Articles on this page are available in 1 other language: Chinese (Simplified) (4) (learn more)

Overview

Brief Summary

Biology

The marbled murrelet feeds on fish such as sandlace and herring but feeds on invertebrates during winter (2). They forage singly, in pairs or in feeding flocks of a mix of different species (3). In California, breeding occurs from mid-March to early September, but the season is shorter further north (2). The nest is built on large branches in high elevation forests or on the ground on some islands. Incubation of the yellowish spotted eggs takes around 30 days and the young chicks fledge after a further 28 days (3).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Description

The marbled murrelet is a small, chubby seabird that has a very short neck (3). During the breeding season it has dark brown to blackish upperparts and a white belly and throat that are greatly mottled. During the winter the upperparts become grey, dark marks form on the sides of the breast and a white ring develops around the eye (2). Males and females are similar in appearance and size (4) (3). Juveniles are similar to the adult winter plumage, but with dusky mottling on the underparts (2). Vocalisations include a sharp 'keer' or low 'kee' (3).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Distribution

Range Description

Brachyramphus marmoratus occurs in the USA and Canada in California, Oregon, Washington, British Columbia, south-east Alaska, Prince William Sound, Kenai Peninsula, Lower Cook Inlet, Barren Islands, Afognak and Kodiak Islands, the Alaska Peninsula and the Aleutians locally to Andreanof and Near Islands (Gaston and Jones 1998). In Alaska (85% of the population), historical estimates place the population at c. 750,000 individuals, though when trend estimates are applied to this figure it gives an estimated 2006 population of c. 271,000 individuals (Piatt et al. 2007). The British Columbia population was previously thought to be c. 54,000 - 92,500 (Piatt et al. 2006) but recent radar counts suggest the population may in fact be c. 72,600-125,600 birds (Bertram et al. 2007, A. Burger in litt. 2012). This higher estimate is likely due to differences in survey methodology as opposed to a genuine population increase. The population in Washington, Oregon and California is estimated at 14,631-20,952 individuals (Falxa et al. 2009). The greatest historical decreases have occurred in Washington, Oregon and California, and these continue (A. Burger in litt. 2012). Declines are also reported in British Columbia and south-east Alaska (Perry 1995). Trend analyses conducted during 2000-2007 suggests a decline of c.15% over the period in Washington, Oregon, and California (Falxa et al. 2008), a decrease of c. 70% in Alaska from the 1980s to 2006 (Piatt et al. 2006), and a 40% decline in some parts of British Columbia in 1982-1992 (Kelson et al. 1995). At-sea surveys over the past 25 years in British Columbia suggest declines of c. 1% per year (Piatt et al. 2006) although radar surveys suggest the population may have been relatively stable since 1999 (COSEWIC 2012). Availability of nesting habitat in British Columbia, which is strongly correlated with local breeding populations (Burger 2001, Burger et al. 2004), has declined by 22% between 1978 and 2008 and is continuing (COSEWIC 2012).

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Shoreline regions of the north Pacific Ocean: Western - Japan to Kamchatka, Russia, Eastern- central California to southern Alaska.

Biogeographic Regions: nearctic (Native ); palearctic (Native ); pacific ocean (Native )

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

occurs (regularly, as a native taxon) in multiple nations

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

National Distribution

Canada

Origin: Native

Regularity: Regularly occurring

Currently: Present

Confidence: Confident

Type of Residency: Year-round

United States

Origin: Native

Regularity: Regularly occurring

Currently: Present

Confidence: Confident

Type of Residency: Year-round

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Global Range: (200,000-2,500,000 square km (about 80,000-1,000,000 square miles)) Breeding range extends from the western Aleutian Islands through coastal southern and southeastern Alaska, British Columbia (up to 100 kilometers inland), Washington, Oregon, and northern central California (mainly Del Norte and northern Humboldt counties to 15 km inland, southcentral Humboldt County 20-40 km inland, and southern San Mateo and northern Santa Cruz counties up to 20 km inland; Carter and Erickson in Carter and Morrison 1992); few occupied sites are known between Tillamook County in Oregon and the Olympic Peninsula in Washington (USFWS 1994). See USFWS (1994) and Federal Register (10 August 1995) for maps of proposed Critical Habitat in California, Oregon, and Washington. During the nonbreeding season, the range extends from southern Alaska south to central California, mostly adjacent to known or suspected nesting areas. Most of the Alaskan population is concentrated offshore of large tracts of coastal coniferous forests in southeastern Alaska (Alexander Archipelago), Prince William Sound, and the Kodiak Archipelago (Piatt and Ford 1993). See Marshall (1988), Carter and Morrison (1992), and Piatt et al. (2007) for further details for specific states and provinces.

Coded range extent pertains to breeding range.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Range

W Aleutian Islands and Alaska to central California.
  • Clements, J. F., T. S. Schulenberg, M. J. Iliff, D. Roberson, T. A. Fredericks, B. L. Sullivan, and C. L. Wood. 2014. The eBird/Clements checklist of birds of the world: Version 6.9. Downloaded from http://www.birds.cornell.edu/clementschecklist/download/

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Marbled murrelets occur in summer from Alaska's Kenai Peninsula, Barren
islands, and Aleutian islands south along the coast of North America to
Point Sal, Santa Barbara County, in south-central California [3,16].
Marbled murrelets winter mostly within the same general area, except
that they tend to vacate the most northern sections of their range and
have been recorded as far south as Imperial Beach of San Diego County,
California [16].

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Regional Distribution in the Western United States

More info on this topic.

This species can be found in the following regions of the western United States (according to the Bureau of Land Management classification of Physiographic Regions of the western United States):

1 Northern Pacific Border
2 Cascade Mountains
3 Southern Pacific Border

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Occurrence in North America

AK CA OR WA BC

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Historic Range:
U.S.A. (AK, CA, OR, WA), Canada (B.C.)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Range

Found along the western coast of the USA and Canada in California, Washington, Oregon, British Columbia, Alaska, Prince William Sound, Kenai Peninsula, Lower Cook Inlet, Barren Islands, Afognak and Kodiak Islands, the Alaska Peninsula and the Aleutians (2). Historically, the decline of this species has been most severe in Washington, Oregon and California; at present, however, the worst losses are occurring in British Columbia and Alaska (2).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Physical Description

Morphology

The Marbled Murrelet is a very small, chubby, sea bird that seems to lack a neck. It has a dark brown to black dorsum and a white venter and throat. The nonbreeding plumage includes a strip of white between the back and the wing, thus the name "marbled". The breeding plumage is dark brown dorsally; ventral feathers are white tipped with brown. Males and females are of approximately the same size, 9.5-10" wingspan. Bill length is 13-18 mm; wing length (relaxed) is 120-140mm. The voice of the Marbled Murrelet is a sharp "keer" or lower "kee."

Other Physical Features: endothermic ; bilateral symmetry

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Size

Length: 25 cm

Weight: 222 grams

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Diagnostic Description

Resembles Kittlitz's Murrelet but summer plumage lacks buff speckling on upperparts and lacks white-tipped secondaries and white outer tail feathers; also, has a longer bill and, in winter, upperparts are not as gray, nor is the face extensively white (dark around eye instead of white), nor is there a nearly complete breast band. Juvenile diifers from juvenile Kittlitz's Murrelet in having a longer bill and darker face, and by lacking pale outer tail feathers. (NGS 1983, Ridgway 1919).

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Ecology

Habitat

Habitat and Ecology

Habitat and Ecology
It nests in old-growth trees (up to 60 km inland) and on the ground (sparsely where trees are absent, suboptimal) (Piatt and Ford 1993, Ralph 1995, Gaston and Jones 1998, Burger 2002, McShane et al. 2004, Piatt et al. 2006), with the breeding season stretching between March and September in California, April and September in British Columbia, and May and September in Alaska (Piatt et al. 2006). Forest areas with multiple canopy layers and (in southern parts of its range) high mistletoe abundance are strongly preferred. Research in British Columbia shows that in areas where forest habitat is relatively plentiful the species seldom re-use the same trees as nest sites, whereas in areas where logging has reduced old-growth there is a higher proportion of nest tree re-use (Burger et al. 2009). The species has been suggested to tolerate substantial fragmentation (Harrison 2008), however, it has been shown to suffer increased predation and disturbance at forest edges adjacent to recently cleared areas, compared with forest edges adjacent to regenerating or riparian areas (Malt and Lank 2007, 2009). Multiple radar studies have shown a significant correlation between numbers of birds entering watersheds and the areas of suitable forest habitat within those watersheds (Burger 2002, Burger et al. 2004). The species may prefer breeding sites with warmer sea-surface temperatures as annual density and productivity estimates during 1995-2007 have been found to increase with increasing sea surface temperature in the San Juan Archipelago, Washington (Raphael and Bloxton 2008), although a study in Northern California, suggests that reproductive effort may decrease with warmer sea-surface temperatures (Bigger and Chinnici 2008). Breeding is mid-March to early September in California, but more compressed further north (Hamer and Nelson 1995a, 1995b, Gaston and Jones 1998, Burger 2002). The diet is sandlance, herring, other small schooling fish and, in winter, invertebrates (Gaston and Jones 1998, Piatt et al. 2006). Chicks are generally fed large subadult or adult prey rather than juveniles or larvae (Piatt et al. 2006). It feeds in near-shore habitats up to 1.4 km offshore, in sheltered waters, lagoons and sometimes inland lakes (Carter 1986, Hunt 1995, Gaston and Jones 1998, Burger 2002, Hebert and Golightly 2008). Daily movements to feeding areas can be up to 250 km in exceptional cases (Whitworth et al. 2000) but are normally about 30 km (Burger 2002, Piatt et al. 2006). Radio-marked birds from Redwood Creek in North California moved a maximum average distance of 99 km alongshore, with males travelling further than females, and non-breeding males travelling further than breeding males perhaps in search of mates or nesting habitats. Average home range size was 505 km2, again being greater for males than females (Hebert and Golightly 2008). Individuals exhibit plasticity in their foraging behaviour, foraging closer to shore and increasing dive rates during nesting (Peery et al. 2009). Marbled Murrelets most often forage in pairs (Piatt et al. 2006). Individuals in the northern part of its range may travel south during the non-breeding season, a movement which likely reflects the availability of prey (Piatt et al. 2006).


Systems
  • Terrestrial
  • Freshwater
  • Marine
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Depth range based on 2385 specimens in 1 taxon.
Water temperature and chemistry ranges based on 17 samples.

Environmental ranges
  Depth range (m): 0 - 0
  Temperature range (°C): 12.397 - 15.174
  Nitrate (umol/L): 0.604 - 3.951
  Salinity (PPS): 30.822 - 33.311
  Oxygen (ml/l): 5.858 - 6.393
  Phosphate (umol/l): 0.407 - 0.674
  Silicate (umol/l): 2.773 - 11.312

Graphical representation

Temperature range (°C): 12.397 - 15.174

Nitrate (umol/L): 0.604 - 3.951

Salinity (PPS): 30.822 - 33.311

Oxygen (ml/l): 5.858 - 6.393

Phosphate (umol/l): 0.407 - 0.674

Silicate (umol/l): 2.773 - 11.312
 
Note: this information has not been validated. Check this *note*. Your feedback is most welcome.
All rights reserved

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

The general habitat of the Marbled Murrelet is near coastal waters, tide-rips, bays, and mountains. Nesting sites are in higher elevations, exclusively in old growth forests of 175-600 years in age (barring a few ground nests on Alaskan Islands). Nest sites are large, moss covered, horizontal branches with an average height of 45 meters. The sites are often a substantial distance from the coast (Peterson, 1961; Carter and Morrison, 1992; Singer, 1990).

Terrestrial Biomes: forest

Aquatic Biomes: coastal

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Comments: Coastal areas, mainly in salt water within 2 km of shore (Marshall 1988), including bays and sounds; not uncommon up to 5 km offshore; occasionally also on rivers and lakes usually within 20 km of ocean (but up to 75 km), especially during breeding season (Carter and Sealy 1986). In Alaska, marine habitats mostly are offshore of large tracts of old-growth coastal coniferous forest, especially Sitka spruce and hemlock (Piatt and Ford 1993).

In central California, visited old-growth forest nesting areas (8-9 km from ocean) year-round; fall and winter visitation of nesting areas occurs regularly in other areas of North America as well; perhaps attendance in nonbreeding season is important in maintenance of pair bonds and nest sites (Naslund 1993). Nests often are in mature/old growth coniferous forest near the coast: on large mossy horizontal branch, mistletoe infection, witches broom, or other structure providing a platform high in mature conifer (e.g., Douglas-fir, mountain hemlock). Most nesting occurs in large stands of old growth. Nest sites generally have good overhead protection. See Quinlan and Hughes (1990), Singer et al. (1991), and USFWS (1996) for characteristics of tree nests.

In California, most inland activity takes place in or to the west of old-growth stands of 250 ha or more (Paton and Ralph 1990).

On the Queen Charlotte Islands, British Columbia, most inland activity (May-July) was in old growth forest, especially stands of large Sitka spruce and western hemlock (Rodway et al. 1993). Nesting or probable nesting has been recorded up to 47 km and 61 km inland in Oregon (Levy 1993), up to 84 km inland in Washington, and up to 56 km inland in California (USFWS 1994). On the British Columbia coast, nesting birds flew 12-102 kilometers (mean 39 kilometers) inland from foraging sites on the water (Hull et al. 2001).

In Alaska, a few percent of the population nests on islands on open barren ground or in a rock cavity, generally a short distance below a peak or ridge (Day et al. 1983, Carter and Sealy 1986, Marshall 1988, Kuletz 1990, Carter and Morrison 1992). Ford and Brown (1995) reported a clifftop nest in old-growth forest in southeastern Alaska.

Silent individuals flying below the forest canopy indicate nesting in the immediate area (Levy 1993).

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Preferred Habitat

More info for the term: tree

Marbled murrelets are coastal birds that occur mainly near saltwater
within 1.2 miles (2 km) of shore [16]. However, marbled murrelets have
been found up to 59 miles (80 km) inland in Washington, 35 miles (56 km)
inland in Oregon, 22 miles (37 km) inland in northern California, and 11
miles (18 km) inland in central California. Over 90 percent of all
marbled murrelet observations in the northern Washington Cascades were
within 37 miles (60 km) of the coast. In Oregon, marbled murrelets are
observed most often within 12 miles (20 km) of the ocean [4]. Many
marbled murrelets regularly visit coastal lakes. Most lakes used by
marbled murrelets are within 12 miles (20 km) of the ocean, but a few
birds have been found at lakes as far inland as 47 miles (75 km). All
lakes used by marbled murrelets occur within potential nesting habitat
[8].

Nesting habitat - From southeast Alaska southward, marbled murrelets use
mature or old-growth forest stands near the coastline for nesting
[4,7,16,27]. These forests are generally characterized by large trees
(>32 inches [80 cm] d.b.h.), a multistoried canopy, moderate to high
canopy closure or an open crown canopy [17,26], large snags, and
numerous downed snags in all stages of decay [4]. Marbled murrelets
tend to nest in the oldest trees in the stand [4]. In Oregon, forests
begin to exhibit old-growth characteristics at about 175 to 250 years of
age [17]. Moss, on which marbled murrelets nest, forms on the limbs of
Douglas-fir that are more than 150 years old [16,17].

The only four marbled murrelet tree nests found before 1990 shared the
following characteristics: (1) located in a large tree (>47 inches [120
cm] d.b.h.) with an open crown structure, (2) on a moss-covered limb
that is camouflaged, partially shaded, and approximately horizontal with
a diameter (including associated moss) of at least 14 inches (36 cm),
and (3) located within the middle or lower part of a live crown [26].
However, Marshall [29] stated that because of their low aerial bouyancy
marbled murrelets often nest high in the treetops or on steep slopes.
Habitat must be sufficiently open to allow for easy flight [17]. All
marbled murrelet nests found in Washington, Oregon, and California were
located in old-growth trees that ranged from 38 inches (88 cm) d.b.h. to
210 inches (533 cm) d.b.h. with a mean of 80 inches (203 cm) d.b.h.
Nests were located high above the ground and had good overhead
protection but allowed easy access to the exterior forest [4]. Marbled
murrelets may use the same nest in successive years [17,29].

Stand size is also important in nest sites. Marbled murrelets more
commonly occupy stands greater than 500 acres (202 ha) than stands less
than 100 acres (40 ha). However, marbled murrelets may nest in remnant
old-growth trees or groves that are surrounded by younger trees [17].
In California, marbled murrelets are usually absent from stands less
than 60 acres (24 ha) in size. In Washington, marbled murrelets are
found more often when old-growth and mature forests make up over 30
percent of the landscape. Fewer marbled murrelets are found when
clearcut and meadow areas make up more than 25 percent of the landscape.
Concentrations of marbled murrelets offshore are almost always adjacent
to old-growth or mature forests onshore [4,16], although marbled
murrelets may not use the interior of dense stands [29].

Where large trees are absent in the northern parts of marbled murrelet
range, marbled murrelets nest in depressions on the ground, in rock
cavities on the ground, or on rock outcrops [9,13,25,26]. Marbled
murrelets are both ground nesters and tree nesters where forests and
treeless areas meet [16].

Foraging habitat - Marbled murrelets forage in the ocean near shore and
in inland saltwater areas such as bays, sounds, and saltwater
passageways. Some also forage on inland freshwater lakes [17]. Flocks
of 50 or more birds have been observed near freshwater lakes [8].
Subadults occur at sea throughout the summer. Sealy [30] determined
that marbled murrelets feed within 1,640 feet (500 m) of shore.

Winter habitat - Marbled murrelet winter habitat is the same as the
nesting and foraging habitat. During the winter marbled murrelets use
inland old-growth or mature sites for roosting, courtship, and
investigating nest sites [17,18]. The use of inland lakes during the
nonbreeding season occurs in conjunction with visits to nesting areas
[8].

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Associated Plant Communities

More info for the term: tundra

In northern regions where coniferous forests nest sites are unavailable,
marbled murrelets occupy alpine or tundra near the ocean [16]. In
Washington and Oregon, marbled murrelets commonly nest in Douglas-fir
(Pseudotsuga menziesii) dominated stands. They also select stands
dominated by mountain hemlock (Tsuga mertensiana), western redcedar
(Thuja plicata), and Sitka spruce (Picea sitchensis) for nesting [4,16].
In California, nests are most often located in redwood (Sequoia
sempervirens) dominated stands with scattered Sitka spruce, western
hemlock (Tsuga heterophylla) and Douglas-fir. Marbled murrelets also
occur in stands dominated by Port-Orford-cedar (Chamaecyparis
lawsoniana) [19,22].

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Habitat: Ecosystem

More info on this topic.

This species is known to occur in the following ecosystem types (as named by the U.S. Forest Service in their Forest and Range Ecosystem [FRES] Type classification):

FRES20 Douglas-fir
FRES23 Fir-spruce
FRES24 Hemlock-Sitka spruce
FRES27 Redwood

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Habitat: Cover Types

More info on this topic.

This species is known to occur in association with the following cover types (as classified by the Society of American Foresters):

205 Mountain hemlock
223 Sitka spruce
224 Western hemlock
225 Western hemlock - Sitka spruce
226 Coastal true fir - hemlock
227 Western redcedar - western hemlock
228 Western redcedar
229 Pacific Douglas-fir
230 Douglas-fir - western hemlock
231 Port-Orford-cedar
232 Redwood
234 Douglas-fir - tanoak - Pacific madrone

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Habitat: Plant Associations

More info on this topic.

This species is known to occur in association with the following plant community types (as classified by Küchler 1964):

K001 Spruce - cedar - hemlock forest
K002 Cedar - hemlock - Douglas-fir forest
K003 Silver fir - Douglas-fir forest
K004 Fir - hemlock forest
K006 Redwood forest

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Depth range based on 2385 specimens in 1 taxon.
Water temperature and chemistry ranges based on 17 samples.

Environmental ranges
  Depth range (m): 0 - 0
  Temperature range (°C): 12.397 - 15.174
  Nitrate (umol/L): 0.604 - 3.951
  Salinity (PPS): 30.822 - 33.311
  Oxygen (ml/l): 5.858 - 6.393
  Phosphate (umol/l): 0.407 - 0.674
  Silicate (umol/l): 2.773 - 11.312

Graphical representation

Temperature range (°C): 12.397 - 15.174

Nitrate (umol/L): 0.604 - 3.951

Salinity (PPS): 30.822 - 33.311

Oxygen (ml/l): 5.858 - 6.393

Phosphate (umol/l): 0.407 - 0.674

Silicate (umol/l): 2.773 - 11.312
 
Note: this information has not been validated. Check this *note*. Your feedback is most welcome.

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Found near coastal waters, in bays and on mountains. It nests at high elevations in old growth forest, often at great distances from the coast (3). This species can be found up to 500 meters offshore (2).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Migration

Non-Migrant: Yes. At least some populations of this species do not make significant seasonal migrations. Juvenile dispersal is not considered a migration.

Locally Migrant: Yes. At least some populations of this species make local extended movements (generally less than 200 km) at particular times of the year (e.g., to breeding or wintering grounds, to hibernation sites).

Locally Migrant: No. No populations of this species make annual migrations of over 200 km.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Trophic Strategy

An adult murrelet was observed carrying a fish, presumably for a hatchling. Murrelets eat primarily fish, including Pacific sandlance, Pacific herring, and seaperch. They forage for food solitarily or in pairs, sometimes amongst mixed species feeding flocks (Carter and Morrison, 1992).

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Comments: Diet includes fishes (sandlance, capelin, herring, etc.), crustaceans (mysids, euphausiids), mollusks. In British Columbia, adult diet during the breeding season is mostly fishes, primarily Pacific Sandlance and Pacific Herring; euphausiids are important in spring at Langara Island; sandlance are the prey most frequently fed to nestlings (Rodway et al., in Carter and Morrison 1992). May feed exclusively on freshwater prey for period of several weeks in some areas; feeds on fingerling Sockeye Salmon and salmon fry in some British Columbia lakes (Carter and Sealy 1986). Foraging occurs mainly in waters up to 80 m deep and up to 2 km from shore. Foraging dives may be up to about 30 m below surface.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Food Habits

Marbled murrelets feed below the water surface on small fish and
invertebrates [16,17]. Some principal foods include sand lance
(Ammodytes hexapterus), Pacific herring (Clupea haringus), capelin
(Mallotus villosus), and the invertebrates Euphausia pacifica and
Thysanoessa spinifera [16,17,23].

Marbled murrelets do not feed in large flocks as do other alcids,
although loose aggregations occur in winter. While feeding during the
breeding season marbled murrelets occur in pairs or as single
individuals. Subadults feed singly; but in early July, when pairs of
adults are still feeding young, mixed flocks begin to form [16].
Marbled murrelets feed during the day and at night [17].

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Associations

Predators

Steller's jays (Cyanocitta stelleri) and common ravens (Corvus corax)
prey on marbled murrelet eggs and nestlings [26].

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Population Biology

Number of Occurrences

Note: For many non-migratory species, occurrences are roughly equivalent to populations.

Estimated Number of Occurrences: Unknown

Comments: Total number of occurrences has not been determined using standardized criteria. Determination of the number of occurrences would be necessarily arbitrary and not particularly informative with regard to the conservation status of this species.

Specific nesting and foraging areas are still being described (Simons 1980; Day et al. 1983; Marshall 1988; Carter and Sealy 1987; Quinlan and Hughes 1990; Singer et al. 1991; Ralph et al. 1995).

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Global Abundance

100,000 - 1,000,000 individuals

Comments: Total population size is about 388,000, with about 18,000 in Washington-Oregon-California, 54,000-92,000 in British Columbia, and around 271,000 in Alaska (Carter and Morrison 1992, Speich et al. 1992, Speich and Wahl 1995, Varoujean and Williams 1995, Ralph et al. 1995, McShane et al. 2004, Piatt et al. 2007, Falxa et al. 2009, COSEWIC 2012).

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

General Ecology

Solitary, or in pairs, small groups, or loose aggregations. In most areas, generally does not flock with other birds, but may participate in mixed-species feeding flocks in the absence of interference from larger diving birds (Mahon et al. 1992).

The only confirmed record of predation on an adult at its nest involved a Sharp-shinned Hawk in Alaskan old-growth forest (Marks and Naslund 1994).

Species has high fidelity to nesting areas and nest trees (see Nelson 1997).

Despite the urgent need for an assessment of the demographic state of populations, the species is so secretive that reliable estimates of the required vital rates are rare. Survival estimates obtained through capture-recapture data from a population in British Columbia were 0.8289 and 0.9289, based on different samples corresponding to two capture techniques. The study area had been and continues to be heavily logged (Cam et al. 2003).

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Habitat-related Fire Effects

More info for the term: mesic

Because marbled murrelets depend on mature or old-growth stands for
nesting and roosting, fires that destroy or reduce the size of these
stands will probably have an adverse effect on marbled murrelet
populations. However, marbled murrelets sometimes nest in unlogged
mature or large sawtimber stands burned 80 to 200 years ago where open
crown canopies or steep slopes exist to provide access to and from large
limbs [16].

Marbled murrelets nest in habitat types characterized by long fire free
intervals. Sitka spruce stands in western Washington typically have a
fire free interval of 1,146 years or more. Along the northern and
southern Oregon coast, Sitka spruce has a fire free interval of 200 to
400 years. Fires that do occur in Sitka spruce are usually stand
replacing. Western hemlock forests along the coast have a fire free
interval of about 750 years [31]. Coastal redwood is tolerant of
low-severity fires which appear to have occurred on mesic sites at
200-to 500-year intervals before the arrival of European settlers
[15,31].

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Timing of Major Life History Events

Age at sexual maturity - Marbled murrelets do not breed until they are
at least 2 years old [16].

Nesting and brooding - Marbled murrelets nest from mid-April to late
September [16]. Peak activity occurs from mid-June to late July in
California, and the second week of July to mid-August in Oregon [17].
Marbled murrelet are semicolonial in nesting habits. Two nests found in
Washington were located only 150 feet (46 m) apart. Not all mature
adults nest every year [4]. Marbled murrelets lay only one egg. The
egg is incubated by both parents for about 30 days. Adults fly from
ocean feeding areas to inland nest sites, mostly at dusk and dawn. They
feed nestlings at least once and sometimes twice per day or night.
Usually only one fish is carried to the young [4,16].

Fledging - Nestlings fledge in 28 days. Young marbled murrelets remain
in the nest longer than other alcids and molt into their juvenile
plumage before leaving the nest [16]. Fledglings fly directly from the
nest to the ocean [4].

Migration - Some marbled murrelet populations probably migrate south in
fall and north in spring. However, these migration patterns are not
well understood [7].

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Life History and Behavior

Behavior

Perception Channels: visual ; tactile ; acoustic ; chemical

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Cyclicity

Comments: Young are fed at night or around dusk or dawn. Feeding has been observed at night (Carter and Sealy 1986). At Redwood Experimental Forest, northwestern California, activity levels were greatest 30 minutes before to 30 minutes after sunrise in May, June, and July (Paton et al., in Carter and Morrison 1992). In old growth forest in the Queen Charlotte Islands, British Columbia, number of detections peaked in late July; detections were most likely to occur on cloudy mornings (Rodway et al. 1993).

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Life Expectancy

Average lifespan

Status: wild:
120 months.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Lifespan, longevity, and ageing

Maximum longevity: 7.2 years (wild)
Creative Commons Attribution 3.0 (CC BY 3.0)

© Joao Pedro de Magalhaes

Source: AnAge

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Reproduction

The Marbled Murrelet breeds on mountains near the coast. Breeding season is from mid-April to the end of August. Females have been collected with shelled eggs in their oviducts from April 23 to July 13. The murrelet has single egg clutches. Murrelets may not fledge young until mid-September, based on a 30-day incubation and a 28-day rearing period. Nesting sites are almost exclusively in old-growth forests, yet some have been found in cavities in subalpine areas, and on the ground on islands. Murrelet eggs are yellowish and spotted. The first known nest was found in a rock slide far above the timber line at 1900 ft. on Chicago Island, Alaska, on June 13, 1931. (Peterson,1961; Carter and Morrison, 1992).

Key Reproductive Features: iteroparous ; gonochoric/gonochoristic/dioecious (sexes separate); sexual ; oviparous

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Nesting season: late March to late September; downy young, and fledged juveniles have been observed June-September. Activity in forest nesting areas is highest from mid-April through late July in California and Oregon, early May through early August in Washington, and mid-May through early August in Alaska (see Levy 1993). Clutch size is 1. Incubation lasts about 30 days, by both sexes alternately in 24-hr shifts. Nestling is visited and fed by parent 2-4 times each day, fledges in 27-40 days (Marshall 1988, Levy 1993). Appears to nest semicolonially (see USFWS 1994). In a study on the British Columbia coast, foraging distance from nest (i.e. energy spent commuting) had no influence on nesting success (Hull et al. 2001). Generation time is around 10 years (COSEWIC 2012).

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Barcode data: Brachyramphus marmoratus

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There are 6 barcode sequences available from BOLD and GenBank.

Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.

See the BOLD taxonomy browser for more complete information about this specimen and other sequences.

AACCAACCACAAAGACATTGGCACCCTATACTTAATCTTTGGCGCATGAGCCGGTATAGTCGGNACTGCCCTAAGTCTTCTCATCCGTGCAGAACTGGGCCAGCCAGGAACTCTCCTAGGAGATGACCAAATCTACAATGTAATCGTCACCGCCCACGCCTTCGTAATAATCTTCTTCATAGTAATACCAATCATAATCGGTGGCTTCGGAAACTGACTAGTCCCACTTATAATCGGCGCCCCCGACATAGCATTTCCCCGCATAAACAACATAAGCTTCTGACTACTACCCCCATCATTTCTACTCCTTCTAGCCTCTTCCACAGTCGAAGCTGGAGTTGGTACAGGTTGAACTGTATACCCTCCCCTAGCTGGTAACCTAGCCCATGCTGGAGCTTCAGTGGACCTAGCAATCTTCTCACTCCACCTAGCAGGTGTGTCCTCTATCTTAGGCGCTATCAACTTCATCACAACTGCTATCAACATAAAACCCCCAGCCCTATCACAATACCAAACTCCCTTATTCGTGTGATCAGTACTCATCACTGCCGTCCTACTACTTCTCTCACTTCCCGTGCTCGCTGCTGGCATCACTATACTACTAACAGACCGAAACCTAAACACAACATTCTTTGATCCAGCCGGAGGCGGAGACCCAGTACTATACCAGCACCTTTTCTGATTCTTCGGTCACCCAGAAGTGTACATCCTAATTCTACCAGGCTTCGGCATTATCTCCCACGTTGTAACATACTACGCAGGAAAAAAAGAACCATTCGGTTACATAGGAATAGTATGAGCTATACTATCCATTGGTTTCCTGGGCTTCATCGTATGGGCACATCACATATTCACCGTAGGRATAGACGTAGACACTCGAGCCTACTTTACATCCGCCACTATAATCATTGCTATTCCTACCGGTATTAAAGTATTTAGCTGACTAGCCACACTCCATGGAGGCACCATCAAATGAGACCCACCAATACTATGAGCCTTGGGCTTTATCTTCCTATTCACTATCGGAGGCCTAACAGGTATCGTTCTAGCAAACTCTTCGCTGGACATTGCTCTACACGACACATATTACGTAGTTGCCCACTTC
-- end --

Download FASTA File

Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Statistics of barcoding coverage: Brachyramphus marmoratus

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 6
Specimens with Barcodes: 11
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Conservation

Conservation Status

IUCN Red List Assessment


Red List Category
EN
Endangered

Red List Criteria
A2bc+3bc+4bc

Version
3.1

Year Assessed
2012

Assessor/s
BirdLife International

Reviewer/s
Butchart, S. & Symes, A.

Contributor/s
Bertram, D., Burger, A.E., Kuletz, K. & Piatt, J.

Justification
This species is still abundant, but it is treated as Endangered because its population is estimated to have undergone a very rapid reduction, which is expected to continue, owing to a variety of threats.


History
  • Endangered (EN)
  • Endangered (EN)
  • Endangered (EN)
  • Endangered (EN)
  • Vulnerable (VU)
  • Not Recognized (NR)
  • Not Recognized (NR)