Articles on this page are available in 1 other language: Chinese (Simplified) (6) (learn more)

Overview

Comprehensive Description

Description of Anas falcata

Het mannetje heeft een kastanjerode kruin en het vrouwtje niet.
Creative Commons Attribution 3.0 (CC BY 3.0)

1geron

Source: BioPedia

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Distribution

Range Description

Anas falcata has a large range, with an estimated global extent of occurrence of 1,000,000-10,000,000 km2. It breeds over much of south-east Siberia, Russia, south to northern Mongolia, China, and Japan. Although the global population was previously estimated to be 35,000 individuals, recent counts indicate that it is considerably higher, with perhaps as many as 89,000 in total (Lei and Barter in litt. 2007). The majority of birds spending the non-breeding season in China (78,000), Japan (9,000), North Korea and South Korea (2,000) (Wetlands International 2002, Lei and Barter in litt. 2007). It also regularly winters in small numbers in Bangladesh, north-east India, Nepal, where it is rare and irregular (H. S. Baral in litt. 2005), Taiwan, and northern Laos, Myanmar, Thailand, and Vietnam, where it is a very rare visitor (A. W. Tordoff in litt. 2005). Vagrants have been recorded from Afghanistan, Bulgaria, Canada, Iran, Iraq, Jordan, Kazakhstan, Malta, the Netherlands, Pakistan, Poland, Portugal, Turkey, and the Aleutian Islands of the United States (Madge and Burn 1988). Escapes from waterfowl collections mask the extent of vagrancy to western Europe. The species appears to be declining in southern China, remaining common only in Dongting Hu, Hunan Province (S. Chan in litt. 2005) and there have been notable declines at least locally in the breeding range, for instance, on Lake Udyl the total number of Falcated Duck broods has fallen from 530 to 120 broods since the 1980s (Poyarkov 2006). Of 14,763 individuals counted in a 2005 survey of China, 13,605 were in Hunan Province, and 970 in Hubei Province (M. Barter in litt. 2005). Populations in Japan and Korea appear to have remained stable or declined only slightly (S. Chan in litt. 2005). It also appears to have become less frequent in Nepal (H. S. Baral in litt. 2005).

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Range

E Siberia and Mongolia to n Japan; winters to India.

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Geographic Range

The range of Anas falcata, also known as falcated teals or ducks, is from eastern Siberia and Mongolia to northern Japan with wintering grounds in southeast Asia to eastern India. There have also been sightings of falcated teals in America, Poland and Thailand. However, these sightings have been attributed to vagrant ducks and ducks that have escaped from captivity.

Biogeographic Regions: palearctic (Native ); oriental (Native )

  • Johnsgard, P. 1978. Ducks, Geese, and Swans of the World. Lincoln and London: University of Nebraska Press.
  • 1970. Bronze-Capped Teal. Pp. 127-128 in A Rutgers, K Norris, eds. Encyclopaedia of Aviculture, Vol. 1, First Edition. Poole, Dorset: Blandford Press Ltd.
  • Clements, J. 2007. The Clements checklist of birds of the world. Ithaca: Comstock Pub. Associates/Cornell University Press.
  • Li, J., S. Lu, Y. Liu, Z. Zhang, Y. Zhang, X. Ruan. 2008. A survey of the birds of the Dabie Shan range, central China. Forktail, 24: 80-91.
  • Ozarowski, D., W. Meissner, M. Skakuj. 1993. First record of the falcated duck (Anas falcata) in Poland. Notatki Ornitologiczne, 34/ 3/4: 373-374.
  • Robertson, I. 1992. Falcated Teal Anas falcata, a New Bird for Thailand. Siam Society. Natural History Bulletin, 40/2: 191-192.
  • San Miguel, M., T. McGrath. 2005. Report of the California Bird Records Committee: 2003 records. Western Birds, 36/2: 78-113.
  • Soothill, E., P. Whitehead. 1978. Wildfowl of the World. London: Peerage Books.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Physical Description

Morphology

Physical Description

Males and females are similar in length at 46 to 53 cm. Their weights range from 422 to 770 g, with males being slightly lighter than females. Their wingspans are 79 to 91 cm.

Both sexes have black bills, a brown iris, gray to yellowish colored legs, and an iridescent green speculum on each wing.

Males in breeding plumage have a crested head which is iridescent green and purple in color. They also have a white neck and a white spot just above the bill. Their bodies are gray and black. Their most interesting characteristic is their uniquely shaped tertial feathers; they are falcated, or sickle-shaped, and extend over the other wing feathers. Males in eclipse appear more like the females.

Females are brown and white in color and do not have the falcated tertial feathers. They look very similar to gadwalls, though falcated teal have a small crest on their head and their speculums are green.

Juveniles have plumage similar to that of females.

Range mass: 422 to 770 g.

Average mass: Males: 713; Females: 585 g.

Range length: 46 to 53 cm.

Range wingspan: 79 to 91 cm.

Other Physical Features: endothermic ; homoiothermic; bilateral symmetry

Sexual Dimorphism: male larger; sexes colored or patterned differently; male more colorful; sexes shaped differently

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Ecology

Habitat

Habitat and Ecology

Habitat and Ecology
The species breeds by water-meadows and lakes in lowland valleys, both in open and partly wooded areas. It winters on lowland rivers, lakes, flooded meadows, and, less frequently, coastal lagoons and estuaries (Madge and Burn 1988). It is usually seen in pairs or small parties, with large flocks formed outside the breeding season, mixing with other dabbling ducks (particularly Eurasian Wigeon A. penelope and Northern Pintail A. acuta) (Madge and Burn 1988). The breeding season is May to July. Birds dabble and up-end for food in open water near emergent vegetation, or sometimes graze in waterside grassland or crops (Madge and Burn 1988).


Systems
  • Terrestrial
  • Freshwater
  • Marine
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Falcated teal belong to the order Anseriformes. As such, they are normally found in freshwater lakes, ponds, rivers and marshes that are surrounded by forest. They can also be found off the shores of Japan.

Habitat Regions: temperate ; polar ; saltwater or marine ; freshwater

Terrestrial Biomes: forest

Aquatic Biomes: lakes and ponds; rivers and streams; coastal

Wetlands: marsh

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Trophic Strategy

Food Habits

Falcated teal are mostly herbivorous, and eat vegetable matter, seeds, rice and aquatic plants. Occasionally they also consume small invertebrates and soft shelled mollusks.

Animal Foods: insects; mollusks

Plant Foods: leaves; seeds, grains, and nuts

Primary Diet: herbivore (Folivore )

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Associations

Ecosystem Roles

Since falcated teal eat grains and the seeds of plants, it can be assumed that they help to disperse seeds over a wide area.

Falcated teal, like many migratory birds, are host to a large number of parasites. Ectoparasites include ticks, fleas and lice. There are also a vast amount of internal parasites that use these birds as hosts. These include viruses, bacteria, fungi and protozoans. Some of the better known diseases that can be carried by falcated teal include: West Nile Virus, Avian Influenza, Avian Pox, Salmonellosis, Staphylococcosis, and E. coli. Many of these can be transferred to other vertebrates, including humans.

Ecosystem Impact: disperses seeds

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Predation

Flight is the main defense that falcated teal have against predators. Females' plumage features brownish tones that serve to better camouflage themselves, their nests, and ducklings within their grassy environments.

Humans are known to hunt falcated teal, both for food and their feathers. There is no information on other possible predator species. However, it can be assumed that the predators of other Anas species also prey on falcated teal.

Known Predators:

Anti-predator Adaptations: cryptic

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Life History and Behavior

Behavior

Communication and Perception

Along with the intricate courtship displays, males of the species will produce a low trilling whistle and females have a quack that is similar to mallards.

Falcated teal appear to be very social creatures. They have been known to associate with other Anas species while wintering and have been known to produce viable offspring with them.

Like most birds, falcated teal perceive their environments through visual, auditory, tactile and chemical stimuli.

Communication Channels: visual ; acoustic

  • Chiba, A. 2010. Morphological and Behavioral Traits of a Wild Hybrid Eurasian Wigeon×Falcated Duck Male Found at Hyo-Ko Waterfowl Park, Niigata, Japan. Ornithological Science, 9/2: 123-130.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Life Expectancy

Lifespan/Longevity

There is no data on longevity or mean life expectancy of falcated teal.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Reproduction

Falcated teal form strong seasonal monogamous pairs and have a very intricate courtship ritual.

Females begin with an inciting call. They then perform a display that includes pointing their bills, lifting their chins and emitting soft rrr sounds. This display is reminiscent of that of gadwalls. They also perform an introductory shake display and preen behind the wings of favored males. Lastly, males make a hoarse gak-gak call when they are displaying.

Males use displays that are widely used throughout the Anas genus. These include an exaggerated introductory shake, a neck-stretching burp call, a grunt-whistle and a head-up-tail-up display.

Mating System: monogamous

The breeding season for falcated teal is from May to early July. They make their nests on the ground near water, usually in tall grass or brush. Clutch sizes range from six to nine cream colored eggs. Incubation time ranges from 24 to 26 days and time to fledging is 45 to 60 days.

Breeding interval: Falcated teal breed once yearly

Breeding season: The breeding season for falcated teal occurs from May to early July

Range eggs per season: 6 to 10.

Range time to hatching: 24 to 26 days.

Range fledging age: 45 to 60 days.

Key Reproductive Features: seasonal breeding ; gonochoric/gonochoristic/dioecious (sexes separate); fertilization

Females have a higher parental investment than males. They incubate the eggs for 24 to 26 days and then take care of the chicks until they are fully fledged, which is 45 to 60 days after hatching. Males tend to stay near the nesting site only for the first half of the incubation period.

Parental Investment: precocial ; female parental care ; pre-fertilization (Provisioning, Protecting: Male, Female); pre-hatching/birth (Provisioning: Male, Female, Protecting: Male, Female); pre-weaning/fledging (Provisioning: Female, Protecting: Female); pre-independence (Provisioning: Female, Protecting: Female)

  • Johnsgard, P. 1978. Ducks, Geese, and Swans of the World. Lincoln and London: University of Nebraska Press.
  • 1970. Bronze-Capped Teal. Pp. 127-128 in A Rutgers, K Norris, eds. Encyclopaedia of Aviculture, Vol. 1, First Edition. Poole, Dorset: Blandford Press Ltd.
  • Soothill, E., P. Whitehead. 1978. Wildfowl of the World. London: Peerage Books.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Barcode data: Anas falcata

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There is 1 barcode sequence available from BOLD and GenBank.   Below is the sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.  See the BOLD taxonomy browser for more complete information about this specimen.  Other sequences that do not yet meet barcode criteria may also be available.

TCTATACCTTATCTTCGGGGCATGAGCCGGAATAATTGGCACAGCACTCAGCCTGCTAATCCGCGCAGAACTAGGCCAACCAGGGACCCTCCTGGGCGACGACCAAATTTATAACGTGATCGTCACCGCTCACGCCTTTGTAATAATCTTCTTCATAGTAATGCCCATCATAATTGGAGGATTCGGCAACTGATTGGTCCCCCTGATAATCGGTGCCCCCGACATAGCGTTCCCACGAATAAACAACATGAGCTTCTGACTCCTCCCACCGTCATTCCTCCTACTACTCGCCTCATCCACCGTAGAAGCTGGCGCTGGCACAGGTTGAACCGTGTACCCGCCCCTAGCAGGCAATCTAGCCCACGCCGGAGCCTCAGTAGACCTAGCTATCTTCTCACTCCACCTAGCCGGAGTCTCCTCCATCCTCGGAGCCATTAACTTCATTACCACGGCCATCAACATAAAACCCCCCGCACTCTCACAATACCAAACCCCACTTTTCGTTTGATCGGTACTAATTACCGCCATCCTACTCCTCCTATCACTCCCCGTCCTCGCCGCCGGCATCACAATGCTATTAACCGACCGAAACCTAAACACTACATTCTTTGACCCCGCCGGAGGAGGAGACCCAATTCTGTACCAACACCTATTTTGATTCTTCGGCCACCCAGAAGTCTATATCTTAATTCTC
-- end --

Download FASTA File
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Statistics of barcoding coverage: Anas falcata

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 1
Specimens with Barcodes: 1
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Conservation

Conservation Status

IUCN Red List Assessment


Red List Category
NT
Near Threatened

Red List Criteria

Version
3.1

Year Assessed
2012

Assessor/s
BirdLife International

Reviewer/s
Butchart, S. & Symes, A.

Contributor/s
Baral, H., Barter, M., Cao, L., Chan, S. & Tordoff, A.W.

Justification
Although this species is clearly more abundant than once believed, it has been retained as Near Threatened owing to moderately rapid declines in China, as measured by survey data and inferred from very high levels of hunting.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Currently falcated teal are not threatened, but are protected under the Migratory Bird Treaty Act. According to the International Union for Conservation of Nature and Natural Resources (IUCN) this species is of least concern. They inhabit a wide geographic range and their population numbers appear to be stable. There are efforts to regulate hunting of all waterfowl, including falcated teal, and to provide alternate employment for some local hunters that may severely decrease local duck populations.

US Migratory Bird Act: protected

CITES: no special status

IUCN Red List of Threatened Species: near threatened

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Population

Population
Although the global population was previously estimated to be 35,000 individuals, recent counts indicate that it is considerably higher, with perhaps > 89,000 individuals in total (Lei and Barter in litt 2007). The majority of birds spend the non-breeding season in China, (c.78,000 individuals), Japan (c.9,000 individuals), North Korea and South Korea (c.2,000 individuals) (Wetlands International 2002; Lei and Barter in litt. 2007).

Population Trend
Decreasing
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Threats

Major Threats
Hunting for food, for subsistence and local markets, is probably the major threat. This is particularly true on the non-breeding grounds in China, with an estimated 33,000-37,000 individuals of this species taken along the lower and middle Yangtze River basins in each of the four winters from 1988-1992 (Madge and Burn 1988).

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Management

Conservation Actions

Conservation Actions
Conservation Actions Underway
The species occurs in a number of protected areas.

Conservation Actions Proposed
Continue to monitor non-breeding populations. Formulate national and local hunting or shooting regulations (Madge and Burn 1988). Educate people about the plight of waterfowl, and provide alternative employment opportunities for local hunters (Madge and Burn 1988). Improve management of existing wetland nature reserves on the non-breeding grounds (Madge and Burn 1988).

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Relevance to Humans and Ecosystems

Benefits

Economic Importance for Humans: Negative

With the number of diseases and parasites that falcated teal can carry, they may be considered a slight risk to humans and their domesticated animals.

Negative Impacts: injures humans (carries human disease); causes or carries domestic animal disease

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Economic Importance for Humans: Positive

Over the last few decades, falcated teal have been used as an ornamental species in duck collections. This sets up a market for the raising and selling of this species.

They are also often hunted in the wild and are an important source of food for some of the countries in their range. Their feathers are also harvested and used for a variety of purposes.

Positive Impacts: pet trade ; food ; body parts are source of valuable material

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Wikipedia

Falcated Duck

The falcated duck or falcated teal (Anas falcata) is a gadwall-sized dabbling duck.

Taxonomy[edit]

The closest relative of this species is the gadwall, followed by the wigeons.[2]

Reproduction[edit]

Falcated ducks have a very intricate courtship ritual. Females perform a series of inciting calls and other movements while preening behind the wings of their targeted male. Males use a courting method similar to others in the Anas genus, including an introductory shake, a neck-stretching burp call, a grunt whistle, and a head-up-tail-up display. During the mating season the falcated ducks form monogamous pairs that last throughout the mating season.[3] It is currently not known how long the falcated duck lifespan is. There is also not much information on their territory size because these ducks are not studied as closely as other more popular species like swans or geese.[3]

Hybridization[edit]

A fieldwork study at Hyo-ko Waterfowl Park,a nature preserve in Niigata, Japan, found what they presumed was a male hybrid of a falcated duck and a Eurasian wigeon. They have found these “wild” hybrids in several instances over the past few years. These birds shared morphological traits with both species. Still, most of the traits favored the falcated duck. It was reported that these hybrid birds have joined courting parties of Eurasian Widgeon and even attempted to compete with Widgeon males. Grunt-whistling, and burping calls being the method of inciting courtship, even resemble that of the falcated duck and not of the Eurasian wigeon. The hybrid bird most be closely watched, was quite sexually active, however, it is not yet known if they can reproduce with either of the female species.[4]

Hybridization between two different species often leaves the offspring sterile, but this genus shows a surprising amount of hybrid fertility. This hybrid species performed courtship rituals more closely related to the falcated duck, yet socially was active in Eurasian Wigeon flocks. Successful reproduction was not seen between the hybrid species and a pure Eurasian Wigeon female during the fieldwork study. Further study of hybrid avian species can help shed light onto avian reproduction and their evolutionary biology.[5]

Distribution and habitat[edit]

The falcated duck breeds in eastern Asia. It nests in eastern Russia, in Khabarovsk, Primorskiy, Amur, Chita, Buryatia, Irkutsk, Tuva, eastern Krasnoyarsk, south central Sakha Sakhalin, extreme northeastern North Korea and northern China, in northeastern Inner Mongolia, and northern Heilongjiang, and in northern Japan, Hokkaidō, Aomori, and the Kuril Islands.[6] It is widely recorded well outside its normal range, but the popularity of this beautiful duck in captivity clouds the origins of these extralimital birds.

This dabbling duck is strongly migratory and winters in much of Southeast Asia. In India: Uttar Pradesh, Bihār, Assam, eastern Haryāna. Also in northern Bangladesh, northern and central Myanmar, northern Laos to the Mekong River, northern Vietnam (from about Hanoi north), and China: Hainan, Taiwan, Yunnan, Guangxi Zhuang, Guangdong, Fujian, Jiangxi, northern Hunan, Hubei, Zhejiang, Anhui, Jiangsu, Shandong, southern Hebei, Shanxi, northern Shaanxi.[6] It is gregarious outside the breeding season and will then form large flocks.

It is estimated that there are about 89,000 falcated ducks in total; this is much higher than the previous population estimate of 35,000 worldwide.[7]

During a survey done in Central China, a migratory area in the winter for the falcated duck, the numbers of animals sighted was minimal. In 2004 only 4 were recorded, and in 2005 only 10.[8]

This is a species of lowland wetlands, such as water meadows or lakes, and usually feeds by dabbling for plant food or grazing. It nests on the ground, near water and under the cover of taller vegetation. The clutch is 6–10 eggs.

The National Nature Reserves supported high proportions of eastern China’s populations of globally threatened Anatidae species (IUCN, 2009): 30% of the near threatened falcated duck (Anas falcata) populations.There is about twenty-seven percent of falcated duck species existing in the National Nature Reserves.[9]

There are many species that have mitochondrial DNA lineages that are phylogenetically intermixed with other species, but studies have rarely tested the cause of such paraphyly. In a study that was conducted, there were tested two hypotheses that could explain mitochondrial paraphyly of Holarctic gadwalls (Anas strepera) with respect to Asian falcated ducks (A. falcata). First, hybridization could have resulted in falcated duck mitochondrial DNA (mtDNA) introgressing into the gadwall gene pool. Second, gadwalls and falcated ducks could have diverged so recently that mtDNA lineages have not sorted to reciprocal monophyly. They used coalescent analyses of three independent loci to distinguish between these two hypotheses. Two lines of evidence support introgression. First, analyses of the three loci combined show that some introgression is necessary to explain current genetic diversity in gadwalls. Second, they generated alternative predictions regarding time since divergence estimated from mtDNA: falcated ducks and gadwalls would have diverged between 65,000 and 700,000 years before present (ybp) under the introgression hypothesis and between 11,000 and 76,000 ybp under the incomplete lineage sorting hypothesis. The two independent nuclear introns indicated that these species diverged between 210,000 and 5,200,000 ybp, which did not overlap the predicted time for incomplete lineage sorting. These analyses also suggested that ancient introgression (similar to 14,000 ybp) has resulted in the widespread distribution and high frequency of falcated-like mtDNA (5.5% of haplotypes) in North America. This is the first study to use a rigorous quantitative framework to reject incomplete lineage sorting as the cause of mitochondrial paraphyly.[10]

Migration[edit]

A rare falcated duck, a "vagrant" from Asia, that arrived at CA's Colusa National Wildlife Refuge in December 2011

Like one of many species of birds, the falcated duck migrates through the Atlantic Ocean. It has a large range, with an estimated global extent of occurrence of 1,000,000-10,000,000 km2.[1] Like 32 other species this bird flies from Eurasia to the eastern United States between the months of August and September. However, 32 species of birds is a small percentage of the population that actually migrate in between hemispheres. These migrations from country to country can cause some diseases (viruses)from insects such as mosquitoes, spread from Europe to North America. The infection happens when the mosquito bites one of the members of the ducks while in one place, for instance West Nile, and carry the infectious blood into the New World. [11]

It should be noted that the falcated duck is primarily native to Asia. The range of Anas falcata, in more colloquial terms, is from eastern Siberia and Mongolia to northern Japan with wintering grounds in southeast Asia to eastern India. There have also been sightings of falcated teals in America, Poland and Thailand. However, these sightings have been attributed to vagrant ducks and ducks that have escaped from captivity, and while the falcated duck has the capacity to immigrate from the far east to the west, it is rare to find the bird outside of Asia and Eurasia.[12]

Identification[edit]

Male falcated duck

Males and females have similar lengths at 46 to 53 cm. Their weight can range from 422 to 770 grams, with males weighing more than their female counterparts. Wingspans range from 79 to 91 cm.[3] The breeding male is unmistakable. Most of the body plumage is finely vermiculated grey, with the long sickle-shaped tertials, which give this species its name, hanging off its back. The large head is dark green with a white throat, and a dark green collar and bronzed crown).[13] The vent region is patterned in yellow, black and white.

Female falcated duck

The female falcated duck is dark brown, with plumage much like a female wigeon. Its long grey bill is an aid to identification.[13] The eclipse male is like the female, but darker on the back and head. In flight both sexes show a pale grey underwing. The blackish speculum is bordered with a white bar on its inner edge.[13] Young birds are buffer than the female and have short tertials.

Juveniles have plumage similar to females of the species.[14]

These ducks are usually quiet except on breeding territory. The male duck has a shrill whistle tyu-tyu-vit…tyu-vit…tyu-tyu-vit (Dementiev and Gladkov 1952) and a quiet whistle ending with a wavering uit-trr (Flint et al. 1984). The female duck has a hoarse, quack, short two-syllable inciting call, and a high pitched, two to four syllable Decrescendo call (Lorenz and Von de Wall 1960).[15] The Anas falcata are known to have very striking and beautiful sickle feathers. This is in comparison with many other birds like swams and geese.[16]

Human influence on population[edit]

The falcated duck requires coastal wetlands for its survival. One of the most ecologically sensitive areas in the world is the eastern end of Nanhui county, China, and is a site for the falcated duck during the migratory season. This area is crucial for the falcated duck due to its population being extremely low. Urbanization and economic growth of this area has led to a significant environmental disturbance in this area. A reclamation project to create artificial wetlands was started in 1999 and finished in 2005. Studies have been done to see if the artificial wetlands were as efficient as the natural ones, and although the artificial wetlands did see migratory shorebirds present, their population was not as high as the natural wetlands. Much more research needs to be done before the artificial wetlands can match the natural wetlands, and provide an acceptable habitat for the falcated duck.

Around the time of the harvesting seasons during the Chinese spring festival of winter in Nanhui County of Shangai,China, the pond managers drain the water in the pond in order to catch fish for commercial purposes. Around that time, the pond was dominated by falcated ducks roosting there. After the pond is drained it remains dry until the following spring when water is replenished for fresh cultivation. The time that the water is replenished is very critical for migrant waterbirds in the spring. If the water is replenished too late then the dry pond is inapt for shorebirds and herons.[17]

Diet and role in ecosystem[edit]

Falcated ducks have food habits generally consisting of small invertebrate and other insects as well as plant foods. They mainly eat vegetation or insects near to the water, consuming animals such as larvae, crustaceans, and mollusks. They likewise eat plant foods: leave as well as seeds, grains, and nuts. Many assume that the falcated duck helps disperse seeds over large areas because of their diet. These ducks are primarily herbivorous. These ducks are hosts to a number of different parasites (ticks, fleas, lice) and thus carries diseases such as: West Nile Virus, Avian Influenza, Avian Pox, Salmonellosis, Staphylococcosis, and E. coli. Moreover they carry viruses, bacteria, fungi and protozoans that can be transferred to other creatures for instance vertebrates and even Humans.[3]

Breeding and life cycle[edit]

Eggs are generally laid in late May. They have their nests on the ground in thick grasses, tussocks, swamped shrubbery, or hidden in deadwood. Usually the eggs are nested near water but have also been seen in small bushes approximately 80 meters from the water. The eggs have a color of white with a pinkish yellow tint. Females incubate the eggs alone, 24–25 days in captivity. The males will leave the female during incubation.[15]

Threats[edit]

A primary threat to the falcated duck is hunting, as people want them for food and their feathers. Their habitat loss is also caused by the drainage of the wetlands.[15] Although the overall population of the falcated duck is larger than once believed and is no longer classified as an endangered species, it is still considered "near threatened" on the ICUN's (or the International Union for the Conservation of Nature's) Animal Red List.[18]

Conservation actions underway[edit]

Falcated duck populations are present in a number of wildlife preservers, national parks, zoos, and other protected areas such as the Colusa National Wildlife Refuge in Sacramento, California.[18]

Conservation actions proposed[edit]

There are several proposed plans of action in protecting the falcated duck. Conservationists are keen to continue monitoring populations that have unfortunately stopped breeding, and plan to petition for hunting and shooting regulations on both the local and national level, respectively. Conservationists are also aware as to the great lack of education in regards to waterfowl extinction. For hunters who make a living off of either using the falcated duck as a food source or from simple sport hunts, conservationists are looking for alternative employment opportunities. Finally, conservationists hope to improve the management and coordination of already existing nature reserves where the falcated duck is present.[18][19]

Conservation status[edit]

The falcated duck is currently in a state of "near threatened" on the IUCN's Red List.[1] They are protected under the Migratory Bird Treaty Act, and their overall population seems to be (for the most part) stable and growing.[3]

References[edit]

  1. ^ a b c BirdLife International (2012). "Anas falcata". IUCN Red List of Threatened Species. Version 2013.2. International Union for Conservation of Nature. Retrieved 26 November 2013. 
  2. ^ Johnson, Kevin P; Sorenson, Michael D (July 1999). "Phylogeny and biogeography of dabbling ducks (genus: Anas): A comparison of molecular and morphological evidence" (PDF). The Auk 116 (3): 792–805. doi:10.2307/4089339. 
  3. ^ a b c d e Glover, Stephen. "ADW: Anas falcata: INFORMATION". Animaldiversity.ummz.umich.edu. Retrieved 2014-04-08. 
  4. ^ "Logging into the proxy: NetID (Rutgers University Libraries)". Bioone.org.proxy.libraries.rutgers.edu. Retrieved 2014-04-08. 
  5. ^ "Logging into the proxy: NetID (Rutgers University Libraries)". Bioone.org.proxy.libraries.rutgers.edu. Retrieved 2014-04-08. 
  6. ^ a b Clements, James, (2007) The Clements Checklist of the Birds of the World, Cornell University Press, Ithaca
  7. ^ Barter, Baral H. (October 2013). "Falcated Duck Anas Falcata. Species". Birdlife International. Retrieved April 8, 2014. 
  8. ^ Liu, Yang, Zheng-Wang Zhang, et al. "A survey of the birds of the Dabie Shan range, central China." Forktail. 24.80-91 (2008): n. page. Print.
  9. ^ Cao, =Lei; Zhang, Yong; Barter, Mark; Lei, Gang (March 2010). "Anatidae in eastern China during the non-breeding season: Geographical distributions and protection status". Biological Conservation. 143, Issue 3. pp. 650–659. ISSN 0006-3207. 
  10. ^ "Web of Science [v5.13] - Please Sign In to Access Web of Science". Apps.webofknowledge.com. Retrieved 2014-04-08. 
  11. ^ Rappole, John H., Scott R. Derrickson, and Zdenek Hubálek (October 2013). "Migratory Birds and Spread of West Nile. Perspectives" (PDF). Conservation and Research Center, National Zoological Park, Smithsonian. 
  12. ^ Li, J., S. Lu, Y. Liu, Z. Zhang, Y. Zhang, X. Ruan. 2008. A survey of the birds of the Dabie Shan range, central China. Forktail, 24: 80-91.
  13. ^ a b c Dunn, J. & Alderfer, J. (2006) National Geographic Field Guide to the Birds of North America 5th Ed.
  14. ^ "Descriptions and articles about the Falcated Duck (Anas falcata) - Encyclopedia of Life". Eol.org. Retrieved 2014-04-08. 
  15. ^ a b c Kear, Janet. Ducks, Geese, and Swans Oxford: Oxford UP, 2005. Print.
  16. ^ go.galegroup.com
  17. ^ "Logging into the proxy: NetID (Rutgers University Libraries)". Apps.webofknowledge.com.proxy.libraries.rutgers.edu. Retrieved 2014-04-08. 
  18. ^ a b c Butchart, S.; Ekstrom, J.; Khwaja, N.; Mahood, S.; Pilgrim, J.; Tylor, J. (October 25, 2013). "Falcated duck anas falcata". Retrieved April 8, 2014. 
  19. ^ Madge, S.; Burn, H. 1988. Wildfowl. Christopher Helm, London.

Further reading[edit]

  • Madge, Steve; Burn, Hilary (1988). Wildfowl: An Identification Guide to the Ducks, Geese and Swans of the World (Helm Identification Guides). Christopher Helm. ISBN 0-7470-2201-1. 
Creative Commons Attribution Share Alike 3.0 (CC BY-SA 3.0)

Source: Wikipedia

Unreviewed

Article rating from 0 people

Average rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!