Articles on this page are available in 1 other language: Chinese (Simplified) (6) (learn more)

Overview

Comprehensive Description

Description of Anas falcata

Het mannetje heeft een kastanjerode kruin en het vrouwtje niet.
Creative Commons Attribution 3.0 (CC BY 3.0)

1geron

Source: BioPedia

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Distribution

The range of Anas falcata, also known as falcated teals or ducks, is from eastern Siberia and Mongolia to northern Japan with wintering grounds in southeast Asia to eastern India. There have also been sightings of falcated teals in America, Poland and Thailand. However, these sightings have been attributed to vagrant ducks and ducks that have escaped from captivity.

Biogeographic Regions: palearctic (Native ); oriental (Native )

  • Johnsgard, P. 1978. Ducks, Geese, and Swans of the World. Lincoln and London: University of Nebraska Press.
  • 1970. Bronze-Capped Teal. Pp. 127-128 in A Rutgers, K Norris, eds. Encyclopaedia of Aviculture, Vol. 1, First Edition. Poole, Dorset: Blandford Press Ltd.
  • Clements, J. 2007. The Clements checklist of birds of the world. Ithaca: Comstock Pub. Associates/Cornell University Press.
  • Li, J., S. Lu, Y. Liu, Z. Zhang, Y. Zhang, X. Ruan. 2008. A survey of the birds of the Dabie Shan range, central China. Forktail, 24: 80-91.
  • Ozarowski, D., W. Meissner, M. Skakuj. 1993. First record of the falcated duck (Anas falcata) in Poland. Notatki Ornitologiczne, 34/ 3/4: 373-374.
  • Robertson, I. 1992. Falcated Teal Anas falcata, a New Bird for Thailand. Siam Society. Natural History Bulletin, 40/2: 191-192.
  • San Miguel, M., T. McGrath. 2005. Report of the California Bird Records Committee: 2003 records. Western Birds, 36/2: 78-113.
  • Soothill, E., P. Whitehead. 1978. Wildfowl of the World. London: Peerage Books.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Range Description

Mareca falcata has a large range, with an estimated global extent of occurrence of 1,000,000-10,000,000 km2. It breeds over much of south-east Siberia, Russia, south to northern Mongolia, China, and Japan. Although the global population was previously estimated to be 35,000 individuals, recent counts indicate that it is considerably higher, with perhaps as many as 89,000 in total (Lei and Barter in litt. 2007). The majority of birds spending the non-breeding season in China (78,000), Japan (9,000), North Korea and South Korea (2,000) (Wetlands International 2002, Lei and Barter in litt. 2007). It also regularly winters in small numbers in Bangladesh, north-east India, Nepal, where it is rare and irregular (H. S. Baral in litt. 2005), Taiwan, and northern Laos, Myanmar, Thailand, and Vietnam, where it is a very rare visitor (A. W. Tordoff in litt. 2005). Vagrants have been recorded from Afghanistan, Bulgaria, Canada, Iran, Iraq, Jordan, Kazakhstan, Malta, the Netherlands, Pakistan, Poland, Portugal, Turkey, and the Aleutian Islands of the United States (Madge and Burn 1988). Escapes from waterfowl collections mask the extent of vagrancy to western Europe. The species appears to be declining in southern China, remaining common only in Dongting Hu, Hunan Province (S. Chan in litt. 2005) and there have been notable declines at least locally in the breeding range, for instance, on Lake Udyl the total number of Falcated Duck broods has fallen from 530 to 120 broods since the 1980s (Poyarkov 2006). Of 14,763 individuals counted in a 2005 survey of China, 13,605 were in Hunan Province, and 970 in Hubei Province (M. Barter in litt. 2005). Populations in Japan and Korea appear to have remained stable or declined only slightly (S. Chan in litt. 2005). It also appears to have become less frequent in Nepal (H. S. Baral in litt. 2005).

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Range

E Siberia and Mongolia to n Japan; winters to India.
  • Clements, J. F., T. S. Schulenberg, M. J. Iliff, D. Roberson, T. A. Fredericks, B. L. Sullivan, and C. L. Wood. 2014. The eBird/Clements checklist of birds of the world: Version 6.9. Downloaded from http://www.birds.cornell.edu/clementschecklist/download/

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Physical Description

Morphology

Males and females are similar in length at 46 to 53 cm. Their weights range from 422 to 770 g, with males being slightly lighter than females. Their wingspans are 79 to 91 cm.

Both sexes have black bills, a brown iris, gray to yellowish colored legs, and an iridescent green speculum on each wing.

Males in breeding plumage have a crested head which is iridescent green and purple in color. They also have a white neck and a white spot just above the bill. Their bodies are gray and black. Their most interesting characteristic is their uniquely shaped tertial feathers; they are falcated, or sickle-shaped, and extend over the other wing feathers. Males in eclipse appear more like the females.

Females are brown and white in color and do not have the falcated tertial feathers. They look very similar to gadwalls, though falcated teal have a small crest on their head and their speculums are green.

Juveniles have plumage similar to that of females.

Range mass: 422 to 770 g.

Average mass: Males: 713; Females: 585 g.

Range length: 46 to 53 cm.

Range wingspan: 79 to 91 cm.

Other Physical Features: endothermic ; homoiothermic; bilateral symmetry

Sexual Dimorphism: male larger; sexes colored or patterned differently; male more colorful; sexes shaped differently

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Ecology

Habitat

Falcated teal belong to the order Anseriformes. As such, they are normally found in freshwater lakes, ponds, rivers and marshes that are surrounded by forest. They can also be found off the shores of Japan.

Habitat Regions: temperate ; polar ; saltwater or marine ; freshwater

Terrestrial Biomes: forest

Aquatic Biomes: lakes and ponds; rivers and streams; coastal

Wetlands: marsh

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Habitat and Ecology

Habitat and Ecology
The species breeds by water-meadows and lakes in lowland valleys, both in open and partly wooded areas. It winters on lowland rivers, lakes, flooded meadows, and, less frequently, coastal lagoons and estuaries (Madge and Burn 1988). It is usually seen in pairs or small parties, with large flocks formed outside the breeding season, mixing with other dabbling ducks (particularly Eurasian Wigeon M. penelope and Northern Pintail Anas acuta) (Madge and Burn 1988). The breeding season is May to July. Birds dabble and up-end for food in open water near emergent vegetation, or sometimes graze in waterside grassland or crops (Madge and Burn 1988).


Systems
  • Terrestrial
  • Freshwater
  • Marine
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Trophic Strategy

Falcated teal are mostly herbivorous, and eat vegetable matter, seeds, rice and aquatic plants. Occasionally they also consume small invertebrates and soft shelled mollusks.

Animal Foods: insects; mollusks

Plant Foods: leaves; seeds, grains, and nuts

Primary Diet: herbivore (Folivore )

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Associations

Since falcated teal eat grains and the seeds of plants, it can be assumed that they help to disperse seeds over a wide area.

Falcated teal, like many migratory birds, are host to a large number of parasites. Ectoparasites include ticks, fleas and lice. There are also a vast amount of internal parasites that use these birds as hosts. These include viruses, bacteria, fungi and protozoans. Some of the better known diseases that can be carried by falcated teal include: West Nile Virus, Avian Influenza, Avian Pox, Salmonellosis, Staphylococcosis, and E. coli. Many of these can be transferred to other vertebrates, including humans.

Ecosystem Impact: disperses seeds

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Flight is the main defense that falcated teal have against predators. Females' plumage features brownish tones that serve to better camouflage themselves, their nests, and ducklings within their grassy environments.

Humans are known to hunt falcated teal, both for food and their feathers. There is no information on other possible predator species. However, it can be assumed that the predators of other Anas species also prey on falcated teal.

Known Predators:

Anti-predator Adaptations: cryptic

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Life History and Behavior

Behavior

Along with the intricate courtship displays, males of the species will produce a low trilling whistle and females have a quack that is similar to mallards.

Falcated teal appear to be very social creatures. They have been known to associate with other Anas species while wintering and have been known to produce viable offspring with them.

Like most birds, falcated teal perceive their environments through visual, auditory, tactile and chemical stimuli.

Communication Channels: visual ; acoustic

Perception Channels: visual ; tactile ; acoustic ; chemical

  • Chiba, A. 2010. Morphological and Behavioral Traits of a Wild Hybrid Eurasian Wigeon×Falcated Duck Male Found at Hyo-Ko Waterfowl Park, Niigata, Japan. Ornithological Science, 9/2: 123-130.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Life Expectancy

There is no data on longevity or mean life expectancy of falcated teal.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Reproduction

Falcated teal form strong seasonal monogamous pairs and have a very intricate courtship ritual.

Females begin with an inciting call. They then perform a display that includes pointing their bills, lifting their chins and emitting soft rrr sounds. This display is reminiscent of that of gadwalls. They also perform an introductory shake display and preen behind the wings of favored males. Lastly, males make a hoarse gak-gak call when they are displaying.

Males use displays that are widely used throughout the Anas genus. These include an exaggerated introductory shake, a neck-stretching burp call, a grunt-whistle and a head-up-tail-up display.

Mating System: monogamous

The breeding season for falcated teal is from May to early July. They make their nests on the ground near water, usually in tall grass or brush. Clutch sizes range from six to nine cream colored eggs. Incubation time ranges from 24 to 26 days and time to fledging is 45 to 60 days.

Breeding interval: Falcated teal breed once yearly

Breeding season: The breeding season for falcated teal occurs from May to early July

Range eggs per season: 6 to 10.

Range time to hatching: 24 to 26 days.

Range fledging age: 45 to 60 days.

Key Reproductive Features: iteroparous ; seasonal breeding ; gonochoric/gonochoristic/dioecious (sexes separate); sexual ; fertilization ; oviparous

Females have a higher parental investment than males. They incubate the eggs for 24 to 26 days and then take care of the chicks until they are fully fledged, which is 45 to 60 days after hatching. Males tend to stay near the nesting site only for the first half of the incubation period.

Parental Investment: precocial ; female parental care ; pre-fertilization (Provisioning, Protecting: Male, Female); pre-hatching/birth (Provisioning: Male, Female, Protecting: Male, Female); pre-weaning/fledging (Provisioning: Female, Protecting: Female); pre-independence (Provisioning: Female, Protecting: Female)

  • Johnsgard, P. 1978. Ducks, Geese, and Swans of the World. Lincoln and London: University of Nebraska Press.
  • 1970. Bronze-Capped Teal. Pp. 127-128 in A Rutgers, K Norris, eds. Encyclopaedia of Aviculture, Vol. 1, First Edition. Poole, Dorset: Blandford Press Ltd.
  • Soothill, E., P. Whitehead. 1978. Wildfowl of the World. London: Peerage Books.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Barcode data: Anas falcata

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There is 1 barcode sequence available from BOLD and GenBank.

Below is the sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.

See the BOLD taxonomy browser for more complete information about this specimen.

Other sequences that do not yet meet barcode criteria may also be available.

TCTATACCTTATCTTCGGGGCATGAGCCGGAATAATTGGCACAGCACTCAGCCTGCTAATCCGCGCAGAACTAGGCCAACCAGGGACCCTCCTGGGCGACGACCAAATTTATAACGTGATCGTCACCGCTCACGCCTTTGTAATAATCTTCTTCATAGTAATGCCCATCATAATTGGAGGATTCGGCAACTGATTGGTCCCCCTGATAATCGGTGCCCCCGACATAGCGTTCCCACGAATAAACAACATGAGCTTCTGACTCCTCCCACCGTCATTCCTCCTACTACTCGCCTCATCCACCGTAGAAGCTGGCGCTGGCACAGGTTGAACCGTGTACCCGCCCCTAGCAGGCAATCTAGCCCACGCCGGAGCCTCAGTAGACCTAGCTATCTTCTCACTCCACCTAGCCGGAGTCTCCTCCATCCTCGGAGCCATTAACTTCATTACCACGGCCATCAACATAAAACCCCCCGCACTCTCACAATACCAAACCCCACTTTTCGTTTGATCGGTACTAATTACCGCCATCCTACTCCTCCTATCACTCCCCGTCCTCGCCGCCGGCATCACAATGCTATTAACCGACCGAAACCTAAACACTACATTCTTTGACCCCGCCGGAGGAGGAGACCCAATTCTGTACCAACACCTATTTTGATTCTTCGGCCACCCAGAAGTCTATATCTTAATTCTC
-- end --

Download FASTA File

Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Statistics of barcoding coverage: Anas falcata

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 1
Specimens with Barcodes: 1
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Conservation

Conservation Status

Currently falcated teal are not threatened, but are protected under the Migratory Bird Treaty Act. According to the International Union for Conservation of Nature and Natural Resources (IUCN) this species is of least concern. They inhabit a wide geographic range and their population numbers appear to be stable. There are efforts to regulate hunting of all waterfowl, including falcated teal, and to provide alternate employment for some local hunters that may severely decrease local duck populations.

US Migratory Bird Act: protected

CITES: no special status

IUCN Red List of Threatened Species: near threatened

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

IUCN Red List Assessment


Red List Category
NT
Near Threatened

Red List Criteria

Version
3.1

Year Assessed
2012

Assessor/s
BirdLife International

Reviewer/s
Butchart, S. & Symes, A.

Contributor/s
Baral, H., Barter, M., Cao, L., Chan, S. & Tordoff, A.W.

Justification
Although this species is clearly more abundant than once believed, it has been retained as Near Threatened owing to moderately rapid declines in China, as measured by survey data and inferred from very high levels of hunting.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Population

Population
Although the global population was previously estimated to be 35,000 individuals, recent counts indicate that it is considerably higher, with perhaps > 89,000 individuals in total (Lei and Barter in litt 2007). The majority of birds spend the non-breeding season in China, (c.78,000 individuals), Japan (c.9,000 individuals), North Korea and South Korea (c.2,000 individuals) (Wetlands International 2002; Lei and Barter in litt. 2007).

Population Trend
Decreasing
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Threats

Major Threats
Hunting for food, for subsistence and local markets, is probably the major threat. This is particularly true on the non-breeding grounds in China, with an estimated 33,000-37,000 individuals of this species taken along the lower and middle Yangtze River basins in each of the four winters from 1988-1992 (Madge and Burn 1988).

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Management

Conservation Actions

Conservation Actions
Conservation Actions Underway
The species occurs in a number of protected areas.

Conservation Actions Proposed
Continue to monitor non-breeding populations. Formulate national and local hunting or shooting regulations (Madge and Burn 1988). Educate people about the plight of waterfowl, and provide alternative employment opportunities for local hunters (Madge and Burn 1988). Improve management of existing wetland nature reserves on the non-breeding grounds (Madge and Burn 1988).

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Relevance to Humans and Ecosystems

Benefits

With the number of diseases and parasites that falcated teal can carry, they may be considered a slight risk to humans and their domesticated animals.

Negative Impacts: injures humans (carries human disease); causes or carries domestic animal disease

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Over the last few decades, falcated teal have been used as an ornamental species in duck collections. This sets up a market for the raising and selling of this species.

They are also often hunted in the wild and are an important source of food for some of the countries in their range. Their feathers are also harvested and used for a variety of purposes.

Positive Impacts: pet trade ; food ; body parts are source of valuable material

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!