Articles on this page are available in 1 other language: Chinese (Simplified) (6) (learn more)

Overview

Brief Summary

Biology

In areas south of the Arctic Circle, laying begins at the end of May, whereas further north the birds wait until June. Between four and ten eggs are laid, which take 24 to 25 days to hatch. Males and non-breeding female moult shortly after the eggs hatch, but females, who continue to care for the ducklings, begin their moult later, towards the end of July. The ducklings learn to fly by August, and become independent of their parents (7). The Baikal teal feeds mainly on seeds and grain, as well as water snails, algae and other water plants (2).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Description

With such a bold and eye-catching head pattern, this teal is easily discernable from other dabbling duck species. Comprised of distinct patches of brown, green, white and black, the male's head is much brighter than the female's. Males also posses a dark-spotted pinkish breast, bluish-grey sides and black tail feathers. The shoulder feathers are particularly long and conspicuous, with streaks of chestnut-red, black and white. Females are plainer, and juveniles have dark blotches on the whitish underside. Males have a deep, chuckling wot-wot-wot sound and females emit a low quack (2)
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Distribution

Baikal teals (Anas formosa) are seasonally migratory birds, typically travelling between north and east Siberia to southeast China. The birds travel to Siberia, Russia to breed in the summer, and migrate to southern Japan, southeastern China, and South Korea for the winter. In Siberia, these ducks can be found as far north as seventy degrees north latitude and west as far as eighty-five degrees east longitude. When wintering, the ducks can sometimes be found as far south as Myanmar and northeastern India. The wintering range may be growing in China, according to recent trends. However, the main concentration for wintering Baikal teals remains South Korea, with a population of over one million ducks in 2009. Vagrant ducks have been found in Alaska and the north-eastern coast of the United States, and occasionally in Europe. Many would attribute sightings in North America and Europe to the domestication and mass sale of these birds globally in the early 20th century. However, some individuals have been known to migrate from wild breeding grounds in Siberia to central Europe.

Biogeographic Regions: nearctic (Introduced ); palearctic (Native ); oriental (Introduced ); mediterranean sea (Introduced )

  • 1990. Distribution and Taxonomy of Birds of the World. New Haven, Connecticut: Yale University Press.
  • 2009. Birds of Europe. Princeton, New Jersey: Princeton University Press.
  • Bearhop, S. 2007. Using stable isotope analysis of multiple feather tracts to identify moulting provenance of vagrant birds: a case study of Baikal Teal Anas formosa in Denmark. IBIS: International Journal of Avian Science, 139/3: 622-625.
  • Howard, R., A. Moore. 1980. A Complete Check-list of Birds of the World. Oxford and New York: Oxford University Press.
  • Lei, C., S. Chan. 2012. "Baikal teal, Anas formosa" (On-line). Waterbirds. Accessed February 10, 2012 at http://www.birdlife.org/datazone/speciesfactsheet.php?id=461#FurtherInfo.
  • USDA Agricultural Resource Center. Wild birds introduced or transplanted in North America. Technical Bulletin No.61. Lincoln, Nebraska: U.S. Department of Agriculture. 1928. Accessed February 09, 2012 at http://digitalcommons.unl.edu/usdaarsfacpub/819/.
  • Young, G. 2010. "Baikal teal, Anas formosa" (On-line). ARKive Images of Life on Earth. Accessed February 09, 2012 at http://www.arkive.org/baikal-teal/anas-formosa/#text=References.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Range

E Siberia to Kamchatka; winters to India, Myanmar and Japan.
  • Clements, J. F., T. S. Schulenberg, M. J. Iliff, D. Roberson, T. A. Fredericks, B. L. Sullivan, and C. L. Wood. 2014. The eBird/Clements checklist of birds of the world: Version 6.9. Downloaded from http://www.birds.cornell.edu/clementschecklist/download/

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Range

The Baikal teal breeds in eastern Siberia, Russia, and journeys through Mongolia and North Korea to winter in Japan, South Korea and mainland China. In winter it is also occasionally seen in Taiwan and Hong Kong (2), and there have been 70 records of this duck as a vagrant in Europe (6).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Physical Description

Morphology

During the breeding season, from July through October, male teals display a vibrant plumage that makes them unmistakable. The males have gold on each cheek, a black stripe on the top of the head bordered by small white streaks, and a black line from each eye to the throat. The summer breeding plumage of males also includes dark pinkish breasts with a white stripe down the center, small white lines from the side of the breasts up to the shoulder, blue-grey sides, a black under tail, brown on the back, and long shoulder feathers with a black, white, and light brown streak pattern. Females are mostly brown covered with dark spots with an anterior whitish neck often extending to the cheeks. The facial pattern is highly contrasting, with dark eye stripes behind the eyes, and a small white patch of feathers in front of the eye on a dark background. During the non-breeding season, the males resemble the females in their complete brown color, but may retain some of the patterns near their eyes. The juveniles are brown with less contrast and definite patterns than the females. Male average weight is 437 grams, and the female averages 431 grams. The typical length of the duck is 39 to 43 cm, and adult wingspan ranges from 180 to 220 mm.

Range mass: 431 to 437 g.

Range length: 39 to 43 cm.

Range wingspan: 180 to 220 mm.

Sexual Dimorphism: sexes colored or patterned differently; male more colorful

Other Physical Features: endothermic ; bilateral symmetry

  • 2010. Wildfowl. London, U.K.: A&C Black.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Ecology

Habitat

During the summer breeding season in Siberia, the ducks mate in freshwater ponds and pools in taiga and tundra regions. Nests can generally be found in nearby fields or among small stands of trees in bogs. In the winter, the birds arrive in southeast Asia to feed and allow adolescents to fully mature in the freshwater rivers and lakes, and occasionally in brackish water areas as well. When in their wintering zones, they typically stay near farmlands, feeding in the fields at night and staying on the water during the day. These birds are often seen on their wintering waterways in very large groups mixed with other species of ducks.

Range elevation: 0 to 4500 m.

Average elevation: 440 m.

Habitat Regions: temperate ; terrestrial ; freshwater

Terrestrial Biomes: tundra ; taiga

Aquatic Biomes: lakes and ponds; rivers and streams; brackish water

Wetlands: marsh ; swamp ; bog

Other Habitat Features: agricultural

  • 2009. Birds of Europe, Russia, China, and Japan. Princeton, New Jersey: Princeton University Press.
  • Lee, H., T. Hironobu, C. Lei, N. Moores, M. Barter, S. Chan, M. Crosby. 2011. "Anas formosa" (On-line). The IUCN red list of threatened species. Accessed February 09, 2012 at http://www.iucnredlist.org/apps/redlist/details/100600461/0.
  • Lewthwaite, R., L. Cao, L. Barter. 2008. The declining importance of the Fujian coast, China, for wintering waterbirds. Waterbirds, 31/4: 645-650.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

During the breeding season the Baikal teal nests in open tussock meadows close to water, as well as in mossy bogs with stands of willows (Salix spp.) and larch (Larix spp.). Over winter, it can be found on freshwater lakes, rivers and reservoirs at night, and feeding on farmland through the day (2).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Trophic Strategy

Baikal teals feed mostly on grains and seeds, but also consumes small, usually aquatic, invertebrates such as water snails. The ducks tend to feed in agricultural fields in the night and remain on the water during the day, sleeping and feeding on algae and aquatic plants.

Animal Foods: insects; terrestrial non-insect arthropods; mollusks; terrestrial worms; aquatic or marine worms; aquatic crustaceans; other marine invertebrates

Plant Foods: seeds, grains, and nuts; algae

Primary Diet: carnivore (Molluscivore ); herbivore (Granivore , Algivore); omnivore

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Associations

Baikal teals help keep insect pest populations in balance as they feed on them. They also feed on large numbers of fresh water crustaceans. The major parasites found in these birds are various species of roundworms that are found in the dabbling duck's aquatic prey. Species include Streptocara incognita, Streptocara crassicauda, Echinuria uncinata. These parasitic nematodes often may not reach the adult stage of their life cycle until they enter the avian hosts as eggs or larvae.

Ecosystem Impact: disperses seeds

Commensal/Parasitic Species:

  • Atkinson, C., N. Thomas, D. Hunter. 2008. Parasitic diseases of wild birds. Ames, Iowa: Wiley-Blackwell.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Ducklings of Baikal teals may fall prey to small ground predators, such as common dogs, cats, and foxes. However, few, if any, ground-dwelling predators can catch an uninjured adult duck. Some winged predators, such as the peregrine falcon and some owls can prey upon the ducks, as well as water-dwelling predators such as the Chinese alligator.

Known Predators:

  • Farrand, J., S. Weidensaul. 1990. Ducks. New York, NY: Random House Value Publishing.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Life History and Behavior

Behavior

Baikal teals, as with most ducks, communicate with quacks. Females of most dabbling ducks, including Baikal teals, quack in what is called "decrescendo calls". These are so named because they typically decrease in volume with succession. Males communicate, especially during breeding season, with a low, throaty "wot-wot-wot grunt." The pair-mating displays of dabbling ducks tend to be elaborate, but the males simply quack as they vertically stretch their necks, creating what is called a "burp." The females perform "nod swimming," swimming with their heads down and nodding quickly as they pass by the males. Male breeding plumage plays a role in the perception of mates. Because the females choose their mates, the plumage perception and communication of mating displays usually prevents hybridization, though many species of ducks can successfully interbreed.

Communication Channels: acoustic

Perception Channels: visual ; tactile ; acoustic ; chemical

  • Johnsgard, P. 1968. Waterfowl: Their Biology and Natural History. Lincoln, Nebraska: University of Nebraska Press.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Life Expectancy

Dabbling ducks closely related to Baikal teals, such as mallards, have been known to commonly reach the age of 25 years in the wild when not hunted. Hunting is the only major threat to the ducks resulting in a shortened lifespan.

  • Burton, M., R. Burton. 2002. International wildlife encyclopedia: Leopard-marten. Tarrytown, New York: Marshall Cavendish Corporation.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Reproduction

Typically migrating to Siberian swampy woodland and meadow breeding grounds at the near the end of March, individuals of Baikal teals soon begin courtship displays. These species-specific displays include the males "burping", a call made by quacking while vertically stretching the throat, and the females "nod-swimming." Almost all ducks are generally monogamous, but only for one breeding season. In late May, female Baikal teals choose the location and build their own nests, and lay between four and ten eggs. The eggs hatch approximately 24 days later. Most of the ducklings have learned to fly and have become independent from the mother by August.

Mating System: monogamous

Baikal teals migrate north to eastern Siberia to breed, nest, and raise their young. The pair-forming displays help the ducks identify and select members of their own species with whom to breed. Female Baikal teals protect the eggs and continue to care for the ducklings until they reach independence at the beginning of August, approximately 4 to 5 weeks post-hastching.

Breeding interval: Baikal teals breed once yearly in late spring.

Breeding season: Baikal teals breed annually in May.

Range eggs per season: 4 to 10.

Range time to hatching: 24 to 25 days.

Range fledging age: 4 to 5 weeks.

Range time to independence: 4 to 5 weeks.

Average age at sexual or reproductive maturity (female): 1 years.

Average age at sexual or reproductive maturity (male): 1 years.

Key Reproductive Features: iteroparous ; seasonal breeding ; gonochoric/gonochoristic/dioecious (sexes separate); sexual ; fertilization ; oviparous

Parental Investment: female parental care ; pre-hatching/birth (Protecting: Female); pre-weaning/fledging (Provisioning: Female, Protecting: Female); pre-independence (Protecting: Female)

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Barcode data: Anas formosa

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There are 4 barcode sequences available from BOLD and GenBank.

Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.

See the BOLD taxonomy browser for more complete information about this specimen and other sequences.

GTGACCTTCATCAATCGATGACTATTCTCTACCAACCACAAAGACATCGGCACTCTATACCTTATCTTCGGGGCATGAGCCGGAATAATTGGCACAGCACTAAGCCTACTAATCCGCGCAGAACTAGGCCAGCCAGGAACCCTCTTGGGTGATGACCAAATCTATAACGTAATCGTCACCGCCCACGCCTTCGTAATAATCTTCTTCATAGTAATGCCCATCATGATCGGGGGATTTGGCAACTGACTGGTCCCCCTGATAATCGGTGCCCCCGACATAGCCTTCCCACGAATAAACAACATAAGCTTCTGACTCCTCCCACCATCATTCCTTCTACTACTCGCCTCATCCACCGTAGAAGCTGGCGCCGGTACAGGTTGAACCGTGTATCCACCCCTAGCAGGCAACCTAGCCCACGCTGGAGCCTCGGTAGACCTAGCTATCTTTTCACTCCACCTAGCCGGTGTTTCCTCCATCCTCGGGGCCATTAACTTCATTACCACAGCCATTAACATAAAACCCCCCGCACTCTCACAATACCAAACCCCACTTTTCGTCTGATCAGTCCTGATTACCGCCATCCTGCTCCTCCTATCACTTCCCGTCCTCGCCGCCGGCATCACAATGCTACTAACTGACCGAAACCTAAACACCACATTCTTTGACCCTGCCGGAGGGGGAGACCCAATCCTGTACCAACACCTATTTTGATTCTTCGGCCACCCAGAAGTCTACATCTTAATTCTCCCAGGATTCGGAATTATCTCCCACGTAGTCACATATTACTCGGGCAAAAAAGAGCCCTTCGGCTACATGGGAATGGTCTGAGCCATGCTATCCATCGGCTTCCTGGGGTTCATCGTCTGAGCCCACCACATGTTTACCGTAGGGATAGACGTTGACACCCGAGCCTACTTCACATCTGCCACCATAATCATCGCCATCCCCACCGGAATCAAAGTTTTCAGCTGGCTCGCCACTCTGCACGGAGGGACAATCAAATGAGACCCCCCAATACTTTGAGCTCTAGGATTTATCTTCCTATTCACCATCGGAGGGCTAACAGGAATCGTCCTTGCAAACTCCTCCCTAGACATCGCCTTGCATGACACATACTACGTAGTCGCCCACTTCCACTACGTATTATCCATAGGCGCTGTCTTTGCTATCCTAGCTGGGTTTACCCACTGATTCCCCCTTCTTACAGGATTCACCCTCCACCAAACATGAGCAAAAGCCCACTTCGGTGTAATATTCACAGGAGTAAACCTAACATTCTTCCCACAACACTTCCTAGGCCTAGCGGGAATACCTCGACGATACTCGGACTACCCTGACGCCTACACACTGTGAAACACCGTCTCCTCTATTGGATCCCTAATCTCAATAGTAGCCGTAATCATGCTAATATTCATCATCTGAGAAGCCTTCTCAGCCAAGCGGAAAGTCCTACAGCCAGAACTAACTGCCACAAACATTGAATGAATCCACGGCTGCCCTCCCCCATACCACACTTTCGAGGAACCAGCTTTCGTACAAGTACAAGAAAGG
-- end --

Download FASTA File

Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Statistics of barcoding coverage: Anas formosa

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 9
Specimens with Barcodes: 12
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Conservation

Conservation Status

Baikal teals are not currently endangered, but is classified as vulnerable. In the 1980s and 1990s these ducks were in decline and became rare due to over-hunting. Now, however, they are increasing in number every year because of greatly decreased trade and the decreased need for the use of the species as a major food source. Baikal teals are listed by the Convention on International Trade of Endangered Species of Wild Fauna and Flora (CITES) under Appendix II, meaning that though the species is not endangered, it could possibly become so if trade and exploitation is unregulated.

US Migratory Bird Act: no special status

US Federal List: no special status

CITES: appendix ii

State of Michigan List: no special status

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Status

The Baikal teal is classified as Vulnerable (VU A3c) on the IUCN Red List 2004 (1) and is listed on Appendix II of CITES (3). It is also listed on Appendix I of the Convention on the Conservation of Migratory Species (CMS or Bonn Convention) (4) and on Appendix III of the Berne Convention on the Conservation of European Wildlife and Natural Habitats (5).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Threats

Intense trophy hunting caused the initial decline of this species, and is still considered a threat. The Baikal teal gathers in large flocks on wetlands, making it an easy target. In China and South Korea, this duck is also killed with poisoned grain. In both China and South Korea, however, the main cause of decline is now habitat loss, as wetlands are converted to agricultural land and developed into urban areas (2).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Management

Conservation

The Baikal teal is protected by national legislation in Russia, Mongolia, Japan, South Korea, Hong Kong, and some provinces in mainland China. Some important teal populations occur within protected areas, such as Bolob Lake and Khanka Lake in Russia, and Katano duck pond in Japan. However, the law is poorly enforced, and declines continue. Plans to study the decline and to research the wintering status in China, as well as regulating the hunting of all duck species throughout China may help to prevent the continuation of this species' decline. A management plan is being drafted for the wintering population of South Korea, and all range states will be urged to give the Baikal teal legal protection (2).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Relevance to Humans and Ecosystems

Benefits

There are no known ways in which Baikal teals have a negative economic impact on humans.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Baikal teals are considered to be among the most beautiful ducks in the world, and are hunted for their feathers, meat, and for sport. The ducks are also traded as pets for their ornamental value.

Positive Impacts: pet trade ; food ; controls pest population

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Wikipedia

Baikal Teal

Baikal Teal

The Baikal Teal (Anas formosa), also called the Bimaculate Duck or Squawk Duck, is a dabbling duck that breeds in eastern Russia and winters in East Asia.

Contents

Description

At between 39 and 43 centimetres (15 and 17 in), this duck is slightly larger and longer-tailed than the Common Teal. The breeding male is unmistakable, with a striking green nape, yellow and black auriculars, neck, and throat. It has a dark crown, and its breast is light brown with dark spots. It has long dropping dark scapulars, and its grey sides are set off on the front and rear with white bars..

The Baikal Teal has a height from 11.75 to 15.75 inches and a weighs an average of 1 pound.

The female looks similar to a female Green-winged Teal but with a longer tail, and a distinctive white spot at the base of the bill and a white throat that angles to the back of the eye. She also has a distinct light eyebrow bordered by a darker crown. The underwing is similar to the Green-winged Teal also, but has a darker leading edge. The green speculum has an indistinct cinnamon-buff inner border.[2] Some "females" have "bridle" markings on their faces, but it has been suggested that at least some of these bridled "females," if not all, are in fact juvenile males.[2] The juvenile has a plumage similar to that of the female and can be distinguished from the Common Teal by the pale loral spot.

In non-breeding (eclipse) plumage, the drake looks more like the female, but plumage is a much richer reddish-brown (rufous) colour.

Taxonomy

Molecular[3] and behavioral[4] data suggest that it has no close relatives among living ducks and should be placed in a distinct genus; it is possibly closest to such species as the Garganey and the Northern Shoveler.

Distribution and habitat

It breeds within the forest zone of eastern Siberia from the Yenisey basin eastwards to Kamchatka, northern Koryak, eastern Magadan Oblast, northern Khabarovsk Krai, southeastern and northern Sakha east central Irkutsk Oblast, and northern Krasnoyarsk Krai. It is a migratory species, wintering in South Korea, Japan, Taiwan, northern and eastern China, from Beijing down the coast to the Vietnam border, and west to Yunnan then north to Chongqing and Henan.[1][5]

It breeds in pools on the tundra edge and within swampy forests. In winter it is found on lowland fresh waters.

Status

This species is classified as Least Concern on the IUCN Red List, though it was classified as Vulnerable before 2011 due to hunting and destruction of its wintering wetland habitats.[1] These threats remain, but the Baikal Teal is recovering, with increased numbers of wintering birds and some increase in habitat area. Based on the numbers of Baikal Teal counted wintering in South Korea, the global population is estimated to be around 1.07 million individual adults around 2010, a major increase from the tens of thousands counted in the 1980s and few hundreds of thousands in the 2000s.[2][6][7]

Gallery

References

  1. ^ a b c BirdLife International (2011). "Anas formosa". IUCN Red List of Threatened Species. Version 2011.2. International Union for Conservation of Nature. Archived from the original on 6 January 2012. http://www.webcitation.org/64UkULjo8. 
  2. ^ a b c Dunn, John L.; Alderfer, Jonathan (2006). National Geographic Field Guide to the Birds of North America (5th ed.). ISBN 0-7922-5314-0. 
  3. ^ Johnson, Kevin P.; Sorenson, Michael D. (1999). "Phylogeny and biogeography of dabbling ducks (genus Anas): a comparison of molecular and morphological evidence" (PDF). Auk 116 (3): 792–805. http://elibrary.unm.edu/sora/Auk/v116n03/p0792-p0805.pdf. 
  4. ^ Johnson, Kevin P.; McKinney, Frank; Wilson, Robert; Sorenson, Michael D. (2000). "The evolution of postcopulatory displays in dabbling ducks (Anatini): a phylogenetic perspective" (PDF). Animal Behaviour 59 (5): 953–963. DOI:10.1006/anbe.1999.1399. PMID 10860522. http://ducksrus.bu.edu/~msoren/pubs/AnimBehav2000b.pdf. 
  5. ^ Clements, James (2007). "The Clements Checklist of the Birds of the World". Cornell University Press. http://www.cornellpress.cornell.edu/cup_detail.taf?ti_id=4566. 
  6. ^ BirdLife International (2012). "Species factsheet: Anas formosa". Archived from the original on 6 January 2012. http://www.webcitation.org/64Uk3n2iD. Retrieved 6 January 2012. 
  7. ^ Planet Earth episode 1: "From Pole to Pole" (Television production). BBC. 3 May 2006. 
Creative Commons Attribution Share Alike 3.0 (CC BY-SA 3.0)

Source: Wikipedia

Unreviewed

Article rating from 0 people

Default rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!