Articles on this page are available in 2 other languages: Chinese (Simplified) (5), Dutch (1) (learn more)

Overview

Brief Summary

Anas crecca

One of the smallest ducks in North America at only 14 inches in length, the Green-winged Teal is second only to the Mallard in number of individuals taken by North American duck hunters. Aside from the large green wing patch which gives this species its name, the male Green-winged Teal is characterized by a reddish-brown head, green head patch, gray-brown back, speckled-brown breast and yellow under-tail patches. Females are drab-brown overall with a smaller green wing patch, but may be recognized as teals by their small size. Green-winged Teals are found across the Northern Hemisphere. The North American subspecies (A. crecca carolinensis) breeds from Alaska to eastern Canada and south to the northern tier of the United States. In winter, Green-winged Teals migrate south, and may be found along the Pacific, Atlantic, and Gulf coasts of the U.S., in the interior in the southern half of the country, and points south. The Eurasian subspecies, (A. crecca crecca) breeds across northern Eurasia, wintering south to North Africa, India, and China. In summer, the Green-winged Teal breeds primarily on ponds in open wooded parkland, but may also breed on bodies of water near prairies or in river deltas. This species may be found more generally in shallow wetlands throughout its winter range. Green-winged Teals consume grasses, aquatic plants, insects, larvae, and crustaceans. Green-winged Teals may be seen either on land or in the water, where they may be observed foraging for food. This species may also be observed undertaking straight, swift flights on migration or between breeding or foraging grounds. Green-winged Teals are most active during the day.

Threat Status: Least Concern

  • Anas crecca. Xeno-canto. Xeno-canto Foundation, n.d. Web. 20 July 2012. .
  • Common Teal (Anas crecca). The Internet Bird Collection. Lynx Edicions, n.d. Web. 20 July 2012. .
  • Johnson, Kevin. 1995. Green-winged Teal (Anas crecca), The Birds of North America Online (A. Poole, Ed.). Ithaca: Cornell Lab of Ornithology; Retrieved from the Birds of North America Online: http://bna.birds.cornell.edu/bna/species/193
  • Peterson, Roger Tory. Birds of Eastern and Central North America. Boston: Houghton Mifflin, 1980. Print.
  • eBird Range Map - Green-winged Teal. eBird. Cornell Lab of Ornithology, N.d. Web. 20 July 2012. .
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Smithsonian Institution

Supplier: DC Birds

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Teal are the smallest European duck species. The birds are rapid flyers, flapping their wings quickly. This gives the impression that they are constantly in a rush. In large groups, they often make unexpected turns and tumbles in the air. Teal are active at night and make lots of noise.
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© Copyright Ecomare

Source: Ecomare

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Biology

The courtship display of the drake teal involves the bird dipping the tip of its bill under the surface of the water, then whistling, arching its back and tipping its head back, while raising its wings across its back and cocking its tail. Like most ducks, female teals take sole responsibility for rearing the ducklings. The nest is constructed on dry ground on an upland moor, often amongst bracken or under gorse. The nest is lined with dried leaves and down from the female's breast. The eggs, laid in April or May, are greeny-buff and may number as many as ten. They hatch after three weeks of incubation and the duck leads them down to water as soon as the ducklings' down is dry. Teal feed on waterweed, insects and other water invertebrates. Teal have been a quarry species for centuries as they are considered very good eating. Bones from the birds have been found in the Roman settlement of Silchester in Hampshire.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Description

The teal is one of the smallest wild ducks in the UK. The drake (male) in breeding plumage is also one of the most handsome of birds. The body is pale grey, finely lined with darker striations on the underside, and slightly broader markings on the back and wings, with a cream chest patch featuring fine black spots. The head is a dark brick red, almost russet, boldly crossed by a broad bottle-green eye stripe lined with cream. Under the black and white patterned tail, there is a noticeable creamy-yellow patch, which is very conspicuous in flight. The female is typically mottled brown, as are the males after moulting when they are said to be in 'eclipse', and juveniles. Both sexes display a wing-bar in flight; this bar is dark green and black with a white flash in front of the other two colours. The drakes make a distinctive ringing whistle similar to that of the pintail but higher pitched, and thought by some to have inspired the common English name. The female makes a soft and high-pitched quack.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Comprehensive Description

Description of Anas crecca

Het mannetje heeft een rood-en-groene kop en het vrouwtje is vrijwel totaal bruin.
Creative Commons Attribution 3.0 (CC BY 3.0)

1geron

Source: BioPedia

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Distribution

Green-winged Teals breed throughout most of Canada, Alaska, Maine, N. Dakota, Minnesota, and Northern Michigan. Their wintering range includes the western United States, Mexico, and the southern United States. Two other subspecies of the Teal, A. c. crecca and A. c. nimia, can be found in Eurasia and the Aleutian Islands.

Biogeographic Regions: nearctic (Native )

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

occurs (regularly, as a native taxon) in multiple nations

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

National Distribution

Canada

Origin: Native

Regularity: Regularly occurring

Currently: Present

Confidence: Confident

Type of Residency: Year-round

United States

Origin: Native

Regularity: Regularly occurring

Currently: Present

Confidence: Confident

Type of Residency: Year-round

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Global Range: (>2,500,000 square km (greater than 1,000,000 square miles)) Holarctic. BREEDS: north-central Alaska, northwestern and central Canada south to California, northern New Mexico, northern Nebraska, Minnesota, northern Ohio, western New York, Maine, Nova Scotia; Iceland, northern Eurasia, Aleutians south to southern Spain, northern Italy, southern Russia and northwestern China. WINTERS: in North America, mostly in the U.S., regularly to central Mexico and Antilles; also Hawaii; widely in Old World. In the U.S., the highest winter densities occur in western Texas, northern Utah, Kansas, Mississippi-Arkansas, and southeastern North Carolina; except for the latter, these are associated with national wildlife refuges (Root 1988).

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Geographic Range

Green-winged Teals breed throughout most of Canada, Alaska, Maine, N. Dakota, Minnesota, and Northern Michigan. Their wintering range includes the western United States, Mexico, and the southern United States. Two other subspecies of the Teal, A. c. crecca and A. c. nimia, can be found in Eurasia and the Aleutian Islands.

Biogeographic Regions: nearctic (Native )

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: BioKIDS Critter Catalog

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

All three green-winged teal subspecies occur in the northern hemisphere
during summer and in winter extend to northern South America, central
Africa, southern India, Burma, and the Philippines. In North America,
ssp. carolinensis occurs across the continent and is joined in the
Aleutian Islands by ssp. nimia, which remains there throughout the year.
Anas crecca breeds in Iceland, Europe, and Asia. It is also seen
occasionally during the winter in North America along the Atlantic Coast
[1,9].

The American green-winged teal breeds from the Aleutian Islands,
northern Alaska, Mackenzie River delta, northern Saskatchewan, Manitoba,
Ontario, Quebec, and Labrador south to central California, central
Nebraska, central Kansas, southern Minnesota, Wisconsin, Ontario,
Quebec, Newfoundland, and the Maritime Provinces [1,4].

The American green-winged teal winters from southern Alaska and southern
British Columbia east to New Brunswick and Nova Scotia and south to
Central America. It also winters in Hawaii [4,10].

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Regional Distribution in the Western United States

More info on this topic.

This species can be found in the following regions of the western United States (according to the Bureau of Land Management classification of Physiographic Regions of the western United States):

1 Northern Pacific Border
2 Cascade Mountains
3 Southern Pacific Border
4 Sierra Mountains
5 Columbia Plateau
6 Upper Basin and Range
7 Lower Basin and Range
8 Northern Rocky Mountains
9 Middle Rocky Mountains
10 Wyoming Basin
11 Southern Rocky Mountains
12 Colorado Plateau
13 Rocky Mountain Piedmont
14 Great Plains
15 Black Hills Uplift
16 Upper Missouri Basin and Broken Lands

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Occurrence in North America

AL AK AZ AR CA CO CT DE FL GA HI
ID IL IN IA KS KY LA ME MD MA
MI MN MS MO MT NE NV NH NJ NM
NY NC ND OH OK OR PA RI SC SD
TN TX UT VT VA WA WV WI WY DC


AB BC MB NB NF NT NS ON PE PQ
SK YT



MEXICO

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Central and western United States, also east coast of United States, extensively distributed throughout Canada.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Gulf of Maine - CoML

Source: Gulf of Maine Area Census of Marine Life

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Range

The teal has an extensive range, like the shoveler, across most of the world's northern latitudes. In the UK, the birds are found over most of the country in winter, but move to the northern upland areas during the breeding season.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Physical Description

Morphology

The Teal is the smallest dabbling duck in the Americas. Its bill is narrow and black. Teals are sexually dimorphic. Males have a cinnamon colored head with an iridescent green crescent spanning from one eye, around the back of the head, to the other eye. The sides and back are actually marked with tiny black and white stripes, although they appear grey. Their wings and tail are a tannish-brown color, with pale yellow feathers along the side of the tail. Females are entirely tannish-brown, except for their white chin and belly.

Range mass: 318 to 364 g.

Other Physical Features: endothermic ; bilateral symmetry

Average basal metabolic rate: 1.68388 W.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Physical Description

The Teal is the smallest dabbling duck in the Americas. Its bill is narrow and black. Teals are sexually dimorphic. Males have a cinnamon colored head with an iridescent green crescent spanning from one eye, around the back of the head, to the other eye. The sides and back are actually marked with tiny black and white stripes, although they appear grey. Their wings and tail are a tannish-brown color, with pale yellow feathers along the side of the tail. Females are entirely tannish-brown, except for their white chin and belly.

Range mass: 318 to 364 g.

Average basal metabolic rate: 1.68388 W.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: BioKIDS Critter Catalog

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Size

Length: 37 cm

Weight: 364 grams

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Length: 35 cm, Wingspan: 57.5 cm
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Gulf of Maine - CoML

Source: Gulf of Maine Area Census of Marine Life

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Diagnostic Description

Description

Length: 34-38 cm. Plumage: above and below vermiculated grey; head chestnut with irridescent green band from lores to nape; breast cream to buff, speckled black; under-tail coverts cream. Eclipse male and female mottled brown with greyish eyeline; Immature resembles female. Bare parts: iris brown; bill grey with flesh colour at base of maxilla; feet and legs slate grey. Habitat: occassionally sea and coastal waters; inland waters with floating vegetation.<388><391>
translation missing: en.license_cc_by_4_0

© WoRMS for SMEBD

Source: World Register of Marine Species

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Ecology

Habitat

Habitat and Ecology

Habitat and Ecology
Behaviour Northern breeding populations of this species are highly migratory (Madge and Burn 1988) although populations in more temperate regions are sedentary (del Hoyo et al. 1992) or locally dispersive (Scott and Rose 1996). The species breeds from May onwards (Madge and Burn 1988) in single pairs or loose groups (del Hoyo et al. 1992). Once females have started incubating (Kear 2005b) (from June or early-July) (Scott and Rose 1996) males congregate (Kear 2005b) and undertake extensive moult migrations or remain near the breeding grounds (Madge and Burn 1988) to undergo a flightless moulting period lasting for c.4 weeks (Scott and Rose 1996) (the females moult on the breeding grounds) (Madge and Burn 1988). After the post-breeding moult migratory populations of the species migrate south, the peak of the autumn migration occurring between October and November (Scott and Rose 1996). It returns to the breeding areas from late-February onwards (peaking March-April) (Scott and Rose 1996). Outside of the breeding season the species forms large concentrations, with large flocks of 30-40 and sometimes hundreds of individuals gathering at winter roosting sites (Brown et al. 1982, Madge and Burn 1988). The species forages at night during the winter (especially during the hunting season) but forages by day during the breeding season (Kear 2005b). Habitat Breeding The species shows a preference for shallow (Madge and Burn 1988, Kear 2005b) permanent waters (Johnsgard 1978) in the breeding season (Madge and Burn 1988, Snow and Perrins 1998), especially those in the vicinity of woodlands with fairly dense herbaceous cover available nearby for nesting (Johnsgard 1978). Small freshwater lakes and shallow marshes with abundant emergent vegetation (Johnsgard 1978, del Hoyo et al. 1992) are preferred to open water (Johnsgard 1978), as are small waterbodies forming part of a larger wetland, lake or river system, especially in the valleys of small forested rivers (Snow and Perrins 1998). Other suitable habitats include small ponds, pools (Madge and Burn 1988, Snow and Perrins 1998), oxbow lakes, lagoons (Snow and Perrins 1998) and slow-flowing streams (Brown et al. 1982, Snow and Perrins 1998). Non-breeding Outside of the breeding season the species frequents similar habitats to those in which it breeds (Brown et al. 1982), including marsh and lake habitats and other sheltered waters with high productivity and abundant vegetation (Kear 2005b) as well as flooded fields and artificial waters (e.g. reservoirs) (Snow and Perrins 1998). During the winter the species also occurs along the coast (del Hoyo et al. 1992, Scott and Rose 1996) on saline (Snow and Perrins 1998) or brackish lagoons with abundant submergent vegetation (Kear 2005b), saltmarshes (Madge and Burn 1988), tidal creeks (Johnsgard 1978), intertidal mudflats (Johnsgard 1978, Kear 2005b), river deltas (Madge and Burn 1988), estuarine waters (Madge and Burn 1988, Kear 2005b) and even sheltered coastal bays (Madge and Burn 1988), although it does show a preference for marshes with mud flats for foraging rather than more saline or open-water habitats (Johnsgard 1978). Diet Breeding In spring and summer the diet of the species consists predominantly of animal matter such as molluscs, worms, insects and crustaceans (del Hoyo et al. 1992). Non-breeding During winter the species mainly takes the seeds of aquatic plants (del Hoyo et al. 1992) (e.g. emergent and submerged macrophytes) (Kear 2005b), grasses, sedges and agricultural grain (del Hoyo et al. 1992) (cereals and rice) (Kear 2005b). Breeding site The nest is a hollow in the ground placed amongst dense vegetation (del Hoyo et al. 1992) or under bushes close to water (rarely more then 100 m away) (Kear 2005b). Neighbouring pairs may sometimes nest only 1 m apart although the species is not colonial (Snow and Perrins 1998). Management information A study in the Czech Republic found that fish ponds with a fish stock density of less than 400 kg ha1, water transparency of more than 50 cm, mixed fish stocks (e.g. tench and pike or perch) rather than monospecific stocks (e.g. of carp), and systems that include ponds with fish fry (to provide areas with low fish competition and high invertebrate availability) are more successful in supporting breeding pairs of this species (Musil 2006). Studies in Danish coastal wetlands found that the spatial restriction of shore-based shooting was more successful at maintaining waterfowl population sizes than was the temporal restriction of shooting, and therefore that wildfowl reserves should incorporate shooting-free refuges that include adjacent marshland in order to ensure high waterfowl species diversity (Bregnballe et al. 2004).

Systems
  • Terrestrial
  • Freshwater
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Depth range based on 236 specimens in 3 taxa.
Water temperature and chemistry ranges based on 6 samples.

Environmental ranges
  Depth range (m): 0 - 0
  Temperature range (°C): 6.847 - 11.396
  Nitrate (umol/L): 1.327 - 8.636
  Salinity (PPS): 8.628 - 35.080
  Oxygen (ml/l): 6.315 - 8.081
  Phosphate (umol/l): 0.240 - 0.599
  Silicate (umol/l): 2.505 - 9.412

Graphical representation

Temperature range (°C): 6.847 - 11.396

Nitrate (umol/L): 1.327 - 8.636

Salinity (PPS): 8.628 - 35.080

Oxygen (ml/l): 6.315 - 8.081

Phosphate (umol/l): 0.240 - 0.599

Silicate (umol/l): 2.505 - 9.412
 
Note: this information has not been validated. Check this *note*. Your feedback is most welcome.
All rights reserved

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Teals prefer shallow inland wetlands, beaver ponds, and coastal marshes with heavy vegetation and muddy bottoms. These habitats are often found in deciduous parklands, boreal forests, grasslands, or sedge meadows.

Terrestrial Biomes: savanna or grassland ; forest

Aquatic Biomes: lakes and ponds

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Comments: Freshwater ponds, marshes, shallow edges of lakes; also, in migration and winter, shallow salt and brackish water and shores (Godfrey 1966). Nests in prairie pothole country and elsewhere. Usually nests in areas with dense emergent vegetation; on islands, lake edges, sometimes in upland habitat some distance from water. Nest is a depression lined with plant material, down, feathers.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Teals prefer shallow inland wetlands, beaver ponds, and coastal marshes with heavy vegetation and muddy bottoms. These habitats are often found in deciduous parklands, boreal forests, grasslands, or sedge meadows.

Terrestrial Biomes: savanna or grassland ; forest

Aquatic Biomes: lakes and ponds

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: BioKIDS Critter Catalog

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Cover Requirements

More info for the term: cover

Green-winged teal nests are usually concealed both from the side and
from above in heavy grass, weeds, or brushy cover [9]. Cattails,
bulrushes, smartweeds (Polygonum spp.), and other emergent vegetation
provide hiding cover for ducks on water [3].

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Preferred Habitat

More info for the term: shrubs

Breeding/nesting habitat - Green-winged teal inhabit inland lakes,
marshes, ponds, pools, and shallow streams with dense emergent and
aquatic vegetation [1,4,9,14]. They prefer shallow waters and small
ponds and pools during the breeding season [12]. Green-winged teal are
often found resting on mudbanks or stumps, or perching on low limbs of
dead trees [4]. These ducks nest in depressions on dry ground located
at the base of shrubs, under a log, or in dense grass. The nests are
usually 2 to 300 feet (6-91 m) from water [4]. Green-winged teal avoid
treeless or brushless habitats [9].

Winter habitat - Green-winged teal winter in both freshwater or brackish
marshes, ponds, streams, and estuaries [4,9].

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Associated Plant Communities

More info for the terms: cover, tundra

Green-winged teal are abundant in wetlands of the Canadian parkland and
northern boreal forest associations. They occur more often in
mixed-prairie associations than in shortgrass associations. They also
inhabit arctic tundra and semidesert communities [1,9].

Within the above associations, green-winged teal commonly inhabit
wetland communities dominated by bulrushes (Scirpus spp.), cattails
(Typha spp.), sedges (Carex spp.), pondweeds (Potamogeton spp.) and
other emergent and aquatic vegetation [1,4]. Green-winged teal
frequently nest in grasses, sedge meadows, or on dry hillsides having
brush or aspen (Populus spp.) cover [9]. Near Brooks, Alberta,
green-winged teal nests were found most often in beds of rushes (Juncus
spp.), and in western Montana most nests were located under greasewood
(Sarcobatus spp.) [1].

REFERENCES :
NO-ENTRY

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Habitat: Cover Types

More info on this topic.

This species is known to occur in association with the following cover types (as classified by the Society of American Foresters):

More info for the term: swamp

5 Balsam fir
12 Black spruce
13 Black spruce - tamarack
16 Aspen
17 Pin cherry
18 Paper birch
19 Gray birch - red maple
38 Tamarack
63 Cottonwood
88 Willow oak - water oak - diamondleaf oak
89 Live oak
91 Swamp chestnut oak - cherrybark oak
95 Black willow
106 Mangrove
201 White spruce
202 White spruce - paper birch
203 Balsam poplar
204 Black spruce
205 Mountain hemlock
206 Engelmann spruce - subalpine fir
217 Aspen
235 Cottonwood - willow
252 Paper birch
253 Black spruce - white spruce
254 Black spruce - paper birch

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Habitat: Plant Associations

More info on this topic.

This species is known to occur in association with the following plant community types (as classified by Küchler 1964):

More info for the term: bog

K001 Spruce - cedar - hemlock forest
K002 Cedar - hemlock - Douglas-fir forest
K004 Fir - hemlock forest
K005 Mixed conifer forest
K008 Lodgepole pine - subalpine forest
K013 Cedar - hemlock - pine forest
K025 Alder - ash forest
K029 California mixed evergreen forest
K047 Fescue - oatgrass
K040 Saltbush - greasewood
K048 California steppe
K049 Tule marshes
K050 Fescue - wheatgrass
K051 Wheatgrass - bluegrass
K053 Grama - galleta steppe
K054 Grama - tobosa prairie
K056 Wheatgrass - needlegrass shrubsteppe
K057 Galleta - three-awn shrubsteppe
K058 Grama - tobosa shrubsteppe
K063 Foothills prairie
K064 Grama - needlegrass - wheatgrass
K065 Grama - buffalograss
K066 Wheatgrass - needlegrass
K067 Wheatgrass - bluestem - needlegrass
K068 Wheatgrass - grama - buffalograss
K069 Bluestem - grama prairie
K070 Sandsage - bluestem prairie
K072 Sea oats prairie
K073 Northern cordgrass prairie
K074 Bluestem prairie
K075 Nebraska Sandhills prairie
K076 Blackland prairie
K077 Bluestem - sacahuista prairie
K078 Southern cordgrass prairie
K079 Palmetto prairie
K080 Marl - everglades
K081 Oak savanna
K082 Mosaic of K074 and K100
K088 Fayette prairie
K090 Live oak - sea oats
K091 Cypress savanna
K092 Everglades
K093 Great Lakes spruce - fir forest
K094 Conifer bog
K095 Great Lakes pine forest
K096 Northeastern spruce - fir forest
K097 Southeastern spruce - fir forest
K098 Northern floodplain forest
K100 Oak - hickory forest
K105 Mangrove
K106 Northern hardwoods
K107 Northern hardwoods - fir forest
K108 Northern hardwoods - spruce forest
K109 Transition between K104 and K106
K110 Northeastern oak - pine forest
K111 Oak - hickory - pine forest
K113 Southern floodplain forest

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Habitat: Ecosystem

More info on this topic.

This species is known to occur in the following ecosystem types (as named by the U.S. Forest Service in their Forest and Range Ecosystem [FRES] Type classification):

FRES11 Spruce-fir
FRES14 Oak-pine
FRES15 Oak-hickory
FRES17 Elm-ash-cottonwood
FRES18 Maple-beech-birch
FRES19 Aspen-birch
FRES20 Douglas-fir
FRES21 Ponderosa pine
FRES22 Western white pine
FRES23 Fir-spruce
FRES24 Hemlock-Sitka spruce
FRES26 Lodgepole pine
FRES30 Desert shrub
FRES36 Mountain grasslands
FRES37 Mountain meadows
FRES38 Plains grasslands
FRES39 Prairie
FRES41 Wet grasslands
FRES42 Annual grasslands

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Depth range based on 236 specimens in 3 taxa.
Water temperature and chemistry ranges based on 6 samples.

Environmental ranges
  Depth range (m): 0 - 0
  Temperature range (°C): 6.847 - 11.396
  Nitrate (umol/L): 1.327 - 8.636
  Salinity (PPS): 8.628 - 35.080
  Oxygen (ml/l): 6.315 - 8.081
  Phosphate (umol/l): 0.240 - 0.599
  Silicate (umol/l): 2.505 - 9.412

Graphical representation

Temperature range (°C): 6.847 - 11.396

Nitrate (umol/L): 1.327 - 8.636

Salinity (PPS): 8.628 - 35.080

Oxygen (ml/l): 6.315 - 8.081

Phosphate (umol/l): 0.240 - 0.599

Silicate (umol/l): 2.505 - 9.412
 
Note: this information has not been validated. Check this *note*. Your feedback is most welcome.

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Summer: Freshwater marshes and rivers Winter: Coastal, bays.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Gulf of Maine - CoML

Source: Gulf of Maine Area Census of Marine Life

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Outside the breeding season, teal form large flocks on lakes and coastal bays. During the breeding season the birds chose brackish or freshwater lakes and ponds in upland wooded or forested areas.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Migration

Non-Migrant: No. All populations of this species make significant seasonal migrations.

Locally Migrant: No. No populations of this species make local extended movements (generally less than 200 km) at particular times of the year (e.g., to breeding or wintering grounds, to hibernation sites).

Locally Migrant: Yes. At least some populations of this species make annual migrations of over 200 km.

Begins slowly migrating northward in March-April; arrives in Beaufort Sea area late May-early June. Generally departs from northernmost breeding areas August-September. Usually migrates southward in large flocks with first cold fall weather. Rare in Puerto Rico and the Virgin Islands, October-April (Raffaele 1983).

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Move south during October through December. Migrates in small flocks. Mated pairs often travel north to breeding grounds together.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Gulf of Maine - CoML

Source: Gulf of Maine Area Census of Marine Life

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Trophic Strategy

Green-winged Teals feed on almost any plant or animal in high abundance, largely in shallow waters, near the shoreline or in mudflats. Their main foods vary from region to region, depending on what is available, but they consist mainly of marine invertebrates and seeds of marine vegetation. The finely spaced lamallae along the inside of the Teal's bill allow it to retrieve small seeds easily.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Comments: Eats aquatic plants; seeds of sedges, smartweeds, pondweeds, and grasses; aquatic insects, mollusks, crustaceans and tadpoles. In fall waste grain. Also eats berries, grapes, acorns. Dabbles in shallow water, also forages on land.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Food Habits

Green-winged Teals feed on almost any plant or animal in high abundance, largely in shallow waters, near the shoreline or in mudflats. Their main foods vary from region to region, depending on what is available, but they consist mainly of marine invertebrates and seeds of marine vegetation. The finely spaced lamallae along the inside of the Teal's bill allow it to retrieve small seeds easily.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: BioKIDS Critter Catalog

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Food Habits

Green-winged teal, more than any other species of duck, prefer to seek
food on mud flats. Where mud flats are lacking, they prefer shallow
marshes or temporarily flooded agricultural lands [1,4]. They usually
eat vegetative matter consisting of seeds, stems, and leaves of aquatic
and emergent vegetation. Green-winged teal appear to prefer the small
seeds of nutgrasses (Cyperus spp.), millets (Panicum spp.), and sedges
to larger seeds, but they also consume corn, wheat, barley, and
buttonbush (Cephalanthus spp.) seeds [1]. In marshes, sloughs, and
ponds, green-winged teal select the seeds of bulrushes, pondweeds, and
spikerushes (Eleocharis spp.). To a lesser extent they feed upon the
vegetative parts of muskgrass (Chara spp.), pondweeds, widgeongrass
(Ruppia maritima), and duckweeds (Lemna spp.) [1]. They will
occasionally eat insects, mollusks, and crustaceans [1,4]. Occasionally
during spring months, green-winged teal will gorge on maggots of
decaying fish which are found around ponds [14].

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Consumes mostly plant material. Also feeds on aquatic insects, crustaceans, mollusks, tadpoles, earthworms, and fish eggs.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Gulf of Maine - CoML

Source: Gulf of Maine Area Census of Marine Life

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Associations

Predators

Common predators of green-winged teal include humans, skunks (Mephitis
and Spilogale spp.), red foxes (Vulpes vulpes), raccoons (Pryon lotor),
crows (Corvus spp.), and magpies (Pica spp.) [1,6].

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

General Ecology

Habitat-related Fire Effects

More info for the terms: cover, marsh

Green-winged teal nesting cover can be removed by fire [6,13]. After
spring burning and mowing at Souris National Wildlife Refuge, North
Dakota, there were 13 percent fewer nesting pairs of seven dabbling duck
species (green-winged teal included) along mowed and burned areas than
where cover was untouched [13]. However, forested uplands adjacent to
aquatic habitats can be converted to grasses and sedges by fire,
increasing the nesting potential of green-winged teal [17]. Large-scale
autumn burning may have a detrimental effect upon marshes by decreasing
their ability to catch and retain drifting snow which adds heavily to
spring run-off. The ability of marsh vegetation to catch and hold snow
can be vital to marsh survival [18]. Fire often removes excessive
accumulations of fast-growing hydrophytes, permitting better waterfowl
access and growth of more desirable duck foods [17].

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Timing of Major Life History Events

Nesting - Nesting chronology varies geographically. In North Dakota,
green-winged teal generally begin nesting in late April. In the
Northwest Territories, Canada, green-winged teal begin nesting between
late May and early July. At Minto Lakes, Alaska, green-winged teal
initiate nesting as early as June 1 and as late as July 20 [1].

Clutch/incubation - Green-winged teal lay 5 to 16 eggs. The incubation
period is 21 to 23 days [1,14].

Age at sexual maturity - Green-winged teal become sexually mature their
first winter [1].

Fledging - Green-winged teals often fledge 34 to 35 days after hatching
or usually before 6 weeks of age [1,9]. Young green-winged teal have
the fastest growth rate of all ducks [1].

Molting - Male green-winged teal leave females at the start of
incubation and congregate on safe waters to molt. Some populations
undergo an extensive molt migration while others remain on or near
breeding grounds. Females molt on breeding grounds [12].

Migration - Green-winged teal are among the earliest spring migrants.
They arrive on nesting areas almost as soon as the snow melts [9]. In
early February, green-winged teal begin to depart their winter grounds,
and continue through April. In central regions green-winged teal begin
to arrive early in March with peak numbers in early April [1].

In northern areas of the United States, green-winged teal migrating to
wintering grounds appear in early September through mid-December. They
begin migrating into most central regions during September and often
remain through December. On their more southerly winter areas,
green-winged teal arrive as early as late September, but most do not
appear until late November [1].

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Life History and Behavior

Behavior

Perception Channels: visual ; tactile ; acoustic ; chemical

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Life Expectancy

Average lifespan

Status: wild:
243 months.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Lifespan/Longevity

Average lifespan

Status: wild:
243 months.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: BioKIDS Critter Catalog

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Lifespan, longevity, and ageing

Maximum longevity: 27.1 years (wild)
Creative Commons Attribution 3.0 (CC BY 3.0)

© Joao Pedro de Magalhaes

Source: AnAge

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Reproduction

Green-winged Teals begin courtship between September and November. They form monogamous pairs every winter. Paired males attempt forced extra-pair copulation during the mating season, while nonpaired males do not. The nest is built by the female, while the male watches, at the beginning of the egg-laying period. This occurs sometime in May, depending on the weather and temperature. Five or 6 eggs are usually layed. The male then abandons the female, who must incubate and care for the young alone. Incubation lasts for about 23 days, during which time the female spends almost three-fourths of her time on the nest, while the rest is spent in feeding and comfort movements. Once hatched, the Teal ducklings are more sensitive to cold than other duck species, and the mother must protect them from extreme cold through brooding. She also leads them to water and food and protects them from predators by using techniques of distraction.

Range eggs per season: 5 to 6.

Average time to hatching: 23 days.

Key Reproductive Features: iteroparous ; gonochoric/gonochoristic/dioecious (sexes separate); sexual ; oviparous

Average time to hatching: 22 days.

Average eggs per season: 10.

Average age at sexual or reproductive maturity (male)

Sex: male:
180 days.

Average age at sexual or reproductive maturity (female)

Sex: female:
180 days.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Clutch size is 7-15 (usually 8-9). Incubation, by female, lasts 21-23 days. Males abandon females early in incubation. Nestlings are precocial, tended by female, become independent in about 23 days.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Green-winged Teals begin courtship between September and November. They form monogamous pairs every winter. Paired males attempt forced extra-pair copulation during the mating season, while nonpaired males do not. The nest is built by the female, while the male watches, at the beginning of the egg-laying period. This occurs sometime in May, depending on the weather and temperature. Five or 6 eggs are usually layed. The male then abandons the female, who must incubate and care for the young alone. Incubation lasts for about 23 days, during which time the female spends almost three-fourths of her time on the nest, while the rest is spent in feeding and comfort movements. Once hatched, the Teal ducklings are more sensitive to cold than other duck species, and the mother must protect them from extreme cold through brooding. She also leads them to water and food and protects them from predators by using techniques of distraction.

Range eggs per season: 5 to 6.

Average time to hatching: 23 days.

Average time to hatching: 22 days.

Average eggs per season: 10.

Average age at sexual or reproductive maturity (male)

Sex: male:
180 days.

Average age at sexual or reproductive maturity (female)

Sex: female:
180 days.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: BioKIDS Critter Catalog

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Female builds nest near water, hiding it within brush or grasses. 6-11 eggs are incubated by the female for 20-24 days. Young hatchlings feed themselves while being tended by female.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Gulf of Maine - CoML

Source: Gulf of Maine Area Census of Marine Life

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Barcode data: Anas crecca

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There are 12 barcode sequences available from BOLD and GenBank.

Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.

See the BOLD taxonomy browser for more complete information about this specimen and other sequences.

CCACAAAGACATTGGCACCCTATACCTTATCTTCGGGGCATGAGCCGGAATAATTGGCACAGCACTCAGCCTACTGATCCGCGCAGAACTAGGCCAACCAGGAACCCTCCTGGGCGACGACCAAATTTACAACGTAATCGTCACCGCCCACGCCTTTGTAATAATCTTCTTCATGGTAATACCCATCATGATTGGAGGATTCGGCAACTGATTAGTCCCCCTAATAATCGGCGCCCCTGACATAGCATTCCCACGAATAAACAACATAAGCTTCTGACTCCTCCCACCATCATTCCTCCTCCTACTCGCCTCATCTACCGTAGAAGCTGGGGCCGGTACAGGTTGAACCGTGTACCCACCCCTAGCAGGCAACCTGGCCCACGCCGGAGCCTCAGTAGACCTAGCTATCTTCTCCCTTCACCTAGCCGGTGTCTCCTCCATCCTCGGGGCCATTAACTTCATTACCACAGCCATCAACATAAAACCCCCTGCACTCTCACAGTACCAAACCCCACTTTTCGTCTGATCGGTCCTAATTACCGCCATCCTACTCCTCCTATCACTCCCTGTCCTCGCCGCCGGCATCACAATGCTACTAACCGACCGAAACCTAAACACCACATTCTTTGACCCCGCCGGAGGAGGAGACCCAATCCTGTACCAACACCTATTTTGATTCTTCGGCCACCCAGAAGTCTATATCTTAATCCTCCCAGGATTTGGAATTATCTCCCACGTAA
-- end --

Download FASTA File

Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Statistics of barcoding coverage: Anas crecca

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 15
Specimens with Barcodes: 18
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Conservation

Conservation Status

IUCN Red List Assessment


Red List Category
LC
Least Concern

Red List Criteria

Version
3.1

Year Assessed
2012

Assessor/s
BirdLife International

Reviewer/s
Butchart, S. & Symes, A.

Contributor/s

Justification
This species has an extremely large range, and hence does not approach the thresholds for Vulnerable under the range size criterion (Extent of Occurrence <20,000 km2 combined with a declining or fluctuating range size, habitat extent/quality, or population size and a small number of locations or severe fragmentation). The population trend is not known, but the population is not believed to be decreasing sufficiently rapidly to approach the thresholds under the population trend criterion (>30% decline over ten years or three generations). The population size is extremely large, and hence does not approach the thresholds for Vulnerable under the population size criterion (<10,000 mature individuals with a continuing decline estimated to be >10% in ten years or three generations, or with a specified population structure). For these reasons the species is evaluated as Least Concern.

History
  • Least Concern (LC)
  • Least Concern (LC)
  • Least Concern (LC)
  • Not Recognized (NR)
  • Lower Risk/least concern (LR/lc)
  • Lower Risk/least concern (LR/lc)
  • Lower Risk/least concern (LR/lc)