patches of brown, green, white and black, the male's head is much brighter than the female's. Males also posses a dark-spotted pinkish breast, bluish-grey sides and black tail feathers. The shoulder feathers are particularly long and conspicuous, with streaks of chestnut-red, black and white. Females are plainer, and juveniles have dark blotches on the whitish underside. Males have a deep, chuckling wot-wot-wot sound and females emit a low quack (2)
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Distribution

Range Description

Anas formosa breeds in eastern Siberia, Russia and occurs on passage in Mongolia and North Korea. It winters mainly in Japan, South Korea, which now holds the majority of the wintering population, and mainland China, and it is a rare winter visitor to Taiwan (China) and Hong Kong (China). In the early 20th century, it was one of the most numerous ducks in eastern Asia and flocks of many thousands were regularly reported, but a significant decline took place since the 1960s and 1970s. Since then however, wintering counts in South Korea have increased spectacularly from the c.20,000 located in the 1980s to a total of 658,000 recorded during simultaneous surveys in 2004, including c. 600,000 in the lower reaches of the Geum River, and a staggering total of c.1.06 million counted in January 2009 (Moores et al. 2010, N. Moores in litt. 2010), with concentrations of over 20,000 at six different sites (N. Moores in litt. 2010). In support of the view that a genuine population increase has taken place in South Korea, an analysis of counts conducted at 38 sites every year since 1999 indicate an increase from a yearly average of 11,533 in 1999-2003 to a yearly average of 314,994 in 2005-2009 (N. Moores in litt. 2010). The increase in the South Korean wintering population is believed to be linked an increase in newly reclaimed land as well as a decline in hunting pressure (Moores 1996, Moores et al. 2010, N. Moores in litt. 2010). In January 2006 a flock of 8,000-10,000 individuals was noted at the small Chongming Dongtan Ramsar Site in China (where the previous maximum was 300 individuals) and in 2006/2007 a flock of 50,000 was recorded at Yancheng National Nature Reserve; these represent the largest flocks recorded outside of South Korea in recent years (Zhang Kejia in litt. 2006, Zhang 2006). The total national population estimate has since been placed at 91,000 individuals (Cao et al. in prep.). The species has continued to increase its numbers and range in China (Lei Cao and M. Barter in litt. 2010), and a possibly slow increase in the population has been noted in Japan since the 1990s, albeit with some fluctuation in numbers (Hironobu Tajiri in litt. 2011).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Range

E Siberia to Kamchatka; winters to India, Myanmar and Japan.

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Range

The Baikal teal breeds in eastern Siberia, Russia, and journeys through Mongolia and North Korea to winter in Japan, South Korea and mainland China. In winter it is also occasionally seen in Taiwan and Hong Kong (2), and there have been 70 records of this duck as a vagrant in Europe (6).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Ecology

Habitat

Habitat and Ecology

Habitat and Ecology
It nests in open tussock meadows near water and in mossy bogs with clumps of willows Salix and larch Larix. It winters (in dense aggregations) on freshwater lakes, rivers, reservoirs, and farmland, often roosting on water during the day and feeding in fields during the night. It feeds on seeds and grain, water snails, algae and other water plants. The species arrives on its Korean wintering grounds from September, peaking through October and November and returning north in mid March/early April (Degtyarev et al. 2006).

Systems
  • Terrestrial
  • Freshwater
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

During the breeding season the Baikal teal nests in open tussock meadows close to water, as well as in mossy bogs with stands of willows (Salix spp.) and larch (Larix spp.). Over winter, it can be found on freshwater lakes, rivers and reservoirs at night, and feeding on farmland through the day (2).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Barcode data: Anas formosa

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There are 4 barcode sequences available from BOLD and GenBank.

Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.

See the BOLD taxonomy browser for more complete information about this specimen and other sequences.

GTGACCTTCATCAATCGATGACTATTCTCTACCAACCACAAAGACATCGGCACTCTATACCTTATCTTCGGGGCATGAGCCGGAATAATTGGCACAGCACTAAGCCTACTAATCCGCGCAGAACTAGGCCAGCCAGGAACCCTCTTGGGTGATGACCAAATCTATAACGTAATCGTCACCGCCCACGCCTTCGTAATAATCTTCTTCATAGTAATGCCCATCATGATCGGGGGATTTGGCAACTGACTGGTCCCCCTGATAATCGGTGCCCCCGACATAGCCTTCCCACGAATAAACAACATAAGCTTCTGACTCCTCCCACCATCATTCCTTCTACTACTCGCCTCATCCACCGTAGAAGCTGGCGCCGGTACAGGTTGAACCGTGTATCCACCCCTAGCAGGCAACCTAGCCCACGCTGGAGCCTCGGTAGACCTAGCTATCTTTTCACTCCACCTAGCCGGTGTTTCCTCCATCCTCGGGGCCATTAACTTCATTACCACAGCCATTAACATAAAACCCCCCGCACTCTCACAATACCAAACCCCACTTTTCGTCTGATCAGTCCTGATTACCGCCATCCTGCTCCTCCTATCACTTCCCGTCCTCGCCGCCGGCATCACAATGCTACTAACTGACCGAAACCTAAACACCACATTCTTTGACCCTGCCGGAGGGGGAGACCCAATCCTGTACCAACACCTATTTTGATTCTTCGGCCACCCAGAAGTCTACATCTTAATTCTCCCAGGATTCGGAATTATCTCCCACGTAGTCACATATTACTCGGGCAAAAAAGAGCCCTTCGGCTACATGGGAATGGTCTGAGCCATGCTATCCATCGGCTTCCTGGGGTTCATCGTCTGAGCCCACCACATGTTTACCGTAGGGATAGACGTTGACACCCGAGCCTACTTCACATCTGCCACCATAATCATCGCCATCCCCACCGGAATCAAAGTTTTCAGCTGGCTCGCCACTCTGCACGGAGGGACAATCAAATGAGACCCCCCAATACTTTGAGCTCTAGGATTTATCTTCCTATTCACCATCGGAGGGCTAACAGGAATCGTCCTTGCAAACTCCTCCCTAGACATCGCCTTGCATGACACATACTACGTAGTCGCCCACTTCCACTACGTATTATCCATAGGCGCTGTCTTTGCTATCCTAGCTGGGTTTACCCACTGATTCCCCCTTCTTACAGGATTCACCCTCCACCAAACATGAGCAAAAGCCCACTTCGGTGTAATATTCACAGGAGTAAACCTAACATTCTTCCCACAACACTTCCTAGGCCTAGCGGGAATACCTCGACGATACTCGGACTACCCTGACGCCTACACACTGTGAAACACCGTCTCCTCTATTGGATCCCTAATCTCAATAGTAGCCGTAATCATGCTAATATTCATCATCTGAGAAGCCTTCTCAGCCAAGCGGAAAGTCCTACAGCCAGAACTAACTGCCACAAACATTGAATGAATCCACGGCTGCCCTCCCCCATACCACACTTTCGAGGAACCAGCTTTCGTACAAGTACAAGAAAGG
-- end --

Download FASTA File

Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Statistics of barcoding coverage: Anas formosa

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 9
Specimens with Barcodes: 12
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Conservation

Conservation Status

IUCN Red List Assessment


Red List Category
LC
Least Concern

Red List Criteria

Version
3.1

Year Assessed
2012

Assessor/s
BirdLife International

Reviewer/s
Butchart, S. & Symes, A.

Contributor/s
Crosby, M., Lei, C., Hironobu, T., Lee, H., Chan, S., Moores, N. & Barter, M.

Justification
This species is listed as Least Concern as its population is now growing rapidly and has not undergone the once-predicted declines. Despite its current population trend, the species remains potentially threatened by a number of factors. It tends to congregate in very large flocks, and suffered rapid declines in many parts of its range during the twentieth century because of hunting and other threats. Its roost sites are unprotected, large numbers died in a recent disease outbreak, and most importantly, the dry rice paddies where it feeds are being converted to vegetable farms and other uses. If evidence arises in the future that these threats have begun to drive a decline, the species may warrant uplisting.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Status

The Baikal teal is classified as Vulnerable (VU A3c) on the IUCN Red List 2004 (1) and is listed on Appendix II of CITES (3). It is also listed on Appendix I of the Convention on the Conservation of Migratory Species (CMS or Bonn Convention) (4) and on Appendix III of the Berne Convention on the Conservation of European Wildlife and Natural Habitats (5).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Population

Population
The 2004 Asian Waterbird Census estimated the population in Korea at 455,000 individuals (D. Li in litt. 2005; Wetlands International 2006). A separate study in 2004 reported 658,000 individuals in Korea (Hansoo Lee in litt. 2004), but this could be an over-estimate. Further to this, Brazil (2009) has estimated national population sizes at
Population Trend
Increasing
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Threats

Major Threats
Hunting was probably the main reason for its decline and is still a serious threat, particularly as it concentrates in large flocks on wetlands and arable land. However, hunting itself is now thought to be in decline (Moores 1996, Moores et al. 2010). In China and South Korea, birds are killed by poisoned grain; pesticide poisoning and pollution from agricultural and household wastes are thought to be a serious problem in the Geum River, South Korea (Degtyarev et al. 2006). Large declines in the numbers of Anatidae have occurred in Sanjiang plain and Poyang Hu, China, as a result of habitat loss to agricultural development and hunting. Wintering sites in South Korea are largely unprotected and threatened by the development of wetlands (N. Moores in litt. 2010); there has been a recent proposal for building the largest tourist development in northeast Asia on the Haenem reclamation site, a key site for wintering Baikal Teal (C. Moores in litt. 2005). Also, its habit of forming dense aggregations in winter renders the species susceptible to infectious diseases; 10,000 birds were recorded dead owing to avian cholera in October, 2002 (Degtyarev et al. 2006). The species suffers from disturbance at the Geum River with up to 12 incidences per day of disturbance from low flying aircraft (Degtyarev et al. 2006).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Intense trophy hunting caused the initial decline of this species, and is still considered a threat. The Baikal teal gathers in large flocks on wetlands, making it an easy target. In China and South Korea, this duck is also killed with poisoned grain. In both China and South Korea, however, the main cause of decline is now habitat loss, as wetlands are converted to agricultural land and developed into urban areas (2).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Management

Conservation Actions

Conservation Actions
Conservation Actions Underway
CITES Appendix II, CMS Appendix II. It is legally protected in Russia, Mongolia, Japan, South Korea, Hong Kong and some provinces in China; and is listed in the Red Data Books of South Korea, Russia and Yakutia (Degtyarev et al. 2006). Some important sites are protected areas, including Bolob lake and Khanka lake (Russia), the Geum River (South Korea [Degtyarev et al. 2006]) and Katano duck pond (Japan). Annual monitoring takes place in parts of its range (Degtyarev et al. 2006).

Conservation Actions Proposed
Continue to study its population trend and establish more protected areas in its breeding grounds. Research its wintering status in China. Draft and implement a management plan for the wintering population in South Korea. Regulate hunting of all Anatidae species in China. Ensure its legal protection in all range states. Carry out efforts to reduce disturbance at key sites (N. Moores in litt. 2010). Garner the support of farmers for the conservation of this and other rice field species (N. Moores in litt. 2010).

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Conservation

The Baikal teal is protected by national legislation in Russia, Mongolia, Japan, South Korea, Hong Kong, and some provinces in mainland China. Some important teal populations occur within protected areas, such as Bolob Lake and Khanka Lake in Russia, and Katano duck pond in Japan. However, the law is poorly enforced, and declines continue. Plans to study the decline and to research the wintering status in China, as well as regulating the hunting of all duck species throughout China may help to prevent the continuation of this species' decline. A management plan is being drafted for the wintering population of South Korea, and all range states will be urged to give the Baikal teal legal protection (2).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Wikipedia

Baikal Teal

Baikal Teal

The Baikal Teal (Anas formosa), also called the Bimaculate Duck or Squawk Duck, is a dabbling duck that breeds in eastern Russia and winters in East Asia.

Contents

Description

At between 39 and 43 centimetres (15 and 17 in), this duck is slightly larger and longer-tailed than the Common Teal. The breeding male is unmistakable, with a striking green nape, yellow and black auriculars, neck, and throat. It has a dark crown, and its breast is light brown with dark spots. It has long dropping dark scapulars, and its grey sides are set off on the front and rear with white bars..

The Baikal Teal has a height from 11.75 to 15.75 inches and a weighs an average of 1 pound.

The female looks similar to a female Green-winged Teal but with a longer tail, and a distinctive white spot at the base of the bill and a white throat that angles to the back of the eye. She also has a distinct light eyebrow bordered by a darker crown. The underwing is similar to the Green-winged Teal also, but has a darker leading edge. The green speculum has an indistinct cinnamon-buff inner border.[2] Some "females" have "bridle" markings on their faces, but it has been suggested that at least some of these bridled "females," if not all, are in fact juvenile males.[2] The juvenile has a plumage similar to that of the female and can be distinguished from the Common Teal by the pale loral spot.

In non-breeding (eclipse) plumage, the drake looks more like the female, but plumage is a much richer reddish-brown (rufous) colour.

Taxonomy

Molecular[3] and behavioral[4] data suggest that it has no close relatives among living ducks and should be placed in a distinct genus; it is possibly closest to such species as the Garganey and the Northern Shoveler.

Distribution and habitat

It breeds within the forest zone of eastern Siberia from the Yenisey basin eastwards to Kamchatka, northern Koryak, eastern Magadan Oblast, northern Khabarovsk Krai, southeastern and northern Sakha east central Irkutsk Oblast, and northern Krasnoyarsk Krai. It is a migratory species, wintering in South Korea, Japan, Taiwan, northern and eastern China, from Beijing down the coast to the Vietnam border, and west to Yunnan then north to Chongqing and Henan.[1][5]

It breeds in pools on the tundra edge and within swampy forests. In winter it is found on lowland fresh waters.

Status

This species is classified as Least Concern on the IUCN Red List, though it was classified as Vulnerable before 2011 due to hunting and destruction of its wintering wetland habitats.[1] These threats remain, but the Baikal Teal is recovering, with increased numbers of wintering birds and some increase in habitat area. Based on the numbers of Baikal Teal counted wintering in South Korea, the global population is estimated to be around 1.07 million individual adults around 2010, a major increase from the tens of thousands counted in the 1980s and few hundreds of thousands in the 2000s.[2][6][7]

Gallery

References

  1. ^ a b c BirdLife International (2011). "Anas formosa". IUCN Red List of Threatened Species. Version 2011.2. International Union for Conservation of Nature. Archived from the original on 6 January 2012. http://www.webcitation.org/64UkULjo8. 
  2. ^ a b c Dunn, John L.; Alderfer, Jonathan (2006). National Geographic Field Guide to the Birds of North America (5th ed.). ISBN 0-7922-5314-0. 
  3. ^ Johnson, Kevin P.; Sorenson, Michael D. (1999). "Phylogeny and biogeography of dabbling ducks (genus Anas): a comparison of molecular and morphological evidence" (PDF). Auk 116 (3): 792–805. http://elibrary.unm.edu/sora/Auk/v116n03/p0792-p0805.pdf. 
  4. ^ Johnson, Kevin P.; McKinney, Frank; Wilson, Robert; Sorenson, Michael D. (2000). "The evolution of postcopulatory displays in dabbling ducks (Anatini): a phylogenetic perspective" (PDF). Animal Behaviour 59 (5): 953–963. DOI:10.1006/anbe.1999.1399. PMID 10860522. http://ducksrus.bu.edu/~msoren/pubs/AnimBehav2000b.pdf. 
  5. ^ Clements, James (2007). "The Clements Checklist of the Birds of the World". Cornell University Press. http://www.cornellpress.cornell.edu/cup_detail.taf?ti_id=4566. 
  6. ^ BirdLife International (2012). "Species factsheet: Anas formosa". Archived from the original on 6 January 2012. http://www.webcitation.org/64Uk3n2iD. Retrieved 6 January 2012. 
  7. ^ Planet Earth episode 1: "From Pole to Pole" (Television production). BBC. 3 May 2006. 
Creative Commons Attribution Share Alike 3.0 (CC BY-SA 3.0)

Source: Wikipedia

Unreviewed

Article rating from 0 people

Default rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!