Articles on this page are available in 2 other languages: Chinese (Simplified) (5), Dutch (1) (learn more)

Overview

Brief Summary

Teal are the smallest European duck species. The birds are rapid flyers, flapping their wings quickly. This gives the impression that they are constantly in a rush. In large groups, they often make unexpected turns and tumbles in the air. Teal are active at night and make lots of noise.
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© Copyright Ecomare

Source: Ecomare

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Anas crecca

One of the smallest ducks in North America at only 14 inches in length, the Green-winged Teal is second only to the Mallard in number of individuals taken by North American duck hunters. Aside from the large green wing patch which gives this species its name, the male Green-winged Teal is characterized by a reddish-brown head, green head patch, gray-brown back, speckled-brown breast and yellow under-tail patches. Females are drab-brown overall with a smaller green wing patch, but may be recognized as teals by their small size. Green-winged Teals are found across the Northern Hemisphere. The North American subspecies (A. crecca carolinensis) breeds from Alaska to eastern Canada and south to the northern tier of the United States. In winter, Green-winged Teals migrate south, and may be found along the Pacific, Atlantic, and Gulf coasts of the U.S., in the interior in the southern half of the country, and points south. The Eurasian subspecies, (A. crecca crecca) breeds across northern Eurasia, wintering south to North Africa, India, and China. In summer, the Green-winged Teal breeds primarily on ponds in open wooded parkland, but may also breed on bodies of water near prairies or in river deltas. This species may be found more generally in shallow wetlands throughout its winter range. Green-winged Teals consume grasses, aquatic plants, insects, larvae, and crustaceans. Green-winged Teals may be seen either on land or in the water, where they may be observed foraging for food. This species may also be observed undertaking straight, swift flights on migration or between breeding or foraging grounds. Green-winged Teals are most active during the day.

Threat Status: Least concern

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Unknown

Supplier: DC Birds

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Biology

The courtship display of the drake teal involves the bird dipping the tip of its bill under the surface of the water, then whistling, arching its back and tipping its head back, while raising its wings across its back and cocking its tail. Like most ducks, female teals take sole responsibility for rearing the ducklings. The nest is constructed on dry ground on an upland moor, often amongst bracken or under gorse. The nest is lined with dried leaves and down from the female's breast. The eggs, laid in April or May, are greeny-buff and may number as many as ten. They hatch after three weeks of incubation and the duck leads them down to water as soon as the ducklings' down is dry. Teal feed on waterweed, insects and other water invertebrates. Teal have been a quarry species for centuries as they are considered very good eating. Bones from the birds have been found in the Roman settlement of Silchester in Hampshire.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Description

The teal is one of the smallest wild ducks in the UK. The drake (male) in breeding plumage is also one of the most handsome of birds. The body is pale grey, finely lined with darker striations on the underside, and slightly broader markings on the back and wings, with a cream chest patch featuring fine black spots. The head is a dark brick red, almost russet, boldly crossed by a broad bottle-green eye stripe lined with cream. Under the black and white patterned tail, there is a noticeable creamy-yellow patch, which is very conspicuous in flight. The female is typically mottled brown, as are the males after moulting when they are said to be in 'eclipse', and juveniles. Both sexes display a wing-bar in flight; this bar is dark green and black with a white flash in front of the other two colours. The drakes make a distinctive ringing whistle similar to that of the pintail but higher pitched, and thought by some to have inspired the common English name. The female makes a soft and high-pitched quack.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Comprehensive Description

Description of Anas crecca

Het mannetje heeft een rood-en-groene kop en het vrouwtje is vrijwel totaal bruin.
Creative Commons Attribution 3.0 (CC BY 3.0)

1geron

Source: BioPedia

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Distribution

All three green-winged teal subspecies occur in the northern hemisphere
during summer and in winter extend to northern South America, central
Africa, southern India, Burma, and the Philippines. In North America,
ssp. carolinensis occurs across the continent and is joined in the
Aleutian Islands by ssp. nimia, which remains there throughout the year.
Anas crecca breeds in Iceland, Europe, and Asia. It is also seen
occasionally during the winter in North America along the Atlantic Coast
[1,9].

The American green-winged teal breeds from the Aleutian Islands,
northern Alaska, Mackenzie River delta, northern Saskatchewan, Manitoba,
Ontario, Quebec, and Labrador south to central California, central
Nebraska, central Kansas, southern Minnesota, Wisconsin, Ontario,
Quebec, Newfoundland, and the Maritime Provinces [1,4].

The American green-winged teal winters from southern Alaska and southern
British Columbia east to New Brunswick and Nova Scotia and south to
Central America. It also winters in Hawaii [4,10].
  • 1. Bellrose, Frank C. 1980. Ducks, geese and swans of North America. Harrisburg, PA: Stackpole Books. 3rd ed. 540 p. [19802]
  • 4. DeGraaf, Richard M.; Scott, Virgil E.; Hamre, R. H.; [and others]
  • 9. Johnsgard, Paul A. 1979. A guide to North American waterfowl. Bloomington, IN: Indiana University Press. 274 p. [20026]
  • 10. Johnson, Douglas H.; Grier, James W. 1988. Determinants of breeding distribution of ducks. Wildlife Monographs. 100: 1-37. [21350]

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Regional Distribution in the Western United States

More info on this topic.

This species can be found in the following regions of the western United States (according to the Bureau of Land Management classification of Physiographic Regions of the western United States):

1 Northern Pacific Border
2 Cascade Mountains
3 Southern Pacific Border
4 Sierra Mountains
5 Columbia Plateau
6 Upper Basin and Range
7 Lower Basin and Range
8 Northern Rocky Mountains
9 Middle Rocky Mountains
10 Wyoming Basin
11 Southern Rocky Mountains
12 Colorado Plateau
13 Rocky Mountain Piedmont
14 Great Plains
15 Black Hills Uplift
16 Upper Missouri Basin and Broken Lands

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Djibouti, Eritrea, Gulf of Mexico, North West Atlantic, Polish Exclusive Economic Zone, Portuguese Exclusive Economic Zone, Red Sea, Somalia, Spanish Exclusive Economic Zone, Swedish Exclusive Economic Zone, United Kingdom Exclusive Economic Zone, Wimereux
Creative Commons Attribution 3.0 (CC BY 3.0)

© WoRMS for SMEBD

Source: World Register of Marine Species

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Occurrence in North America

AL AK AZ AR CA CO CT DE FL GA HI
ID IL IN IA KS KY LA ME MD MA
MI MN MS MO MT NE NV NH NJ NM
NY NC ND OH OK OR PA RI SC SD
TN TX UT VT VA WA WV WI WY DC


AB BC MB NB NF NT NS ON PE PQ
SK YT



MEXICO

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Geographic Range

Green-winged Teals breed throughout most of Canada, Alaska, Maine, N. Dakota, Minnesota, and Northern Michigan. Their wintering range includes the western United States, Mexico, and the southern United States. Two other subspecies of the Teal, A. c. crecca and A. c. nimia, can be found in Eurasia and the Aleutian Islands.

Biogeographic Regions: nearctic (Native )

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Geographic Range

Green-winged Teals breed throughout most of Canada, Alaska, Maine, N. Dakota, Minnesota, and Northern Michigan. Their wintering range includes the western United States, Mexico, and the southern United States. Two other subspecies of the Teal, A. c. crecca and A. c. nimia, can be found in Eurasia and the Aleutian Islands.

Biogeographic Regions: nearctic (Native )

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

occurs (regularly, as a native taxon) in multiple nations

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

National Distribution

Canada

Origin: Native

Regularity: Regularly occurring

Currently: Present

Confidence: Confident

Type of Residency: Year-round

United States

Origin: Native

Regularity: Regularly occurring

Currently: Present

Confidence: Confident

Type of Residency: Year-round

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Global Range: (>2,500,000 square km (greater than 1,000,000 square miles)) Holarctic. BREEDS: north-central Alaska, northwestern and central Canada south to California, northern New Mexico, northern Nebraska, Minnesota, northern Ohio, western New York, Maine, Nova Scotia; Iceland, northern Eurasia, Aleutians south to southern Spain, northern Italy, southern Russia and northwestern China. WINTERS: in North America, mostly in the U.S., regularly to central Mexico and Antilles; also Hawaii; widely in Old World. In the U.S., the highest winter densities occur in western Texas, northern Utah, Kansas, Mississippi-Arkansas, and southeastern North Carolina; except for the latter, these are associated with national wildlife refuges (Root 1988).

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Central and western United States, also east coast of United States, extensively distributed throughout Canada.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Gulf of Maine - CoML

Source: Gulf of Maine Area Census of Marine Life

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Range

The teal has an extensive range, like the shoveler, across most of the world's northern latitudes. In the UK, the birds are found over most of the country in winter, but move to the northern upland areas during the breeding season.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Physical Description

Morphology

Physical Description

The Teal is the smallest dabbling duck in the Americas. Its bill is narrow and black. Teals are sexually dimorphic. Males have a cinnamon colored head with an iridescent green crescent spanning from one eye, around the back of the head, to the other eye. The sides and back are actually marked with tiny black and white stripes, although they appear grey. Their wings and tail are a tannish-brown color, with pale yellow feathers along the side of the tail. Females are entirely tannish-brown, except for their white chin and belly.

Range mass: 318 to 364 g.

Average basal metabolic rate: 1.68388 W.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Physical Description

The Teal is the smallest dabbling duck in the Americas. Its bill is narrow and black. Teals are sexually dimorphic. Males have a cinnamon colored head with an iridescent green crescent spanning from one eye, around the back of the head, to the other eye. The sides and back are actually marked with tiny black and white stripes, although they appear grey. Their wings and tail are a tannish-brown color, with pale yellow feathers along the side of the tail. Females are entirely tannish-brown, except for their white chin and belly.

Range mass: 318 to 364 g.

Average basal metabolic rate: 1.68388 W.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Size

Length: 37 cm

Weight: 364 grams

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Length: 35 cm, Wingspan: 57.5 cm
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Gulf of Maine - CoML

Source: Gulf of Maine Area Census of Marine Life

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Diagnostic Description

Description

Length: 34-38 cm. Plumage: above and below vermiculated grey; head chestnut with irridescent green band from lores to nape; breast cream to buff, speckled black; under-tail coverts cream. Eclipse male and female mottled brown with greyish eyeline; Immature resembles female. Bare parts: iris brown; bill grey with flesh colour at base of maxilla; feet and legs slate grey. Habitat: occassionally sea and coastal waters; inland waters with floating vegetation.<388><391>
Creative Commons Attribution 3.0 (CC BY 3.0)

© WoRMS for SMEBD

Source: World Register of Marine Species

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Ecology

Habitat

Cover Requirements

More info for the term: cover

Green-winged teal nests are usually concealed both from the side and
from above in heavy grass, weeds, or brushy cover [9]. Cattails,
bulrushes, smartweeds (Polygonum spp.), and other emergent vegetation
provide hiding cover for ducks on water [3].
  • 3. Cooperrider, Allen Y.; Boyd, Raymond J.; Stuart, Hanson R., eds. 1986. Inventory and monitoring of wildlife habitat. Denver, CO: U.S. Department of the Interior, Bureau of Land Management, Service Center. 858 p. [3441]
  • 9. Johnsgard, Paul A. 1979. A guide to North American waterfowl. Bloomington, IN: Indiana University Press. 274 p. [20026]

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Preferred Habitat

More info for the term: shrubs

Breeding/nesting habitat - Green-winged teal inhabit inland lakes,
marshes, ponds, pools, and shallow streams with dense emergent and
aquatic vegetation [1,4,9,14]. They prefer shallow waters and small
ponds and pools during the breeding season [12]. Green-winged teal are
often found resting on mudbanks or stumps, or perching on low limbs of
dead trees [4]. These ducks nest in depressions on dry ground located
at the base of shrubs, under a log, or in dense grass. The nests are
usually 2 to 300 feet (6-91 m) from water [4]. Green-winged teal avoid
treeless or brushless habitats [9].

Winter habitat - Green-winged teal winter in both freshwater or brackish
marshes, ponds, streams, and estuaries [4,9].
  • 1. Bellrose, Frank C. 1980. Ducks, geese and swans of North America. Harrisburg, PA: Stackpole Books. 3rd ed. 540 p. [19802]
  • 14. Musgrove, Jack W.; Musgrove, Mary R. 1943. Waterfowl in Iowa. Des Moines, IA: State Convservation Committee. 113 p. + index. [20028]
  • 4. DeGraaf, Richard M.; Scott, Virgil E.; Hamre, R. H.; [and others]
  • 9. Johnsgard, Paul A. 1979. A guide to North American waterfowl. Bloomington, IN: Indiana University Press. 274 p. [20026]
  • 12. Madge, Steve; Burn, Hilary. 1988. Waterfowl: An indentification guide to the ducks, geese and swans of the world. Boston, MA: Houghton Mifflin Company. 298 p. [20029]

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Associated Plant Communities

More info for the terms: cover, tundra

Green-winged teal are abundant in wetlands of the Canadian parkland and
northern boreal forest associations. They occur more often in
mixed-prairie associations than in shortgrass associations. They also
inhabit arctic tundra and semidesert communities [1,9].

Within the above associations, green-winged teal commonly inhabit
wetland communities dominated by bulrushes (Scirpus spp.), cattails
(Typha spp.), sedges (Carex spp.), pondweeds (Potamogeton spp.) and
other emergent and aquatic vegetation [1,4]. Green-winged teal
frequently nest in grasses, sedge meadows, or on dry hillsides having
brush or aspen (Populus spp.) cover [9]. Near Brooks, Alberta,
green-winged teal nests were found most often in beds of rushes (Juncus
spp.), and in western Montana most nests were located under greasewood
(Sarcobatus spp.) [1].

REFERENCES :
NO-ENTRY
  • 1. Bellrose, Frank C. 1980. Ducks, geese and swans of North America. Harrisburg, PA: Stackpole Books. 3rd ed. 540 p. [19802]
  • 4. DeGraaf, Richard M.; Scott, Virgil E.; Hamre, R. H.; [and others]
  • 9. Johnsgard, Paul A. 1979. A guide to North American waterfowl. Bloomington, IN: Indiana University Press. 274 p. [20026]

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Habitat: Cover Types

More info on this topic.

This species is known to occur in association with the following cover types (as classified by the Society of American Foresters):

More info for the term: swamp

5 Balsam fir
12 Black spruce
13 Black spruce - tamarack
16 Aspen
17 Pin cherry
18 Paper birch
19 Gray birch - red maple
38 Tamarack
63 Cottonwood
88 Willow oak - water oak - diamondleaf oak
89 Live oak
91 Swamp chestnut oak - cherrybark oak
95 Black willow
106 Mangrove
201 White spruce
202 White spruce - paper birch
203 Balsam poplar
204 Black spruce
205 Mountain hemlock
206 Engelmann spruce - subalpine fir
217 Aspen
235 Cottonwood - willow
252 Paper birch
253 Black spruce - white spruce
254 Black spruce - paper birch

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Habitat: Plant Associations

More info on this topic.

This species is known to occur in association with the following plant community types (as classified by Küchler 1964):

More info for the term: bog

K001 Spruce - cedar - hemlock forest
K002 Cedar - hemlock - Douglas-fir forest
K004 Fir - hemlock forest
K005 Mixed conifer forest
K008 Lodgepole pine - subalpine forest
K013 Cedar - hemlock - pine forest
K025 Alder - ash forest
K029 California mixed evergreen forest
K047 Fescue - oatgrass
K040 Saltbush - greasewood
K048 California steppe
K049 Tule marshes
K050 Fescue - wheatgrass
K051 Wheatgrass - bluegrass
K053 Grama - galleta steppe
K054 Grama - tobosa prairie
K056 Wheatgrass - needlegrass shrubsteppe
K057 Galleta - three-awn shrubsteppe
K058 Grama - tobosa shrubsteppe
K063 Foothills prairie
K064 Grama - needlegrass - wheatgrass
K065 Grama - buffalograss
K066 Wheatgrass - needlegrass
K067 Wheatgrass - bluestem - needlegrass
K068 Wheatgrass - grama - buffalograss
K069 Bluestem - grama prairie
K070 Sandsage - bluestem prairie
K072 Sea oats prairie
K073 Northern cordgrass prairie
K074 Bluestem prairie
K075 Nebraska Sandhills prairie
K076 Blackland prairie
K077 Bluestem - sacahuista prairie
K078 Southern cordgrass prairie
K079 Palmetto prairie
K080 Marl - everglades
K081 Oak savanna
K082 Mosaic of K074 and K100
K088 Fayette prairie
K090 Live oak - sea oats
K091 Cypress savanna
K092 Everglades
K093 Great Lakes spruce - fir forest
K094 Conifer bog
K095 Great Lakes pine forest
K096 Northeastern spruce - fir forest
K097 Southeastern spruce - fir forest
K098 Northern floodplain forest
K100 Oak - hickory forest
K105 Mangrove
K106 Northern hardwoods
K107 Northern hardwoods - fir forest
K108 Northern hardwoods - spruce forest
K109 Transition between K104 and K106
K110 Northeastern oak - pine forest
K111 Oak - hickory - pine forest
K113 Southern floodplain forest

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Habitat: Ecosystem

More info on this topic.

This species is known to occur in the following ecosystem types (as named by the U.S. Forest Service in their Forest and Range Ecosystem [FRES] Type classification):

FRES11 Spruce-fir
FRES14 Oak-pine
FRES15 Oak-hickory
FRES17 Elm-ash-cottonwood
FRES18 Maple-beech-birch
FRES19 Aspen-birch
FRES20 Douglas-fir
FRES21 Ponderosa pine
FRES22 Western white pine
FRES23 Fir-spruce
FRES24 Hemlock-Sitka spruce
FRES26 Lodgepole pine
FRES30 Desert shrub
FRES36 Mountain grasslands
FRES37 Mountain meadows
FRES38 Plains grasslands
FRES39 Prairie
FRES41 Wet grasslands
FRES42 Annual grasslands

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Teals prefer shallow inland wetlands, beaver ponds, and coastal marshes with heavy vegetation and muddy bottoms. These habitats are often found in deciduous parklands, boreal forests, grasslands, or sedge meadows.

Terrestrial Biomes: savanna or grassland ; forest

Aquatic Biomes: lakes and ponds

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Habitat and Ecology

Habitat and Ecology
Behaviour Northern breeding populations of this species are highly migratory3 although populations in more temperate regions are sedentary1 or locally dispersive5. The species breeds from May onwards3 in single pairs or loose groups1. Once females have started incubating2 (from June or early-July)5 males congregate2 and undertake extensive moult migrations or remain near the breeding grounds3 to undergo a flightless moulting period lasting for c.4 weeks5 (the females moult on the breeding grounds)3. After the post-breeding moult migratory populations of the species migrate south, the peak of the autumn migration occurring between October and November5. It returns to the breeding areas from late-February onwards (peaking March-April)5. Outside of the breeding season the species forms large concentrations, with large flocks of 30-40 and sometimes hundreds of individuals gathering at winter roosting sites3, 6. The species forages at night during the winter (especially during the hunting season) but forages by day during the breeding season2. Habitat Breeding The species shows a preference for shallow2, 3 permanent waters4 in the breeding season3, 7, especially those in the vicinity of woodlands with fairly dense herbaceous cover available nearby for nesting4. Small freshwater lakes and shallow marshes with abundant emergent vegetation1, 4 are preferred to open water4, as are small waterbodies forming part of a larger wetland, lake or river system, especially in the valleys of small forested rivers7. Other suitable habitats include small ponds, pools3, 7, oxbow lakes, lagoons7 and slow-flowing streams6, 7. Non-breeding Outside of the breeding season the species frequents similar habitats to those in which it breeds6, including marsh and lake habitats and other sheltered waters with high productivity and abundant vegetation2 as well as flooded fields and artificial waters (e.g. reservoirs)7. During the winter the species also occurs along the coast1, 5 on saline7 or brackish lagoons with abundant submergent vegetation2, saltmarshes3, tidal creeks4, intertidal mudflats2, 4, river deltas3, estuarine waters2, 3 and even sheltered coastal bays3, although it does show a preference for marshes with mud flats for foraging rather than more saline or open-water habitats4. Diet Breeding In spring and summer the diet of the species consists predominantly of animal matter such as molluscs, worms, insects and crustaceans1. Non-breeding During winter the species mainly takes the seeds of aquatic plants1 (e.g. emergent and submerged macrophytes)2, grasses, sedges and agricultural grain1 (cereals and rice)2. Breeding site The nest is a hollow in the ground placed amongst dense vegetation1 or under bushes close to water (rarely more then 100 m away)2. Neighbouring pairs may sometimes nest only 1 m apart although the species is not colonial7. Management information A study in the Czech Republic found that fish ponds with a fish stock density of less than 400 kg ha1, water transparency of more than 50 cm, mixed fish stocks (e.g. tench and pike or perch) rather than monospecific stocks (e.g. of carp), and systems that include ponds with fish fry (to provide areas with low fish competition and high invertebrate availability) are more successful in supporting breeding pairs of this species11. Studies in Danish coastal wetlands found that the spatial restriction of shore-based shooting was more successful at maintaining waterfowl population sizes than was the temporal restriction of shooting, and therefore that wildfowl reserves should incorporate shooting-free refuges that include adjacent marshland in order to ensure high waterfowl species diversity20.

Systems
  • Terrestrial
  • Freshwater
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Teals prefer shallow inland wetlands, beaver ponds, and coastal marshes with heavy vegetation and muddy bottoms. These habitats are often found in deciduous parklands, boreal forests, grasslands, or sedge meadows.

Terrestrial Biomes: savanna or grassland ; forest

Aquatic Biomes: lakes and ponds

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Depth range based on 236 specimens in 3 taxa.
Water temperature and chemistry ranges based on 6 samples.

Environmental ranges
  Depth range (m): 0 - 0
  Temperature range (°C): 6.847 - 11.396
  Nitrate (umol/L): 1.327 - 8.636
  Salinity (PPS): 8.628 - 35.080
  Oxygen (ml/l): 6.315 - 8.081
  Phosphate (umol/l): 0.240 - 0.599
  Silicate (umol/l): 2.505 - 9.412

Graphical representation

Temperature range (°C): 6.847 - 11.396

Nitrate (umol/L): 1.327 - 8.636

Salinity (PPS): 8.628 - 35.080

Oxygen (ml/l): 6.315 - 8.081

Phosphate (umol/l): 0.240 - 0.599

Silicate (umol/l): 2.505 - 9.412
 
Note: this information has not been validated. Check this *note*. Your feedback is most welcome.
Public Domain

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Comments: Freshwater ponds, marshes, shallow edges of lakes; also, in migration and winter, shallow salt and brackish water and shores (Godfrey 1966). Nests in prairie pothole country and elsewhere. Usually nests in areas with dense emergent vegetation; on islands, lake edges, sometimes in upland habitat some distance from water. Nest is a depression lined with plant material, down, feathers.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Summer: Freshwater marshes and rivers Winter: Coastal, bays.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Gulf of Maine - CoML

Source: Gulf of Maine Area Census of Marine Life

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Outside the breeding season, teal form large flocks on lakes and coastal bays. During the breeding season the birds chose brackish or freshwater lakes and ponds in upland wooded or forested areas.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Migration

Non-Migrant: No. All populations of this species make significant seasonal migrations.

Locally Migrant: No. No populations of this species make local extended movements (generally less than 200 km) at particular times of the year (e.g., to breeding or wintering grounds, to hibernation sites).

Locally Migrant: Yes. At least some populations of this species make annual migrations of over 200 km.

Begins slowly migrating northward in March-April; arrives in Beaufort Sea area late May-early June. Generally departs from northernmost breeding areas August-September. Usually migrates southward in large flocks with first cold fall weather. Rare in Puerto Rico and the Virgin Islands, October-April (Raffaele 1983).

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Move south during October through December. Migrates in small flocks. Mated pairs often travel north to breeding grounds together.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Gulf of Maine - CoML

Source: Gulf of Maine Area Census of Marine Life

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Trophic Strategy

Food Habits

Green-winged teal, more than any other species of duck, prefer to seek
food on mud flats. Where mud flats are lacking, they prefer shallow
marshes or temporarily flooded agricultural lands [1,4]. They usually
eat vegetative matter consisting of seeds, stems, and leaves of aquatic
and emergent vegetation. Green-winged teal appear to prefer the small
seeds of nutgrasses (Cyperus spp.), millets (Panicum spp.), and sedges
to larger seeds, but they also consume corn, wheat, barley, and
buttonbush (Cephalanthus spp.) seeds [1]. In marshes, sloughs, and
ponds, green-winged teal select the seeds of bulrushes, pondweeds, and
spikerushes (Eleocharis spp.). To a lesser extent they feed upon the
vegetative parts of muskgrass (Chara spp.), pondweeds, widgeongrass
(Ruppia maritima), and duckweeds (Lemna spp.) [1]. They will
occasionally eat insects, mollusks, and crustaceans [1,4]. Occasionally
during spring months, green-winged teal will gorge on maggots of
decaying fish which are found around ponds [14].
  • 1. Bellrose, Frank C. 1980. Ducks, geese and swans of North America. Harrisburg, PA: Stackpole Books. 3rd ed. 540 p. [19802]
  • 14. Musgrove, Jack W.; Musgrove, Mary R. 1943. Waterfowl in Iowa. Des Moines, IA: State Convservation Committee. 113 p. + index. [20028]
  • 4. DeGraaf, Richard M.; Scott, Virgil E.; Hamre, R. H.; [and others]

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Food Habits

Green-winged Teals feed on almost any plant or animal in high abundance, largely in shallow waters, near the shoreline or in mudflats. Their main foods vary from region to region, depending on what is available, but they consist mainly of marine invertebrates and seeds of marine vegetation. The finely spaced lamallae along the inside of the Teal's bill allow it to retrieve small seeds easily.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Food Habits

Green-winged Teals feed on almost any plant or animal in high abundance, largely in shallow waters, near the shoreline or in mudflats. Their main foods vary from region to region, depending on what is available, but they consist mainly of marine invertebrates and seeds of marine vegetation. The finely spaced lamallae along the inside of the Teal's bill allow it to retrieve small seeds easily.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Comments: Eats aquatic plants; seeds of sedges, smartweeds, pondweeds, and grasses; aquatic insects, mollusks, crustaceans and tadpoles. In fall waste grain. Also eats berries, grapes, acorns. Dabbles in shallow water, also forages on land.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Consumes mostly plant material. Also feeds on aquatic insects, crustaceans, mollusks, tadpoles, earthworms, and fish eggs.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Gulf of Maine - CoML

Source: Gulf of Maine Area Census of Marine Life

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Associations

Predators

Common predators of green-winged teal include humans, skunks (Mephitis
and Spilogale spp.), red foxes (Vulpes vulpes), raccoons (Pryon lotor),
crows (Corvus spp.), and magpies (Pica spp.) [1,6].
  • 1. Bellrose, Frank C. 1980. Ducks, geese and swans of North America. Harrisburg, PA: Stackpole Books. 3rd ed. 540 p. [19802]
  • 6. Fritzell, Erik K. 1975. Effects of agricultural burning on nesting waterfowl. Canadian Field-Naturalist. 89: 21-27. [14635]

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

General Ecology

Habitat-related Fire Effects

More info for the terms: cover, marsh

Green-winged teal nesting cover can be removed by fire [6,13]. After
spring burning and mowing at Souris National Wildlife Refuge, North
Dakota, there were 13 percent fewer nesting pairs of seven dabbling duck
species (green-winged teal included) along mowed and burned areas than
where cover was untouched [13]. However, forested uplands adjacent to
aquatic habitats can be converted to grasses and sedges by fire,
increasing the nesting potential of green-winged teal [17]. Large-scale
autumn burning may have a detrimental effect upon marshes by decreasing
their ability to catch and retain drifting snow which adds heavily to
spring run-off. The ability of marsh vegetation to catch and hold snow
can be vital to marsh survival [18]. Fire often removes excessive
accumulations of fast-growing hydrophytes, permitting better waterfowl
access and growth of more desirable duck foods [17].
  • 6. Fritzell, Erik K. 1975. Effects of agricultural burning on nesting waterfowl. Canadian Field-Naturalist. 89: 21-27. [14635]
  • 13. Martz, Gerald F. 1967. Effects of nesting cover removal on breeding puddle ducks. Journal of Wildlife Management. 31(2): 236-247. [16284]
  • 17. Vogl, Richard J. 1967. Controlled burning for wildlife in Wisconsin. In: Proceedings, 6th annual Tall Timbers Fire Ecology Conference; 1967 March 6-7; Tallahassee, FL. No. 6. Tallahassee, FL: Tall Timbers Research Station: 47-96. [18726]
  • 18. Ward, P. 1968. Fire in relation to waterfowl habitat of the delta marshes. In: Proceedings, annual Tall Timbers fire ecology conference; 1968 March 14-15; Tallahassee, FL. No. 8. Tallahassee, FL: Tall Timbers Research Station: 255-267. [18932]

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Timing of Major Life History Events

Nesting - Nesting chronology varies geographically. In North Dakota,
green-winged teal generally begin nesting in late April. In the
Northwest Territories, Canada, green-winged teal begin nesting between
late May and early July. At Minto Lakes, Alaska, green-winged teal
initiate nesting as early as June 1 and as late as July 20 [1].

Clutch/incubation - Green-winged teal lay 5 to 16 eggs. The incubation
period is 21 to 23 days [1,14].

Age at sexual maturity - Green-winged teal become sexually mature their
first winter [1].

Fledging - Green-winged teals often fledge 34 to 35 days after hatching
or usually before 6 weeks of age [1,9]. Young green-winged teal have
the fastest growth rate of all ducks [1].

Molting - Male green-winged teal leave females at the start of
incubation and congregate on safe waters to molt. Some populations
undergo an extensive molt migration while others remain on or near
breeding grounds. Females molt on breeding grounds [12].

Migration - Green-winged teal are among the earliest spring migrants.
They arrive on nesting areas almost as soon as the snow melts [9]. In
early February, green-winged teal begin to depart their winter grounds,
and continue through April. In central regions green-winged teal begin
to arrive early in March with peak numbers in early April [1].

In northern areas of the United States, green-winged teal migrating to
wintering grounds appear in early September through mid-December. They
begin migrating into most central regions during September and often
remain through December. On their more southerly winter areas,
green-winged teal arrive as early as late September, but most do not
appear until late November [1].
  • 1. Bellrose, Frank C. 1980. Ducks, geese and swans of North America. Harrisburg, PA: Stackpole Books. 3rd ed. 540 p. [19802]
  • 14. Musgrove, Jack W.; Musgrove, Mary R. 1943. Waterfowl in Iowa. Des Moines, IA: State Convservation Committee. 113 p. + index. [20028]
  • 9. Johnsgard, Paul A. 1979. A guide to North American waterfowl. Bloomington, IN: Indiana University Press. 274 p. [20026]
  • 12. Madge, Steve; Burn, Hilary. 1988. Waterfowl: An indentification guide to the ducks, geese and swans of the world. Boston, MA: Houghton Mifflin Company. 298 p. [20029]

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Life History and Behavior

Life Expectancy

Lifespan/Longevity

Average lifespan

Status: wild:
243 months.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Lifespan/Longevity

Average lifespan

Status: wild:
243 months.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Lifespan, longevity, and ageing

Maximum longevity: 27.1 years (wild)
Creative Commons Attribution 3.0 (CC BY 3.0)

© Joao Pedro de Magalhaes

Source: AnAge

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Reproduction

Green-winged Teals begin courtship between September and November. They form monogamous pairs every winter. Paired males attempt forced extra-pair copulation during the mating season, while nonpaired males do not. The nest is built by the female, while the male watches, at the beginning of the egg-laying period. This occurs sometime in May, depending on the weather and temperature. Five or 6 eggs are usually layed. The male then abandons the female, who must incubate and care for the young alone. Incubation lasts for about 23 days, during which time the female spends almost three-fourths of her time on the nest, while the rest is spent in feeding and comfort movements. Once hatched, the Teal ducklings are more sensitive to cold than other duck species, and the mother must protect them from extreme cold through brooding. She also leads them to water and food and protects them from predators by using techniques of distraction.

Range eggs per season: 5 to 6.

Average time to hatching: 23 days.

Average time to hatching: 22 days.

Average eggs per season: 10.

Average age at sexual or reproductive maturity (male)

Sex: male:
180 days.

Average age at sexual or reproductive maturity (female)

Sex: female:
180 days.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Green-winged Teals begin courtship between September and November. They form monogamous pairs every winter. Paired males attempt forced extra-pair copulation during the mating season, while nonpaired males do not. The nest is built by the female, while the male watches, at the beginning of the egg-laying period. This occurs sometime in May, depending on the weather and temperature. Five or 6 eggs are usually layed. The male then abandons the female, who must incubate and care for the young alone. Incubation lasts for about 23 days, during which time the female spends almost three-fourths of her time on the nest, while the rest is spent in feeding and comfort movements. Once hatched, the Teal ducklings are more sensitive to cold than other duck species, and the mother must protect them from extreme cold through brooding. She also leads them to water and food and protects them from predators by using techniques of distraction.

Range eggs per season: 5 to 6.

Average time to hatching: 23 days.

Average time to hatching: 22 days.

Average eggs per season: 10.

Average age at sexual or reproductive maturity (male)

Sex: male:
180 days.

Average age at sexual or reproductive maturity (female)

Sex: female:
180 days.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Clutch size is 7-15 (usually 8-9). Incubation, by female, lasts 21-23 days. Males abandon females early in incubation. Nestlings are precocial, tended by female, become independent in about 23 days.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Female builds nest near water, hiding it within brush or grasses. 6-11 eggs are incubated by the female for 20-24 days. Young hatchlings feed themselves while being tended by female.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Gulf of Maine - CoML

Source: Gulf of Maine Area Census of Marine Life

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Barcode data: Anas crecca

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There are 12 barcode sequences available from BOLD and GenBank.  Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.  See the BOLD taxonomy browser for more complete information about this specimen and other sequences.

CCACAAAGACATTGGCACCCTATACCTTATCTTCGGGGCATGAGCCGGAATAATTGGCACAGCACTCAGCCTACTGATCCGCGCAGAACTAGGCCAACCAGGAACCCTCCTGGGCGACGACCAAATTTACAACGTAATCGTCACCGCCCACGCCTTTGTAATAATCTTCTTCATGGTAATACCCATCATGATTGGAGGATTCGGCAACTGATTAGTCCCCCTAATAATCGGCGCCCCTGACATAGCATTCCCACGAATAAACAACATAAGCTTCTGACTCCTCCCACCATCATTCCTCCTCCTACTCGCCTCATCTACCGTAGAAGCTGGGGCCGGTACAGGTTGAACCGTGTACCCACCCCTAGCAGGCAACCTGGCCCACGCCGGAGCCTCAGTAGACCTAGCTATCTTCTCCCTTCACCTAGCCGGTGTCTCCTCCATCCTCGGGGCCATTAACTTCATTACCACAGCCATCAACATAAAACCCCCTGCACTCTCACAGTACCAAACCCCACTTTTCGTCTGATCGGTCCTAATTACCGCCATCCTACTCCTCCTATCACTCCCTGTCCTCGCCGCCGGCATCACAATGCTACTAACCGACCGAAACCTAAACACCACATTCTTTGACCCCGCCGGAGGAGGAGACCCAATCCTGTACCAACACCTATTTTGATTCTTCGGCCACCCAGAAGTCTATATCTTAATCCTCCCAGGATTTGGAATTATCTCCCACGTAA
-- end --

Download FASTA File
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Statistics of barcoding coverage: Anas crecca

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 13
Specimens with Barcodes: 18
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Conservation

Conservation Status

Green-winged Teals are the second most commonly hunted duck in North America, following Mallards. In addition, there has been a decline in their wintering habitat. In spite of these two setbacks, however, Teal populations are increasing. This is likely due to the inaccessibility to humans of their breeding habitat, which is deep in the wilderness of northern Canada. The wetlands that they inhabit in the winter are being managed, but more for waterfowl in general than for the Green-winged Teal.

IUCN Red List of Threatened Species: least concern

US Migratory Bird Act: protected

US Federal List: no special status

CITES: no special status

State of Michigan List: no special status

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

IUCN Red List Assessment


Red List Category
LC
Least Concern

Red List Criteria

Version
3.1

Year Assessed
2009

Assessor/s
BirdLife International

Reviewer/s
Bird, J., Butchart, S.

Contributor/s

Justification
This species has an extremely large range, and hence does not approach the thresholds for Vulnerable under the range size criterion (Extent of Occurrence <20,000 km2 combined with a declining or fluctuating range size, habitat extent/quality, or population size and a small number of locations or severe fragmentation). The population trend is not known, but the population is not believed to be decreasing sufficiently rapidly to approach the thresholds under the population trend criterion (>30% decline over ten years or three generations). The population size is extremely large, and hence does not approach the thresholds for Vulnerable under the population size criterion (<10,000 mature individuals with a continuing decline estimated to be >10% in ten years or three generations, or with a specified population structure). For these reasons the species is evaluated as Least Concern.

History
  • 2008
    Least Concern
  • 2005
    Least Concern
  • 2004
    Not Recognized
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Green-winged Teals are the second most commonly hunted duck in North America, following Mallards. In addition, there has been a decline in their wintering habitat. In spite of these two setbacks, however, Teal populations are increasing. This is likely due to the inaccessibility to humans of their breeding habitat, which is deep in the wilderness of northern Canada. The wetlands that they inhabit in the winter are being managed, but more for waterfowl in general than for the Green-winged Teal.

US Migratory Bird Act: protected

US Federal List: no special status

CITES: no special status

State of Michigan List: no special status

IUCN Red List of Threatened Species: least concern

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Status in Egypt

Regular passage visitor and winter visitor.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Bibliotheca Alexandrina

Source: Bibliotheca Alexandrina - EOL Ar

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

National NatureServe Conservation Status

Canada

Rounded National Status Rank: N5B,N5N : N5B: Secure - Breeding, N5N: Secure - Nonbreeding

United States

Rounded National Status Rank: N5B,N5N : N5B: Secure - Breeding, N5N: Secure - Nonbreeding

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

NatureServe Conservation Status

Rounded Global Status Rank: G5 - Secure

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

No official conservation status.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Gulf of Maine - CoML

Source: Gulf of Maine Area Census of Marine Life

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Status

Receives general protection under the Wildlife and Countryside Act (as amended) in the UK. Included in the Birds of Conservation Concern Amber List (medium conservation concern).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Threats

Major Threats
This species is threatened by lowland habitat loss and degradation (e.g. through wetland drainage)11 and by upland habitat loss due to afforestation and other land-use changes2. The species suffers mortality as a result of lead shot ingestion (France)23 and from poisoning by white phosphorous ingestion (from firearms) in Alaska21. It is also intensively hunted in its winter quarters1. The species is threatened by disturbance from human recreational activities19, hunting20 and construction work (UK)18. The species is susceptible to avian botulism9 and avian influenza10, 17 so may be threatened by future outbreaks of these diseases. Utilisation The species is hunted for sport in North America8, 12, Denmark13, France14 and Italy15, and is hunted commercially and recreationally in Iran16. The eggs of this species were (and possibly still are) harvested in Iceland22.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Teal are not an uncommon duck, figures show that the north-western European populations have increased by a figure of 2.5% annually between 1967 and 1993, and have since levelled off.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Management

Use of Fire in Population Management

Fire can be used to remove fast-growing, undesirable species such as
common reed (Phragmites australis) and increase desirable green-winged
teal foods such as pondweed and duckweed [15]. The best way to reduce
common reed with prescribed burning is to burn during early summer when
carbohydrate reserves in the plant are low and the soil is dry [8].

Controlled burning can be used to create nesting edge for ducks.
Removal of dense vegetation and woody encroachment is vital if prairie
marshes are to remain in this successional state [18]. According to
Ward [18], spring burning in marshlands is primarily done to remove
vegetation and create more nesting edge. Summer fires are used to
create more permanent changes in the plant community. Fire can also be
used to reduce predator activity through the elimination of hiding cover
[6].

If prescribed burning is used as a management technique, burning must be
completed well before or after the nesting season [18]. Land managers
who burn during the nesting season should consider partial burns.
Partial burns probably have less impact on total vegetation changes and
would result in higher recruitment of waterfowl than complete burns
would [19].
  • 15. Schlichtemeier, Gary. 1967. Marsh burning for waterfowl. In: Proceedings, 6th annual Tall Timbers fire ecology conference; 1967 March 6-7; Tallahassee, FL. No. 6. Tallahassee, FL: Tall Timbers Research Station: 40-46. [16450]
  • 6. Fritzell, Erik K. 1975. Effects of agricultural burning on nesting waterfowl. Canadian Field-Naturalist. 89: 21-27. [14635]
  • 8. Higgins, Kenneth F.; Kruse, Arnold D.; Piehl, James L. 1989. Effects of fire in the Northern Great Plains. Ext. Circ. EC-761. Brookings, SD: South Dakota State University, Cooperative Extension Service, South Dakota Cooperative Fish and Wildlife Research Unit. 47 p. [14749]
  • 18. Ward, P. 1968. Fire in relation to waterfowl habitat of the delta marshes. In: Proceedings, annual Tall Timbers fire ecology conference; 1968 March 14-15; Tallahassee, FL. No. 8. Tallahassee, FL: Tall Timbers Research Station: 255-267. [18932]
  • 19. Kruse, Arnold D.; Piehl, James L. 1986. The impact of prescribed burning on ground-nesting birds. In: Clambey, Gary K.; Pemble, Richard H., eds. The prairie: past, present and future: Proceedings, 9th North American prairie conference; 1984 July 29 - August 1; Moorhead, MN. Fargo, ND: Tri-College University Center for Environmental Studies: 153-156. [3561]

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Management Considerations

A large proportion of green-winged teal breed north of the agricultural
lands of Canada. Because so many breed in the wetlands of boreal forest
associations, populations of this species have not declined due to
habitat loss as much as other waterfowl species more confined to the
prairies of Canada [1].

REFERENCES :
NO-ENTRY
  • 1. Bellrose, Frank C. 1980. Ducks, geese and swans of North America. Harrisburg, PA: Stackpole Books. 3rd ed. 540 p. [19802]

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Conservation

It has been calculated that nearly 70,000 individual teal are present annually in the UK outside the breeding season. This represents about 17% of the global population for this species. The success of the teal is thought to be due in part to an increase in the available wetland habitat, much of this due to reclaimed mineral extraction sites. However, teal are susceptible to low winter temperatures, and will migrate south to escape bad conditions. This can influence population figures either way, depending on the prevailing weather. Teal are one of the migratory bird species that are used to assess the designation of Special Protection Areas (SPAs) under the EC Birds Directive. One site that qualifies as an SPA, and which plays host to about 1.5% of the north-western Europe population for the birds, is the Lower Derwent Valley in the East Riding of Yorkshire. This site is one of the most important – and largest – examples of traditionally managed wetland in the UK, and is home to large numbers wildfowl and waders, as well as bitterns.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Relevance to Humans and Ecosystems

Benefits

Economic Importance for Humans: Positive

Green-winged Teals are hunted for sport. In 1989, approximately 200,000 were harvested in Canada alone.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Economic Importance for Humans: Positive

Green-winged Teals are hunted for sport. In 1989, approximately 200,000 were harvested in Canada alone.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Wikipedia

Eurasian Teal

The Eurasian Teal or Common Teal (Anas crecca) is a common and widespread duck which breeds in temperate Eurasia and migrates south in winter. The Eurasian Teal is often called simply the Teal due to being the only one of these small dabbling ducks in much of its range.[2] The bird gives its name to the blue-green colour teal.

It is a highly gregarious duck outside the breeding season and can form large flocks. It is commonly found in sheltered wetlands and feeds on seeds and aquatic invertebrates. The North American Green-winged Teal (A. carolinensis) was formerly (and sometimes is still) considered a subspecies of A. crecca.

Contents

Description

Male in nuptial plumage (above) and female.
Note typical wide white wing stripe and conspicuous face markings of male.

The Eurasian Teal is the smallest extant dabbling duck at 34–43 cm (13–17 in) length and with an average weight of 360 g (13 oz) in drake (males) and 340 g (12 oz) in hens (females). The wings are 17.5–20.4 cm (6.9–8.0 in) long, yielding a wingspan of 53–59 cm (21–23 in). The bill measures 3.2–4 cm (1.3–1.6 in) in length, and the tarsus 2.8–3.4 cm (1.1–1.3 in).[3][2]

From a distance, the drakes in nuptial plumage appear grey, with a dark head, a yellowish behind, and a white stripe running along the flanks. Their head and upper neck is chestnut, with a wide and iridescent dark green patch of half-moon- or teardrop-shape that starts immediately before the eye and arcs to the upper hindneck. The patch is bordered with thin yellowsh-white lines, and a single line of that colour extends from the patch's forward end, curving along the base of the bill. The breast is buff with small round brown spots. The center of the belly is white, and the rest of the body plumage is mostly white with thin and dense blackish vermiculations, appearing medium grey even at a short distance. The outer scapular feathers are white, with a black border to the outer vanes, and form the white side-stripe when the bird is in resting position. The primary remiges are dark greyish brown; the speculum feathers are iridescent blackish-green with white tips, and form the speculum together with the yellowish-white tips of the larger upperwing coverts (which are otherwise grey). The underwing is whitish, with grey remiges, dense dark spotting on the inner coverts and a dark leading edge. The tail and tail coverts are black, with a bright yellowish-buff triangular patch in the center of the coverts at each side.[3]

Drake in eclipse plumage (rightmost bird), hen and young

In non-breeding (eclipse) plumage, the drake looks more like the hen; it is more uniform in colour, with a dark head and vestigial facial markings. The hen itself is yellowish-brown, somewhat darker on wings and back. It has a dark greyish-brown upper head, hindneck, eyestripe and feather pattern. The pattern is dense short streaks on the head and neck, and scaly spots on the rest of the body; overall they look much like a tiny Mallard (A. platyrhynchos) hen when at rest. The wings are coloured similar to the drake's, but with brown instead of grey upperwing coverts that have less wide tips, and wider tips of the speculum feathers. The hen's rectrices have yellowish-white tips; the midbelly is whitish with some dark streaking.[3]

Immatures are coloured much like hens, but have a stronger pattern. The downy young are coloured like in other dabbling ducks: brown above and yellow below, with a yellow supercilium. They are recognizable by their tiny size however, weighing just 15 grams (about half an ounce) at hatching.[3][2][4]

The drake's bill is dark grey, in eclipse plumage often with some light greenish or brownish hue at the base. The bill of hens and immatures is pinkish or yellowish at the base, becoming dark grey towards the tip; the grey expands basewards as the birds age. The feet are dark grey in males and greyish olive or greyish-brown in females and immatures. The iris is always brown.[3]

This is a noisy species. The male whistles cryc or creelycc, not loud but very clear and far-carrying. The female has a feeble keh or neeh quack[3]

Males in nuptial plumage are distinguished from Green-winged Teals by the horizontal white scapular stripe, the lack of a vertical white bar at the breast sides, and the quite conspicuous light outlines of the face patch, which are indistinct in the Green-winged Teal drake. Males in eclipse plumage, females and immatures are best recognised by their small size, calls, and the speculum; they are hard to tell apart from the Green-winged Teal however.[3]

Taxonomy

Eurasian Teal ( A. crecca), drake in nuptial plumage (note horizontal white stripe from shoulder)

The Eurasian Teal belongs to the "true" teals, a group of small Anas dabbling ducks closely related to the Mallard (A. platyrhynchos) and its relatives; that latter group in fact seems to have evolved from a true teal. It forms a superspecies with the Green-winged Teal and the Speckled Teal (A. flavirostris). A proposed subspecies, A. c. nimia of the Aleutian Islands, differs only in slightly larger size; it is probably not distinct.[5][2][6]

Green-winged Teal ( A. carolinensis), drake in nuptial plumage (note vertical white stripe from shoulder)

Whether the Eurasian and Green-winged teals are to be treated as one or two species is still being reviewed by the AOU,[7] while the IUCN and BirdLife International separate them nowadays.[1] Despite the almost identical and highly apomorphic nuptial plumage of their males, which continues to puzzle scientists (see the Green-winged Teal page for a discussion of the species' phylogeny), they seem well distinct species, as indicated by a wealth of behavioural, morphological and molecular data.[8][5][6][9]

The Eurasian Teal was first scientifically named by Carl Linnaeus in his 1758 edition of Systema naturae. His Latin description reads: [Anas] macula alarum viridi, linea alba supra infraque oculos – "a duck with green speculum, a white line above and below the eyes" – and his primary reference was the bird's description in his earlier work Fauna Svecica.[10] In fact, the description he used in Systema Naturae was the name under which the bird went in the Fauna Svecica, demonstrating the value of his new binomial nomenclature by compressing the long-winded names formerly used in biological classification into much simpler scientific names like Anas crecca. Linnaeus also noted in his description that earlier authors had already written about the Eurasan Teal at length: Conrad Gessner[11] had described it in the Historiae animalium as the anas parva ("small duck") among his querquedulae ("teals"); Ulisse Aldrovandi[12] had called it phascade or querquedula minor ("lesser teal"), and was duly referenced by Francis Willughby[13] who named the species querquedula secunda Aldrovandi ("the second teal of Aldrovandus"[14]). John Ray[15] may be credited with formally introducing the name "Common Teal", while Eleazar Albin[16] called it simply "the teal". As regards the type locality Linnaeus simply remarked that it inhabits freshwater ecosystems in Europe.[17]

The specific name of Linnaeus is onomatopoetic, referring to the male's characteristic call which was already discussed by Linnaeus' sources. Thus, the scientific name of the Eurasian Teal – unchanged since Linnaeus' time – translates as "duck that makes cryc"; common names like the Bokmål krikkand, Danish krikand and German Krickente mean the same.

Distribution and habitat

Wintering birds at Purbasthali, Burdwan District of West Bengal (India)

The Eurasian Teal breeds across northern Eurasia and mostly winters well south of its breeding range. However, in the milder climate of temperate Europe, the summer and winter ranges overlap. For example, in the United Kingdom and Ireland a small summer population breeds, but far greater numbers of Siberian birds arrive in winter. In the Caucasus region, western Asia Minor, along the northern shores of the Black Sea, and even on the south coast of Iceland and on the Vestmannaeyjar, the species can be encountered all year, too.[3]

In winter, there are high densities around the Mediterranean – including the entire Iberian Peninsula and extending west to Mauretania –, on Japan and Taiwan, as well as in South Asia. Other important wintering locations include almost the entire length of the Nile Valley, the Near East and Persian Gulf region, the mountain ranges of northern Iran, and South Korea and continental East and Southeast Asia. More isolated wintering grounds are Lake Victoria, the Senegal River estuary, the swamps of the upper Congo River, the inland and sea deltas of the Niger River, and the central Indus River valley. Vagrants have been seen in inland Zaire, Malaysia, on Greenland, and on the Marianas, Palau and Yap in Micronesia;[18] they are regularly recorded on the North American coasts south to California and South Carolina.[3]

Altogether, the Eurasian Teal is much less common than its American counterpart, though still very plentiful. Its numbers are mainly assessed by counts of wintering birds; some 750,000 are recorded annually around the Mediterranean and Black Seas, 250,000 in temperate western Europe, and more than 110,000 in Japan. In 1990 and 1991, a more detailed census was undertaken, yielding over 210,000 birds wintering in Iran, some 109,000 in Pakistan, about 77,000 in Azerbaidzhan, some 37,000 in India, 28,000 in Israel, over 14,000 in Turkmenistan and almost 12,000 in Taiwan. It appears to be holding its own currently, with its slow decline of maybe 1–2% annually in the 1990s – presumably mainly due to drainage and pollution of wetlands – not warranting action other than continuing to monitor the population and possibly providing better protection for habitat on the wintering grounds. The IUCN and BirdLife International classify the Eurasian Teal as a Species of Least Concern, unchanged from their assessment before the split of the more numerous A. carolinensis.[3][2][1]

The Eurasian Teal is one of the species to which the Agreement on the Conservation of African-Eurasian Migratory Waterbirds (AEWA) applies.

Behaviour

This dabbling duck is highly gregarious outside of the breeding season and will form large flocks. In flight, the fast, twisting flocks resemble waders; despite its short legs, it is also rather nimble on the ground by ducks' standards. In the breeding season, it is a common inhabitant of sheltered freshwater wetlands with some tall vegetation, such as taiga bogs or small lakes and ponds with extensive reedbeds. In winter, it is often seen in brackish waters and even in sheltered inlets and lagoons along the seashore.[3]

The Eurasian Teal usually feeds by dabbling, upending or grazing; it may submerge its head and on occasion even dive to reach food. In the breeding season it eats mainly aquatic invertebrates, such as crustaceans, insects and their larvae, molluscs and worms. In winter, it shifts to a largely granivorous diet, feeding on seeds of aquatic plants and grasses, including sedges and grains. Diurnal throughout the breeding season, in winter they are often crepuscular or even nocturnal feeders.[3]

It nests on the ground, near water and under cover. The pairs form in the winter quarters and arrive on the breeding grounds together, starting about March. The breeding starts some weeks thereafter, not until May in the most northernly locations. The nest is a deep hollow lined with dry leaves and down feathers, built in dense vegetation near water. After the females have started laying, the males leave them and move away for shorter or longer distances, assembling in flocks on particular lakes where they moult into eclipse plumage; they will usually encounter their offspring only in winter quarters. The clutch may consist of 5–16 eggs, but usually numbers 8–11; they are incubated for 21–23 days. The young leave the nest soon after hatching and are attended by the mother for about 25–30 days, after which they fledge. The drakes and the hens with young generally move to the winter quarters separately. After the first winter, the young moult into adult plumage. The maximum recorded lifespan – though it is not clear whether this refers to the Common or the Green-winged Teal – was over 27 years, which is rather high for such a small bird.[3]

References

  1. ^ a b c BirdLife International (2012). "Anas crecca". IUCN Red List of Threatened Species. Version 2012.1. International Union for Conservation of Nature. http://www.iucnredlist.org/apps/redlist/details/160031027. Retrieved 16 July 2012.
  2. ^ a b c d e Carboneras, Carles (1992): Family Anatidae (Ducks, Geese and Swans). In: del Hoyo, Josep; Elliott, Andrew & Sargatal, Jordi (eds.): Handbook of Birds of the World (Volume 1: Ostrich to Ducks): 536–629, plates 40–50. Lynx Edicions, Barcelona. ISBN 84-87334-10-5
  3. ^ a b c d e f g h i j k l m Madge, S. & Burn, H. (1987) Wildfowl, an Identification Guide to the Ducks, Geese and Swans of the World. Christopher Helm, London ISBN 0713636475
  4. ^ AnAge [2009]: Anas crecca life history data. Retrieved 2009-JAN-06.
  5. ^ a b Livezey, Bradley C. (1991). "A phylogenetic analysis and classification of recent dabbling ducks (Tribe Anatini) based on comparative morphology". Auk 108 (3): 471–507. doi:10.2307/4088089. http://sora.unm.edu/sites/default/files/journals/auk/v108n03/p0471-p0507.pdf.
  6. ^ a b Johnson, Kevin P. & Sorenson, Michael D. (1999). "Phylogeny and biogeography of dabbling ducks (genus Anas): a comparison of molecular and morphological evidence". Auk 116 (3): 792–805. doi:10.2307/4089339. http://sora.unm.edu/sites/default/files/journals/auk/v116n03/p0792-p0805.pdf.
  7. ^ South American Classification Committee (2008): A classification of the bird species of South America – Part 1. Struthioniformes to Cathartiformes. Version of 2008-DEC-22. Retrieved 2009-JAN-05.
  8. ^ Laurie-Ahlberg, C.C. & McKinney, F. (1979). "The nod-swim display of male Green-winged Teal (Anas crecca)". Animal Behaviour 27: 165. doi:10.1016/0003-3472(79)90136-2.
  9. ^ Sangster, George; Knox, Alan G.; Helbig, Andreas J. & Parkin, David T. (2002). "Taxonomic recommendations for European birds". Ibis 144: 153. doi:10.1046/j.0019-1019.2001.00026.x.
  10. ^ Linnaeus, Carl (1746): 109. Anas macula alarum viridi: linea alba supra infraque oculos. In: Fauna Svecica Sistens Animalia Sveciæ Regni, etc. (1st ed.): 39–40 [in Latin]. Conrad & Georg Jacob Wishoff, Leiden ("Lugdunum Batavorum").
  11. ^ Gessner, Conrad (1555): Historiae animalium (vol. 3) [in Latin]. Christoph Froschauer, Zürich ("Tigurium"), pp.103–105
  12. ^ Aldrovandi, Ulisse (Ulyssis Aldrovandus) (1637): Ornithologia (2nd ed., vol. 3: Tomus tertius ac postremus) [in Latin]. Nicolò Tebaldini, Bologna ("Bononia"). pp. 207–209
  13. ^ Willughby, Francis (1676): Ornithologiae libri tres [in Latin]. John Martyn, London, p. 290.
  14. ^ Aldrovandi's "first teal" was the Garganey, which was consequently scientifically described as Anas querquedula ("teal-duck"): Linnaeus (1758): p. 126.
  15. ^ Ray, John (Joannis Raii) (1713): Synopsis methodica avium & piscium: opus posthumum, etc. (vol. 1) [in Latin]. William Innys, London. pp. 147–148
  16. ^ Albin, Eleazar (1731–1738): A natural history of the birds (3 volumes). William Innys, London. Vol.1, p.95, plate 100; vol. 2, p.91, plate 102
  17. ^ Linnaeus (1758): pp. 126–127
  18. ^ Wiles, Gary J.; Johnson, Nathan C.; de Cruz, Justine B.; Dutson, Guy; Camacho, Vicente A.; Kepler, Angela Kay; Vice, Daniel S.; Garrett, Kimball L.; Kessler, Curt C. & Pratt, H. Douglas (2004). "New and Noteworthy Bird Records for Micronesia, 1986–2003". Micronesica 37 (1): 69–96. http://www.researchgate.net/publication/228788814_New_and_noteworthy_bird_records_for_Micronesia_19862003.

Bibliography

Creative Commons Attribution Share Alike 3.0 (CC BY-SA 3.0)

 

Source: Wikipedia

Unreviewed

Article rating from 0 people

Average rating: 2.5 of 5

Names and Taxonomy

Taxonomy

Comments: Livezey's (1991) phylogenetic analysis and classification (supergenera, subgenera, infragenera, etc.) of dabbling ducks (based on comparative morphology) listed A. crecca and A. carolinensis as separate species. Zink et al. (1995), however, found no evidence of genetic differentiation between populations in Asian and North American sides of Beringia. The American Ornithologists' Union (1998 and subsequent supplements in 2000, 2002, 2003, and 2004) accordingly has treated A. crecca and A. carolinensis as conspecific. In contrasts, in a phylogeny of dabbling ducks, Johnson and Sorenson (1999) presented evidence that A. crecca and A. carolinensis are separate species, and the British Ornithological Union (2001) subsequently recognized them as such.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!