Articles on this page are available in 1 other language: Chinese (Simplified) (4) (learn more)

Overview

Brief Summary

Biology

The marbled murrelet feeds on fish such as sandlace and herring but feeds on invertebrates during winter (2). They forage singly, in pairs or in feeding flocks of a mix of different species (3). In California, breeding occurs from mid-March to early September, but the season is shorter further north (2). The nest is built on large branches in high elevation forests or on the ground on some islands. Incubation of the yellowish spotted eggs takes around 30 days and the young chicks fledge after a further 28 days (3).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Description

The marbled murrelet is a small, chubby seabird that has a very short neck (3). During the breeding season it has dark brown to blackish upperparts and a white belly and throat that are greatly mottled. During the winter the upperparts become grey, dark marks form on the sides of the breast and a white ring develops around the eye (2). Males and females are similar in appearance and size (4) (3). Juveniles are similar to the adult winter plumage, but with dusky mottling on the underparts (2). Vocalisations include a sharp 'keer' or low 'kee' (3).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Distribution

Marbled murrelets occur in summer from Alaska's Kenai Peninsula, Barren
islands, and Aleutian islands south along the coast of North America to
Point Sal, Santa Barbara County, in south-central California [3,16].
Marbled murrelets winter mostly within the same general area, except
that they tend to vacate the most northern sections of their range and
have been recorded as far south as Imperial Beach of San Diego County,
California [16].
  • 3. American Ornithologists' Union. 1983. Checklist of North American birds. 6th ed. Lawrence, KS: Allen Press, Inc. 877 p. [21234]
  • 16. Marshall, David B. 1988. Status of the marbled murrelet in North America: with special emphasis on populations in California, Oregon, and Washington. Biological Report 88(30). Washington, DC: U.S. Department of the Interior, Fish and Wildlife Service. 19 p. [23180]

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Regional Distribution in the Western United States

More info on this topic.

This species can be found in the following regions of the western United States (according to the Bureau of Land Management classification of Physiographic Regions of the western United States):

1 Northern Pacific Border
2 Cascade Mountains
3 Southern Pacific Border

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Occurrence in North America

AK CA OR WA BC

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Range

W Aleutian Islands and Alaska to central California.
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

 

Partner Web Site: Cornell Laboratory of Ornithology

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Range Description

Brachyramphus marmoratus occurs in the USA and Canada in California, Oregon, Washington, British Columbia, south-east Alaska, Prince William Sound, Kenai Peninsula, Lower Cook Inlet, Barren Islands, Afognak and Kodiak Islands, the Alaska Peninsula and the Aleutians locally to Andreanof and Near Islands6. In Alaska (85% of the population), historical estimates place the population at c. 750,000 individuals, though when trend estimates are applied to this figure it gives an estimated 2006 population of c. 270,000 individuals29. The British Columbia population is thought to be in the region of c. 54,000 - 92,500. The greatest historical decreases have been in Washington, Oregon and California, but populations in British Columbia and south-east Alaska are now most threatened13. The current annual decline in Washington, Oregon and California is 4-7%21, with a c. 70% decrease in Alaska from 1985-201029, and 40% in parts of British Columbia in 1982-199210..
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Geographic Range

Shoreline regions of the north Pacific Ocean: Western - Japan to Kamchatka, Russia, Eastern- central California to southern Alaska.

Biogeographic Regions: nearctic (Native ); palearctic (Native ); pacific ocean (Native )

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

occurs (regularly, as a native taxon) in multiple nations

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

National Distribution

Canada

Origin: Native

Regularity: Regularly occurring

Currently: Present

Confidence: Confident

Type of Residency: Year-round

United States

Origin: Native

Regularity: Regularly occurring

Currently: Present

Confidence: Confident

Type of Residency: Year-round

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Global Range: (200,000-2,500,000 square km (about 80,000-1,000,000 square miles)) Breeding range extends from the western Aleutian Islands through coastal southern and southeastern Alaska, British Columbia (up to 100 kilometers inland), Washington, Oregon, and northern central California (mainly Del Norte and northern Humboldt counties to 15 km inland, southcentral Humboldt County 20-40 km inland, and southern San Mateo and northern Santa Cruz counties up to 20 km inland; Carter and Erickson in Carter and Morrison 1992); few occupied sites are known between Tillamook County in Oregon and the Olympic Peninsula in Washington (USFWS 1994). See USFWS (1994) and Federal Register (10 August 1995) for maps of proposed Critical Habitat in California, Oregon, and Washington. During the nonbreeding season, the range extends from southern Alaska south to central California, mostly adjacent to known or suspected nesting areas. Most of the Alaskan population is concentrated offshore of large tracts of coastal coniferous forests in southeastern Alaska (Alexander Archipelago), Prince William Sound, and the Kodiak Archipelago (Piatt and Ford 1993). See Marshall (1988), Carter and Morrison (1992), and Piatt et al. (2007) for further details for specific states and provinces.

Coded range extent pertains to breeding range.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Historic Range:
U.S.A. (AK, CA, OR, WA), Canada (B.C.)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Range

Found along the western coast of the USA and Canada in California, Washington, Oregon, British Columbia, Alaska, Prince William Sound, Kenai Peninsula, Lower Cook Inlet, Barren Islands, Afognak and Kodiak Islands, the Alaska Peninsula and the Aleutians (2). Historically, the decline of this species has been most severe in Washington, Oregon and California; at present, however, the worst losses are occurring in British Columbia and Alaska (2).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Physical Description

Morphology

Physical Description

The Marbled Murrelet is a very small, chubby, sea bird that seems to lack a neck. It has a dark brown to black dorsum and a white venter and throat. The nonbreeding plumage includes a strip of white between the back and the wing, thus the name "marbled". The breeding plumage is dark brown dorsally; ventral feathers are white tipped with brown. Males and females are of approximately the same size, 9.5-10" wingspan. Bill length is 13-18 mm; wing length (relaxed) is 120-140mm. The voice of the Marbled Murrelet is a sharp "keer" or lower "kee."

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Size

Length: 25 cm

Weight: 222 grams

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Diagnostic Description

Resembles Kittlitz's Murrelet but summer plumage lacks buff speckling on upperparts and lacks white-tipped secondaries and white outer tail feathers; also, has a longer bill and, in winter, upperparts are not as gray, nor is the face extensively white (dark around eye instead of white), nor is there a nearly complete breast band. Juvenile diifers from juvenile Kittlitz's Murrelet in having a longer bill and darker face, and by lacking pale outer tail feathers. (NGS 1983, Ridgway 1919).

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Ecology

Habitat

Preferred Habitat

More info for the term: tree

Marbled murrelets are coastal birds that occur mainly near saltwater
within 1.2 miles (2 km) of shore [16]. However, marbled murrelets have
been found up to 59 miles (80 km) inland in Washington, 35 miles (56 km)
inland in Oregon, 22 miles (37 km) inland in northern California, and 11
miles (18 km) inland in central California. Over 90 percent of all
marbled murrelet observations in the northern Washington Cascades were
within 37 miles (60 km) of the coast. In Oregon, marbled murrelets are
observed most often within 12 miles (20 km) of the ocean [4]. Many
marbled murrelets regularly visit coastal lakes. Most lakes used by
marbled murrelets are within 12 miles (20 km) of the ocean, but a few
birds have been found at lakes as far inland as 47 miles (75 km). All
lakes used by marbled murrelets occur within potential nesting habitat
[8].

Nesting habitat - From southeast Alaska southward, marbled murrelets use
mature or old-growth forest stands near the coastline for nesting
[4,7,16,27]. These forests are generally characterized by large trees
(>32 inches [80 cm] d.b.h.), a multistoried canopy, moderate to high
canopy closure or an open crown canopy [17,26], large snags, and
numerous downed snags in all stages of decay [4]. Marbled murrelets
tend to nest in the oldest trees in the stand [4]. In Oregon, forests
begin to exhibit old-growth characteristics at about 175 to 250 years of
age [17]. Moss, on which marbled murrelets nest, forms on the limbs of
Douglas-fir that are more than 150 years old [16,17].

The only four marbled murrelet tree nests found before 1990 shared the
following characteristics: (1) located in a large tree (>47 inches [120
cm] d.b.h.) with an open crown structure, (2) on a moss-covered limb
that is camouflaged, partially shaded, and approximately horizontal with
a diameter (including associated moss) of at least 14 inches (36 cm),
and (3) located within the middle or lower part of a live crown [26].
However, Marshall [29] stated that because of their low aerial bouyancy
marbled murrelets often nest high in the treetops or on steep slopes.
Habitat must be sufficiently open to allow for easy flight [17]. All
marbled murrelet nests found in Washington, Oregon, and California were
located in old-growth trees that ranged from 38 inches (88 cm) d.b.h. to
210 inches (533 cm) d.b.h. with a mean of 80 inches (203 cm) d.b.h.
Nests were located high above the ground and had good overhead
protection but allowed easy access to the exterior forest [4]. Marbled
murrelets may use the same nest in successive years [17,29].

Stand size is also important in nest sites. Marbled murrelets more
commonly occupy stands greater than 500 acres (202 ha) than stands less
than 100 acres (40 ha). However, marbled murrelets may nest in remnant
old-growth trees or groves that are surrounded by younger trees [17].
In California, marbled murrelets are usually absent from stands less
than 60 acres (24 ha) in size. In Washington, marbled murrelets are
found more often when old-growth and mature forests make up over 30
percent of the landscape. Fewer marbled murrelets are found when
clearcut and meadow areas make up more than 25 percent of the landscape.
Concentrations of marbled murrelets offshore are almost always adjacent
to old-growth or mature forests onshore [4,16], although marbled
murrelets may not use the interior of dense stands [29].

Where large trees are absent in the northern parts of marbled murrelet
range, marbled murrelets nest in depressions on the ground, in rock
cavities on the ground, or on rock outcrops [9,13,25,26]. Marbled
murrelets are both ground nesters and tree nesters where forests and
treeless areas meet [16].

Foraging habitat - Marbled murrelets forage in the ocean near shore and
in inland saltwater areas such as bays, sounds, and saltwater
passageways. Some also forage on inland freshwater lakes [17]. Flocks
of 50 or more birds have been observed near freshwater lakes [8].
Subadults occur at sea throughout the summer. Sealy [30] determined
that marbled murrelets feed within 1,640 feet (500 m) of shore.

Winter habitat - Marbled murrelet winter habitat is the same as the
nesting and foraging habitat. During the winter marbled murrelets use
inland old-growth or mature sites for roosting, courtship, and
investigating nest sites [17,18]. The use of inland lakes during the
nonbreeding season occurs in conjunction with visits to nesting areas
[8].
  • 4. Anon. 1992. Determination of threatened status for the Washington, Oregon, and California population of the marbled murrelet. Oregon Birds. 18(4): 120-121. [21468]
  • 7. Campbell, R. Wayne; Dawe, Neil K.; McTaggart-Cowan, Ian; [and others]
  • 8. Carter, Harry R.; Sealy, Spencer G. 1986. Year-round use of coastal lakes by marbled murrelets. Condor. 88: 473-477. [23182]
  • 9. Day, Robert H.; Oakley, Karen L.; Barnard, David R. 1983. Nest sites and eggs of Kittlitz's and marbled murrelets. Condor. 85(3): 265-273. [23644]
  • 13. Johnston, Stuart; Carter, Harry R. 1985. Cavity-nesting marbled murrelets. Wilson Bulletin. 97(1): 1-3. [23183]
  • 16. Marshall, David B. 1988. Status of the marbled murrelet in North America: with special emphasis on populations in California, Oregon, and Washington. Biological Report 88(30). Washington, DC: U.S. Department of the Interior, Fish and Wildlife Service. 19 p. [23180]
  • 17. Marshall, David B. 1989. The marbled murrelet. Audubon Wildlife Report 1989/1990: 435-455. [23187]
  • 18. Nelson, S. Kim. 1991. The marbled murrelet in western Oregon: a summary of current knowledge. In: Ruggiero, Leonard F.; Aubry, Keith B.; Carey, Andrew B.; Huff, Mark H., technical coordinators. Wildlife and vegetation of unmanaged Douglas-fir forests. Gen. Tech. Rep. PNW-GTR-285. Portland, OR: U.S. Department of Agriculture, Forest Service, Pacific Northwest Research Station: 529-530. [Poster paper]
  • 25. Simons, THeodore R. 1980. Discovery of a ground-nesting marbled murrelet. Condor. 82(1): 1-9. [23675]
  • 26. Singer, Steven W.; Naslund, Nancy L.; Singer, Stephanie A.; Ralph, C. John. 1991. Discovery and observations of two tree nests of the marbled murrelet. Condor. 93: 330-339. [20661]
  • 27. Nelson, S. Kim; Hamer, Tom. 1992. Nest-site characteristics of marbled murrelets. Seabird Group Bulletin. 19(1): 52. [Abstract]
  • 29. Marshall, David B. 1988. The marbled murrelet joins the old-growth forest conflict. American Birds. 42(2): 202-212. [23181]
  • 30. Sealy, Spencer G. 1975. Feeding ecology of the ancient and marbled murrelets near Langara Island, British Columbia. Canadian Journal of Zoology. 53: 418-433. [23643]

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Associated Plant Communities

More info for the term: tundra

In northern regions where coniferous forests nest sites are unavailable,
marbled murrelets occupy alpine or tundra near the ocean [16]. In
Washington and Oregon, marbled murrelets commonly nest in Douglas-fir
(Pseudotsuga menziesii) dominated stands. They also select stands
dominated by mountain hemlock (Tsuga mertensiana), western redcedar
(Thuja plicata), and Sitka spruce (Picea sitchensis) for nesting [4,16].
In California, nests are most often located in redwood (Sequoia
sempervirens) dominated stands with scattered Sitka spruce, western
hemlock (Tsuga heterophylla) and Douglas-fir. Marbled murrelets also
occur in stands dominated by Port-Orford-cedar (Chamaecyparis
lawsoniana) [19,22].
  • 4. Anon. 1992. Determination of threatened status for the Washington, Oregon, and California population of the marbled murrelet. Oregon Birds. 18(4): 120-121. [21468]
  • 16. Marshall, David B. 1988. Status of the marbled murrelet in North America: with special emphasis on populations in California, Oregon, and Washington. Biological Report 88(30). Washington, DC: U.S. Department of the Interior, Fish and Wildlife Service. 19 p. [23180]
  • 19. Paton, Peter W. C.; Ralph, C. John. 1990. Distribution of the marbled murrelet at inland sites in California. Northwestern Naturalist. 71(3): 72-84. [23188]
  • 22. Ralph, C. John; Paton, Peter W. C.; Zakis, Aivars; Strachan, Gary. 1990. Breeding distribution of the marbled murrelet in Redwood National Park and vicinity during 1988. In: Van Riper, Charles, III; Stohlgren, Thomas J.; Veirs, Stephen D., Jr.; Hillyer, Silvia Castillo, eds. Examples of resource inventory and monitoring inNational Parks of California: Proceedings, 3rd biennial conference on research in California's National Parks; 1988 September 13-15; Davis, CA: Transactions and Proceedings Series No. 8. Washington, DC: U.S. Department of the Interior, National Park Service: 57-70. [15196]

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Habitat: Ecosystem

More info on this topic.

This species is known to occur in the following ecosystem types (as named by the U.S. Forest Service in their Forest and Range Ecosystem [FRES] Type classification):

FRES20 Douglas-fir
FRES23 Fir-spruce
FRES24 Hemlock-Sitka spruce
FRES27 Redwood

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Habitat: Cover Types

More info on this topic.

This species is known to occur in association with the following cover types (as classified by the Society of American Foresters):

205 Mountain hemlock
223 Sitka spruce
224 Western hemlock
225 Western hemlock - Sitka spruce
226 Coastal true fir - hemlock
227 Western redcedar - western hemlock
228 Western redcedar
229 Pacific Douglas-fir
230 Douglas-fir - western hemlock
231 Port-Orford-cedar
232 Redwood
234 Douglas-fir - tanoak - Pacific madrone

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Habitat: Plant Associations

More info on this topic.

This species is known to occur in association with the following plant community types (as classified by Küchler 1964):

K001 Spruce - cedar - hemlock forest
K002 Cedar - hemlock - Douglas-fir forest
K003 Silver fir - Douglas-fir forest
K004 Fir - hemlock forest
K006 Redwood forest

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Habitat and Ecology

Habitat and Ecology
It nests in old-growth trees (up to 60 km inland) and on the ground (sparsely where trees are absent, suboptimal)6,11,14,16,19, with the breeding season stretching between March and September in California, and May and September in Alaska29. Forest areas with multiple canopy layers and high mistletoe abundance are strongly preferred22. Breeding is mid-March to early September in California, but more compressed further north6,7,8. The diet is sandlance, herring and, in winter, invertebrates6. Chicks are generally fed large subadult or adult prey rather than juveniles or larvae29. It feeds in near-shore habitats up to 1.4 km offshore, in sheltered waters, lagoons and sometimes inland lakes3,4,6,9,27. Daily movements to feeding areas can be up to 250 km20. Radio-marked birds from Redwood Creek in North California moved a maximum average distance of 99 km alongshore, with males travelling further than females, and non-breeding males travelling further than breeding males perhaps in search of mates or nesting habitats. Average home range size was 505 km2, again being greater for males than females27. Individuals exhibit plasticity in their foraging behavior, foraging closer to shore and increasing dive rates during nesting28. Marbled Murrelets most often forage in pairs29. Individuals in the northern part of its range may travel south during the non-breeding season, a movement which likely reflects the availability of prey29.

Systems
  • Terrestrial
  • Freshwater
  • Marine
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

The general habitat of the Marbled Murrelet is near coastal waters, tide-rips, bays, and mountains. Nesting sites are in higher elevations, exclusively in old growth forests of 175-600 years in age (barring a few ground nests on Alaskan Islands). Nest sites are large, moss covered, horizontal branches with an average height of 45 meters. The sites are often a substantial distance from the coast (Peterson, 1961; Carter and Morrison, 1992; Singer, 1990).

Terrestrial Biomes: forest

Aquatic Biomes: coastal

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Depth range based on 2385 specimens in 1 taxon.
Water temperature and chemistry ranges based on 17 samples.

Environmental ranges
  Depth range (m): 0 - 0
  Temperature range (°C): 12.397 - 15.174
  Nitrate (umol/L): 0.604 - 3.951
  Salinity (PPS): 30.822 - 33.311
  Oxygen (ml/l): 5.858 - 6.393
  Phosphate (umol/l): 0.407 - 0.674
  Silicate (umol/l): 2.773 - 11.312

Graphical representation

Temperature range (°C): 12.397 - 15.174

Nitrate (umol/L): 0.604 - 3.951

Salinity (PPS): 30.822 - 33.311

Oxygen (ml/l): 5.858 - 6.393

Phosphate (umol/l): 0.407 - 0.674

Silicate (umol/l): 2.773 - 11.312
 
Note: this information has not been validated. Check this *note*. Your feedback is most welcome.
Public Domain

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Comments: Coastal areas, mainly in salt water within 2 km of shore (Marshall 1988), including bays and sounds; not uncommon up to 5 km offshore; occasionally also on rivers and lakes usually within 20 km of ocean (but up to 75 km), especially during breeding season (Carter and Sealy 1986). In Alaska, marine habitats mostly are offshore of large tracts of old-growth coastal coniferous forest, especially Sitka spruce and hemlock (Piatt and Ford 1993).

In central California, visited old-growth forest nesting areas (8-9 km from ocean) year-round; fall and winter visitation of nesting areas occurs regularly in other areas of North America as well; perhaps attendance in nonbreeding season is important in maintenance of pair bonds and nest sites (Naslund 1993). Nests often are in mature/old growth coniferous forest near the coast: on large mossy horizontal branch, mistletoe infection, witches broom, or other structure providing a platform high in mature conifer (e.g., Douglas-fir, mountain hemlock). Most nesting occurs in large stands of old growth. Nest sites generally have good overhead protection. See Quinlan and Hughes (1990), Singer et al. (1991), and USFWS (1996) for characteristics of tree nests.

In California, most inland activity takes place in or to the west of old-growth stands of 250 ha or more (Paton and Ralph 1990).

On the Queen Charlotte Islands, British Columbia, most inland activity (May-July) was in old growth forest, especially stands of large Sitka spruce and western hemlock (Rodway et al. 1993). Nesting or probable nesting has been recorded up to 47 km and 61 km inland in Oregon (Levy 1993), up to 84 km inland in Washington, and up to 56 km inland in California (USFWS 1994). On the British Columbia coast, nesting birds flew 12-102 kilometers (mean 39 kilometers) inland from foraging sites on the water (Hull et al. 2001).

In Alaska, a few percent of the population nests on islands on open barren ground or in a rock cavity, generally a short distance below a peak or ridge (Day et al. 1983, Carter and Sealy 1986, Marshall 1988, Kuletz 1990, Carter and Morrison 1992). Ford and Brown (1995) reported a clifftop nest in old-growth forest in southeastern Alaska.

Silent individuals flying below the forest canopy indicate nesting in the immediate area (Levy 1993).

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Found near coastal waters, in bays and on mountains. It nests at high elevations in old growth forest, often at great distances from the coast (3). This species can be found up to 500 meters offshore (2).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Migration

Non-Migrant: Yes. At least some populations of this species do not make significant seasonal migrations. Juvenile dispersal is not considered a migration.

Locally Migrant: Yes. At least some populations of this species make local extended movements (generally less than 200 km) at particular times of the year (e.g., to breeding or wintering grounds, to hibernation sites).

Locally Migrant: No. No populations of this species make annual migrations of over 200 km.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Trophic Strategy

Food Habits

Marbled murrelets feed below the water surface on small fish and
invertebrates [16,17]. Some principal foods include sand lance
(Ammodytes hexapterus), Pacific herring (Clupea haringus), capelin
(Mallotus villosus), and the invertebrates Euphausia pacifica and
Thysanoessa spinifera [16,17,23].

Marbled murrelets do not feed in large flocks as do other alcids,
although loose aggregations occur in winter. While feeding during the
breeding season marbled murrelets occur in pairs or as single
individuals. Subadults feed singly; but in early July, when pairs of
adults are still feeding young, mixed flocks begin to form [16].
Marbled murrelets feed during the day and at night [17].
  • 16. Marshall, David B. 1988. Status of the marbled murrelet in North America: with special emphasis on populations in California, Oregon, and Washington. Biological Report 88(30). Washington, DC: U.S. Department of the Interior, Fish and Wildlife Service. 19 p. [23180]
  • 17. Marshall, David B. 1989. The marbled murrelet. Audubon Wildlife Report 1989/1990: 435-455. [23187]
  • 23. Sanger, Gerald A. 1987. Winter diets of common murres and marbled murrelets in Kachemak Bay, Alaska. Condor. 89: 426-430. [23642]

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Food Habits

An adult murrelet was observed carrying a fish, presumably for a hatchling. Murrelets eat primarily fish, including Pacific sandlance, Pacific herring, and seaperch. They forage for food solitarily or in pairs, sometimes amongst mixed species feeding flocks (Carter and Morrison, 1992).

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Comments: Diet includes fishes (sandlance, capelin, herring, etc.), crustaceans (mysids, euphausiids), mollusks. In British Columbia, adult diet during the breeding season is mostly fishes, primarily Pacific Sandlance and Pacific Herring; euphausiids are important in spring at Langara Island; sandlance are the prey most frequently fed to nestlings (Rodway et al., in Carter and Morrison 1992). May feed exclusively on freshwater prey for period of several weeks in some areas; feeds on fingerling Sockeye Salmon and salmon fry in some British Columbia lakes (Carter and Sealy 1986). Foraging occurs mainly in waters up to 80 m deep and up to 2 km from shore. Foraging dives may be up to about 30 m below surface.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Associations

Predators

Steller's jays (Cyanocitta stelleri) and common ravens (Corvus corax)
prey on marbled murrelet eggs and nestlings [26].
  • 26. Singer, Steven W.; Naslund, Nancy L.; Singer, Stephanie A.; Ralph, C. John. 1991. Discovery and observations of two tree nests of the marbled murrelet. Condor. 93: 330-339. [20661]

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Population Biology

Number of Occurrences

Note: For many non-migratory species, occurrences are roughly equivalent to populations.

Estimated Number of Occurrences: 81 to >300

Comments: Total number of occurrences has not been determined using standardized criteria, but likely there are well over one hundred. Specific nesting and foraging areas are still being described (Simons 1980; Day et al. 1983; Marshall 1988; Carter and Sealy 1987; Quinlan and Hughes 1990; Singer et al. 1991; Ralph et al. 1995).

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Global Abundance

100,000 - 1,000,000 individuals

Comments: Total adult population size is a few hundred thousand, with a few 10,000s in Washington-Oregon-California, 54,000-92,000 in British Columbia, and around 270,000 in Alaska (Carter and Morrison 1992, Speich et al. 1992, Speich and Wahl 1995, Varoujean and Williams 1995, Ralph et al. 1995, McShane et al. 2004, Piatt et al. 2007).

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

General Ecology

Habitat-related Fire Effects

More info for the term: mesic

Because marbled murrelets depend on mature or old-growth stands for
nesting and roosting, fires that destroy or reduce the size of these
stands will probably have an adverse effect on marbled murrelet
populations. However, marbled murrelets sometimes nest in unlogged
mature or large sawtimber stands burned 80 to 200 years ago where open
crown canopies or steep slopes exist to provide access to and from large
limbs [16].

Marbled murrelets nest in habitat types characterized by long fire free
intervals. Sitka spruce stands in western Washington typically have a
fire free interval of 1,146 years or more. Along the northern and
southern Oregon coast, Sitka spruce has a fire free interval of 200 to
400 years. Fires that do occur in Sitka spruce are usually stand
replacing. Western hemlock forests along the coast have a fire free
interval of about 750 years [31]. Coastal redwood is tolerant of
low-severity fires which appear to have occurred on mesic sites at
200-to 500-year intervals before the arrival of European settlers
[15,31].
  • 15. Lehman, Robert N.; Allendorf, John W. 1989. The effects of fire, fire exclusion and fire management on raptor habitats in the western United States. In: Proceedings of the western raptor management symposium and workshop; 1987 October 26-28; Boise, ID. Scientific and Technical Series No. 12. Washington, DC: National Wildlife Federation: 236-244. [22324]
  • 16. Marshall, David B. 1988. Status of the marbled murrelet in North America: with special emphasis on populations in California, Oregon, and Washington. Biological Report 88(30). Washington, DC: U.S. Department of the Interior, Fish and Wildlife Service. 19 p. [23180]
  • 31. Agee, James K. 1993. Fire ecology of Pacific Northwest forests. Washington, DC: Island Press. 493 p. [22247]

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Timing of Major Life History Events

Age at sexual maturity - Marbled murrelets do not breed until they are
at least 2 years old [16].

Nesting and brooding - Marbled murrelets nest from mid-April to late
September [16]. Peak activity occurs from mid-June to late July in
California, and the second week of July to mid-August in Oregon [17].
Marbled murrelet are semicolonial in nesting habits. Two nests found in
Washington were located only 150 feet (46 m) apart. Not all mature
adults nest every year [4]. Marbled murrelets lay only one egg. The
egg is incubated by both parents for about 30 days. Adults fly from
ocean feeding areas to inland nest sites, mostly at dusk and dawn. They
feed nestlings at least once and sometimes twice per day or night.
Usually only one fish is carried to the young [4,16].

Fledging - Nestlings fledge in 28 days. Young marbled murrelets remain
in the nest longer than other alcids and molt into their juvenile
plumage before leaving the nest [16]. Fledglings fly directly from the
nest to the ocean [4].

Migration - Some marbled murrelet populations probably migrate south in
fall and north in spring. However, these migration patterns are not
well understood [7].
  • 4. Anon. 1992. Determination of threatened status for the Washington, Oregon, and California population of the marbled murrelet. Oregon Birds. 18(4): 120-121. [21468]
  • 7. Campbell, R. Wayne; Dawe, Neil K.; McTaggart-Cowan, Ian; [and others]
  • 16. Marshall, David B. 1988. Status of the marbled murrelet in North America: with special emphasis on populations in California, Oregon, and Washington. Biological Report 88(30). Washington, DC: U.S. Department of the Interior, Fish and Wildlife Service. 19 p. [23180]
  • 17. Marshall, David B. 1989. The marbled murrelet. Audubon Wildlife Report 1989/1990: 435-455. [23187]

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Solitary, or in pairs, small groups, or loose aggregations. In most areas, generally does not flock with other birds, but may participate in mixed-species feeding flocks in the absence of interference from larger diving birds (Mahon et al. 1992).

The only confirmed record of predation on an adult at its nest involved a Sharp-shinned Hawk in Alaskan old-growth forest (Marks and Naslund 1994).

Species has high fidelity to nesting areas and nest trees (see Nelson 1997).

Despite the urgent need for an assessment of the demographic state of populations, the species is so secretive that reliable estimates of the required vital rates are rare. Survival estimates obtained through capture-recapture data from a population in British Columbia were 0.8289 and 0.9289, based on different samples corresponding to two capture techniques. The study area had been and continues to be heavily logged (Cam et al. 2003).

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Life History and Behavior

Cyclicity

Comments: Young are fed at night or around dusk or dawn. Feeding has been observed at night (Carter and Sealy 1986). At Redwood Experimental Forest, northwestern California, activity levels were greatest 30 minutes before to 30 minutes after sunrise in May, June, and July (Paton et al., in Carter and Morrison 1992). In old growth forest in the Queen Charlotte Islands, British Columbia, number of detections peaked in late July; detections were most likely to occur on cloudy mornings (Rodway et al. 1993).

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Life Expectancy

Lifespan/Longevity

Average lifespan

Status: wild:
120 months.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Lifespan, longevity, and ageing

Maximum longevity: 7.2 years (wild)
Creative Commons Attribution 3.0 (CC BY 3.0)

© Joao Pedro de Magalhaes

Source: AnAge

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Reproduction

The Marbled Murrelet breeds on mountains near the coast. Breeding season is from mid-April to the end of August. Females have been collected with shelled eggs in their oviducts from April 23 to July 13. The murrelet has single egg clutches. Murrelets may not fledge young until mid-September, based on a 30-day incubation and a 28-day rearing period. Nesting sites are almost exclusively in old-growth forests, yet some have been found in cavities in subalpine areas, and on the ground on islands. Murrelet eggs are yellowish and spotted. The first known nest was found in a rock slide far above the timber line at 1900 ft. on Chicago Island, Alaska, on June 13, 1931. (Peterson,1961; Carter and Morrison, 1992).

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Nesting season: late March to late September; downy young, and fledged juveniles have been observed June-September. Activity in forest nesting areas is highest from mid-April through late July in California and Oregon, early May through early August in Washington, and mid-May through early August in Alaska (see Levy 1993). Clutch size is 1. Incubation lasts about 30 days, by both sexes alternately in 24-hr shifts. Nestling is visited and fed by parent 2-4 times each day, fledges in 27-40 days (Marshall 1988, Levy 1993). Appears to nest semicolonially (see USFWS 1994). In a study on the British Columbia coast, foraging distance from nest (i.e. energy spent commuting) had no influence on nesting success (Hull et al. 2001).

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Barcode data: Brachyramphus marmoratus

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There are 6 barcode sequences available from BOLD and GenBank.  Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.  See the BOLD taxonomy browser for more complete information about this specimen and other sequences.

AACCAACCACAAAGACATTGGCACCCTATACTTAATCTTTGGCGCATGAGCCGGTATAGTCGGNACTGCCCTAAGTCTTCTCATCCGTGCAGAACTGGGCCAGCCAGGAACTCTCCTAGGAGATGACCAAATCTACAATGTAATCGTCACCGCCCACGCCTTCGTAATAATCTTCTTCATAGTAATACCAATCATAATCGGTGGCTTCGGAAACTGACTAGTCCCACTTATAATCGGCGCCCCCGACATAGCATTTCCCCGCATAAACAACATAAGCTTCTGACTACTACCCCCATCATTTCTACTCCTTCTAGCCTCTTCCACAGTCGAAGCTGGAGTTGGTACAGGTTGAACTGTATACCCTCCCCTAGCTGGTAACCTAGCCCATGCTGGAGCTTCAGTGGACCTAGCAATCTTCTCACTCCACCTAGCAGGTGTGTCCTCTATCTTAGGCGCTATCAACTTCATCACAACTGCTATCAACATAAAACCCCCAGCCCTATCACAATACCAAACTCCCTTATTCGTGTGATCAGTACTCATCACTGCCGTCCTACTACTTCTCTCACTTCCCGTGCTCGCTGCTGGCATCACTATACTACTAACAGACCGAAACCTAAACACAACATTCTTTGATCCAGCCGGAGGCGGAGACCCAGTACTATACCAGCACCTTTTCTGATTCTTCGGTCACCCAGAAGTGTACATCCTAATTCTACCAGGCTTCGGCATTATCTCCCACGTTGTAACATACTACGCAGGAAAAAAAGAACCATTCGGTTACATAGGAATAGTATGAGCTATACTATCCATTGGTTTCCTGGGCTTCATCGTATGGGCACATCACATATTCACCGTAGGRATAGACGTAGACACTCGAGCCTACTTTACATCCGCCACTATAATCATTGCTATTCCTACCGGTATTAAAGTATTTAGCTGACTAGCCACACTCCATGGAGGCACCATCAAATGAGACCCACCAATACTATGAGCCTTGGGCTTTATCTTCCTATTCACTATCGGAGGCCTAACAGGTATCGTTCTAGCAAACTCTTCGCTGGACATTGCTCTACACGACACATATTACGTAGTTGCCCACTTC
-- end --

Download FASTA File
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Statistics of barcoding coverage: Brachyramphus marmoratus

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 6
Specimens with Barcodes: 11
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Conservation

Conservation Status

Information on state-level protected status of the marbled murrelet in the
United States is available at NatureServe.

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

U.S. Federal Legal Status

Threatened [35]
  • 35. U.S. Fish and Wildlife Service. 2013. Listed animals. In: Environmental Conservation Online System, [Online]

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

IUCN Red List Assessment


Red List Category
EN
Endangered

Red List Criteria
A2c+3c+4c

Version
3.1

Year Assessed
2010

Assessor/s
BirdLife International

Reviewer/s
Bird, J., Butchart, S. & Calvert, R.

Contributor/s
Bertram, D. & Kuletz, K.

Justification
This species is still abundant, but it is treated as Endangered because its population is estimated to have undergone a very rapid reduction over three generations (36 years), owing to a variety of threats. This decline is likely to continue.


History
  • 2008
    Endangered
  • 2005
    Endangered
  • 2004
    Endangered
  • 2000
    Vulnerable
  • 1994
    Not Recognized
  • 1988
    Not Recognized
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

The Alaskan population is estimated at 250,000 birds, centered in south central and south eastern parts of the state, but extending into Bristol Bay and along the Aleutian Islands. This represents the bulk of the North American population. Logging efforts are expanding in the areas of the greatest murrelet population. Continued logging will produce major declines in murrelet numbers. Inland records from British Columbia, Washington, and Oregon suggested the presence of nests in old growth forests, although none had been found prior to 1990. Marbled Murrelet numbers in British Columbia are an estimated 45,000-50,000 birds, with the highest density on the west coast of Vancouver Island. The Marbled Murrelet population of Washington is estimated at 5,000, centered in the northern Puget Sound area. Oregon's population is estimated at 2,000-4,000 birds, located mostly in the central coastal region. There is also a small population of murrelets, (1400-1700 birds) on the north central coast of California.

Threats include mainly the loss of old-growth forests (all locales), some mortality from gill nets (responsible for the annual death of 7.8% of the British Columbia population), and oil pollution (Alaska and Washington). Very little of the existing old-growth forests are currently protected. One locale of substantial old growth forest in British Columbia was expected to decrease 95% in 50 years due to harvest schedules. Four of the five locations where fledglings were found in Washington state have been logged. Of Oregon's old growth forests, 44% is in stands of less than 32 hectares or within 122 meters of a clearcut. This isolation of small patches of forest may decrease reproductive success and increase predation at nest sites. In California, only 4% of the original acreage of Redwood trees is currently protected. This obliteration of habitat could be responsible for the sparse numbers of murrelet in California.

The Marbled Murrelet is considered endanged in California, and threatened in Oregon, Washington, and British Columbia. Its low reproductive rate prevents fast recovery from population decreases. The Marbled Murrelet is one of the few species of alcids whose known and suspected nesting habitat is not protected by federal refuge designation. Several lawsuits have been filed to defer the logging of old-growth forests where murrelets are known or suspected to live. In order to save the habitat of the marbled murrelet there need to be larger forest reserves and/or substantial changes in the logging practices.

Ground searches produced only 15 nest locations up until 1987

Tree searches since then have produced 19 nest locations in old growth forests. Due to the difficulty of locating the nests of these elusive birds, it is necessary to implement plans for further research before the Marbled Murrelet becomes an indicator species such as the spotted owl (Carter and Morisson, 1992).

IUCN Red List of Threatened Species: endangered

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

National NatureServe Conservation Status

Canada

Rounded National Status Rank: N2 - Imperiled

United States

Rounded National Status Rank: N3 - Vulnerable

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

NatureServe Conservation Status

Rounded Global Status Rank: G3 - Vulnerable

Reasons: Extensive range along the Pacific coast of North America from Alaska to California; population numbers still high in British Columbia and Alaska, but declining; threats from habitat loss due to logging, oil spills, and gill net fisheries are increasing.

Rank of G3G4 was confirmed using NatureServe Rank Calculator Estimator Version 6.11.

Intrinsic Vulnerability: Moderately vulnerable

Comments: Low reproductive rate (1 egg/pair/season); slow recovery rate.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Current Listing Status Summary

Status: Threatened
Date Listed: 10/01/1992
Lead Region:   Pacific Region (Region 1)   
Where Listed: CA, OR, WA

Status: Species of Concern
Date Listed:
Lead Region:   Alaska Region (Region 7)   
Where Listed: except CA, OR, WA


Population detail:

Population location: U.S.A. (CA, OR, WA)
Listing status: T

For most current information and documents related to the conservation status and management of Brachyramphus marmoratus , see its USFWS Species Profile

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Status

Classified as Endangered (EN) by the IUCN Red List 2007 (1).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Population

Population
Agler et al. (1998).

Population Trend
Decreasing
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Global Short Term Trend: Decline of 30-70%

Comments: Compiling available abundance information, Piatt et al. (2007) estimated that in the recent past, the marbled murrelet population in Alaska numbered on the order of 1 million birds (it was not possible to generate a similar estimate for historical population size in British Columbia). Information from at-sea surveys spanning a wide geographic range in Alaska indicated that murrelet numbers declined significantly at five of eight trend sites at annual rates of -5.4 to -12.7 percent since the early 1990s. Applying these rates of decline to the historical population estimate, Piatt et al. (2007) estimated the current murrelet population in Alaska to be on the order of 270,000 birds. This represents an overall population decline of about 70 percent during the past 25 years. In British Columbia, available trend data indicate that murrelet populations there have experienced similar declines. Updating a recent (2002) population estimate for British Columbia, Piatt et al. concluded that there are now between 54,000 and 92,000 murrelets in British Columbia. The rates of decline are within, but at the high end of, a range of rates expected by chance (Piatt et al. 2007). Given that declines were estimated for sites over essentially the entire northern range of the species, there is cause for concern about the species' status.

On the southern coast of Washington, north coast of Oregon, and in California south of Humboldt County, murrelets are rare or uncommon where they once were common or abundant in the early 1900s (Ralph et al. 1995).

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Threats

Major Threats
Many areas of remaining old-growth forest are slated for logging. Since the collapse of the Pacific sardine fishery, prey quality and abundance has declined, with lower trophic-level prey (e.g. krill) now dominating the pre-breeding diet23. This has resulted in a lower proportion of individuals reaching breeding condition, and therefore lower population productivity. This factor, combined with high rates of nest predation by corvids, is thought to be the primary cause of recent declines24. Nylon, monofilament gill-nets in shallow waters and oil-spills (e.g. Exxon Valdez and Nestucca) also cause considerable mortality3,6,12,15.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Degree of Threat: B : Moderately threatened throughout its range, communities provide natural resources that when exploited alter the composition and structure of the community over the long-term, but are apparently recoverable

Comments: Most populations are dependent on large trees in old-growth forests for nest sites. Continued harvest of old-growth and mature coastal coniferous forest that reduces critical nesting habitat is a major concern throughout most of the range (Sealy and Carter 1984, Marshall 1988, Mendenhall 1992, Rodway et al. 1992, Leschner and Cummins 1992, Nelson et al. 1992, Carter and Erickson 1992, Carter and Morrison 1992; see also Rodway 1990 COSEWIC report). Marbled murrelets have lost about 15 percent of their suitable nesting habitat in Southeast Alaska, and 33 to 49 percent in British Columbia, from industrial-scale logging within the past half century (Piatt et al. 2007). Ralph (1994) estimated that 80 percent of the old-growth forests within the range of this species in the Pacific Northwest had been removed over the last 150 years.

Marbled murrelets are vulnerable to incidental mortality associated with salmon gillnet fisheries (Sealy and Carter 1984, Wynne et al. 1991). The gill-net threat is greatest north of Oregon (Levy 1993). Annual bycatch mortality in salmon gillnetting operations in British Columbia and in Alaska (especially in Prince William Sound and Southeast Alaska) is likely in the low thousands per year, although bycatch rates are difficult to measure (Piatt et al. 2007).

The species' inshore distribution coincides with high levels of vessel traffic and makes them especially vulnerable to both chronic oil pollution and to catastrophic spills (King and Sanger 1979, King 1984, Sealy and Carter 1984, Mendenhall 1992, Rodway et al. 1992, Leschner and Cummins 1992, Nelson et al. 1992, Carter and Erickson 1992, Piatt et al. 2007). The 1989 Exxon Valdez oil spill in south-central Alaska is estimated to have killed 12,000 to 15,000 murrelets (Piatt et al 2007).

Other threats include direct and indirect mortality associated with the location and operation of mariculture facilities. These threats include: entanglement, displacement of birds from traditional foraging areas, contamination of foods by antibiotics, antifoulants, and alteration of local food supplies due to decomposition of fish food and fish excrement associated with these farms (Vermeer and Morgan 1989, Rodway et al. 1992, Leschner and Cummins 1992). Murrelets in some areas may also be subject to high levels of industrial pollutants (Fimreite et al. 1971, Rodway et al. 1992).

Listed populations are currently experiencing very low recruitment rates, due at least in part to nest predation (by edge species, such as bald eagle, common raven, and Steller's jay, that are now more abundant due to forest fragmentation) and probably high mortality in young prior to reaching the ocean (USFWS 1994, 1996). Populations in the Aleutians may have been higher before foxes were introduced there (Mendenhall in Carter and Morrison 1992).

Finally, nesting habitat losses cannot explain the declines observed in areas where industrial logging has not occurred on a large scale (e.g., Prince William Sound) or at all (Glacier Bay) (Piatt et al. 2007). Those declines probably are related to combined and cumulative effects from climate-related changes in the marine ecosystem (most likely the 1977 regime shift) and human activities (logging, gillnet bycatch, oil pollution) (Piatt et al. 2007).

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

In many areas, the old-growth forests in which this murrelet breeds are subject to logging. Declines in areas where logging has not been a problem are thought to be due to a reduction in fish prey (2). Significant mortalities of this species have been caused by the birds becoming caught in gill-nets used in fishing, and by oil spills (2).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Management

Management Considerations

The principal factor threatening the persistence of marbled murrelet
over the southern portions of its range is harvesting of old-growth and
mature forests [17]. Old growth harvesting has been heavier in coastal
forests than further inland; and short rotation ages (currently < 80
years) do not allow conifers to develop the large diameter flat limbs
with thick moss layers used for nesting. Old-growth and mature forests
within the range of marbled murrelets are essential to marbled murrelet
perpetuation [16,29].

Mortality from gill-net fisheries - Marbled murrelets are the alcid most
frequently killed by gill-nets. In Barkley Sound off Vancouver Island,
British Columbia, an estimated 380 marbled murrelets were killed by
gill-nets in 1980. This accounted for 7.8 percent of the potential fall
population in the area [29]. Sealy and Carter [24] reported that 600 to
800 or more marbled murrelets are killed (almost exclusively at night)
annually in Prince William Sound, Alaska, due to gill-nets. Recommended
conservation measures include changes in areas where the gill-net
fishery takes place and prohibition of night fishing. Gill-net fishing
does not occur off the Oregon coast, but is widespread in Puget Sound
[16].

Mortality from oil pollution - Marbled murrelets have been rated as
having the highest oil vulnerability index of any seabird in southeast
Alaska. This is based in part on their feeding in loose aggregations
close to shore. Development in the petroleum industry along the Pacific
coast will increase the threat of oil pollution [24].
  • 16. Marshall, David B. 1988. Status of the marbled murrelet in North America: with special emphasis on populations in California, Oregon, and Washington. Biological Report 88(30). Washington, DC: U.S. Department of the Interior, Fish and Wildlife Service. 19 p. [23180]
  • 17. Marshall, David B. 1989. The marbled murrelet. Audubon Wildlife Report 1989/1990: 435-455. [23187]
  • 24. Sealy, Spencer G.; Carter, Harry R. 1984. At-sea distribution & nesting habitat of the marbled murrelet in British Columbia: problems in the conservation of a solitarily nesting seabird. In: Croxall, J. P.; Evans, P. G. H.; Schreiber, R. W., eds. Status and conservation of the world's seabirds. ICBP Technical Publication No. 2. [Place of publication unknown]
  • 29. Marshall, David B. 1988. The marbled murrelet joins the old-growth forest conflict. American Birds. 42(2): 202-212. [23181]

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Conservation Actions

Conservation Actions
Conservation Actions Underway
It is Threatened in all range states except Alaska. Detailed conservation recommendations were made in 199517. Federal land-use is regulated, areas for management identified, and some temporarily removed from logging12, though the protected status of old-growth forest in California is currently under review by the USFWS in response to a timber-industry-led petition. In Canada there has been extensive research, a (now outdated) Recovery Plan and interim protection for nest-sites18. The Northwest Forest Plan (2006) is expected to ensure the protection of a large proportion of important habitats in the USA25. In 1998, the Exxon Valdez Trustee Council protected 179 km2 of Afognak Island2.

Conservation Actions Proposed
Survey potential nesting habitat. Collect data on the ratio of juvenile to adult birds from sites throughout the range, and monitor over time, as this is thought to be a reliable indicator of productivity26Research means of improving the abundance of high quality food, e.g. small fish, during the pre-breeding period. Minimise damage to fish stocks and feeding areas18. Update the Canadian Recovery Plan18. Protect nesting habitat11. Move campgrounds away from old-growth areas in Californian State Parks, in order to reduce predator populations in breeding areas. Reduce oil-spills, gill-net mortality and logging11. List as Threatened in Alaska11.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Management Requirements: See U.S. Forest Service et al. (1993), Thomas et al. (1993), and USFWS (1994) for discussions of management issues.

Biological Research Needs: Further research is needed on methods for measuring population status and change, adult mortality (major sources, density dependence, seasonal concordance), and the movements of wintering populations (Piatt et al. 2007).

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Global Protection: Few to several (1-12) occurrences appropriately protected and managed

Comments: Protected under the Migratory Bird Treaty in the United States and Canada and also under the Endangered Species Act in the United States. It is federally listed as a Threatened species in Washington, Oregon, and California and is a former candidate species (Category 2) in Alaska (USFWS 1992a, b). The status of the Alaska population is
currently under review (Robards et al. 2003).

U.S. Fish and Wildlife Service (1996) designated Critical Habitat in Washington, Oregon, and California. Critical Habitat included 32 Critical Habitat Units that were considered essential to the conservation of the species. The National Audubon Society recently purchased habitat in Oregon along Tenmile Creek, an area that supports the largest concentration of Marbled Murrelets in that state (Ehrlich et al. 1992).

Protected under the federal Species at Risk Act (SARA) in Canada. In British Columbia, the Marbled Murrelet is a "Red" listed species (candidate for official extirpated, endangered or threatened status in BC; Fraser et al. 1999).

Needs: Protect critical old-growth nesting and feeding areas; increase response capability against oil spills; monitor gill net takes and regulate harvests to minimize murrelet mortality; prevent pollution of feeding areas; prevent displacement of murrelets from historic foraging areas by disturbance and development.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Conservation

Conservation measures taken to date include the protection of some areas supporting this species from future logging. Detailed research has been carried out on this murrelet, and a recovery plan has been produced. Furthermore, 179 km² of Afognak Island has been protected since 1998 by the Exxon Valdex Trustee Council (2). Proposed measures include research, particularly into the feeding ecology of this bird in order to fully understand the threats facing it. It is vital that suitable nesting habitat is protected and that fish stocks in known feeding areas are not severely damaged (2).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Relevance to Humans and Ecosystems

Benefits

Economic Importance for Humans: Negative

If additional research finds that the marbled murrelet lives exclusively in old-growth forests and that their numbers decrease proportionally with the decrease in acres of forest, then it could be deemed an indicator species thus a justifiable deterent for further logging operations. The decrease in logging leads to a loss of income and jobs in the logging industry (Carter, Morrison).

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Economic Importance for Humans: Positive

Increasing numbers of people are spending considerable sums of money to reach marine bird viewing areas off the coasts of North American States and Provinces. These "nonconsumptive pursuits" (Barry, 1979) contribute significant amounts of money to regional economies. Also, there are indirect commercial benefits. Marine birds play significant roles in their complex ecosystem. Disruption of that ecosystem by the extinction of sea birds could have an adverse affect on the fishing industry. Marine bird excrement, (.12-.24 million tons annually!!) is especially rich in nitrates and phosphates, which phytoplankton, the basis of ocean food pyramids, requires (Berry, 1979).

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Wikipedia

Marbled Murrelet

The Marbled Murrelet (Brachyramphus marmoratus) is a small seabird from the North Pacific. It is a member of the auk family. It nests in old-growth forests or on the ground at higher latitudes where trees cannot grow. Its habit of nesting in trees was suspected but not documented until a tree-climber found a chick in 1974 making it one of the last North American bird species to have its nest described. The Marbled Murrelet has declined in number since humans began logging its nest trees in the latter half of the 19th century. The decline of the Marbled Murrelet and its association with old-growth forests, at least in the southern part of its range, have made it a flagship species in the forest preservation movement. In Canada (north of 50° North Latitude) and Alaska, the declines are not so obvious because populations are much larger and the survey techniques have not had sufficient power to detect changes.

Contents

Description

The Marbled Murrelet is a small (25 cm), chunky auk with a slender black bill. It has pointed wings and plumage that varies by season. The non-breeding plumage is typically white underneath with a black crown, nape, wings and back. The bird closely resembles its closest relative, the Long-billed Murrelet. In fact, these species were considered conspecific up until 1998. They are virtually identical. In breeding plumage, both have a brown mottled body and face. The Long-billed has a pale white throat, lacking in the Marbled. In winter plumage, the Marbled Murrelet has a white neck collar, absent in Long-billed. The Marbled Murrelet is shorter billed and slightly smaller than the Long-billed Murrelet.

Behavior and breeding

Marbled Murrelet chick (taxidermy)

The Marbled Murrelet feeds at sea both in pelagic offshore areas (often associating with upwellings) and inshore in protected bays and fiords. It feeds principally on sandeels, also taking herring, capelin and shiner perch. The bird has not been known to wander from the Pacific coast of North America, all inland and eastern Brachyramphus records being of the closely related Long-billed Murrelet.

The nesting behaviour of the Marbled Murrelet is unusual, since unlike most alcids it does not nest in colonies on cliffs or in burrows, but on branches of old-growth and mature conifers such as Western Hemlock, Sitka Spruce, Douglas Fir and Coastal Redwood, as far as 80 km inland. It lays one egg on a platform of lichen or moss on these branches (less often on the ground). In northern populations, murrelets nest on the ground among rocks, as do other related murrelet species. The egg is incubated for a month, then fed for around 40 days until the chick is able to fledge. The chick then leaves the nest and flies unaccompanied to the sea. Breeding success is low and chick mortality high.

Distribution

Marbled murrelets occur in summer from Alaska's Kenai Peninsula, Barren islands, and Aleutian islands south along the coast of North America to Point Sal, Santa Barbara County, in south-central California. Marbled murrelets winter mostly within the same general area, except that they tend to vacate the most northern sections of their range, especially where ice forms on the surface of the fiords. They have been recorded as far south as Imperial Beach of San Diego County, California.[2]

Plant communities

In northern regions where coniferous forests nest sites are unavailable, marbled murrelets occupy alpine or tundra near the ocean.[2] In Washington and Oregon, marbled murrelets commonly nest in Douglas-fir (Pseudotsuga menziesii) dominated stands. They also select stands dominated by mountain hemlock (Tsuga mertensiana), western redcedar (Thuja plicata), and Sitka spruce (Picea sitchensis) for nesting.[2][3] In California, nests are most often located in redwood (Sequoia sempervirens) dominated stands with scattered Sitka spruce, western hemlock (Tsuga heterophylla) and Douglas-fir. Marbled murrelets also occur in stands dominated by Port-Orford-cedar (Chamaecyparis lawsoniana).[4]

Major life events

Marbled murrelets do not breed until they are at least 2 years old. Marbled murrelets nest from mid-April to late September.[2] Peak activity occurs from mid-June to late July in California, and the second week of July to mid-August in Oregon.[5] Marbled murrelet are semicolonial in nesting habits. Two nests found in Washington were located only 150 feet (46 m) apart. Not all mature adults nest every year.[3] Marbled murrelets lay only one egg. The egg is incubated by both parents for about 30 days. Adults fly from ocean feeding areas to inland nest sites, mostly at dusk and dawn. They feed nestlings at least once and sometimes twice per day or night. Usually only one fish is carried to the young.[2][3]

Nestlings fledge in 28 days. Young marbled murrelets remain in the nest longer than other alcids and molt into their juvenile plumage before leaving the nest.[2] Fledglings fly directly from the nest to the ocean.[3]

Habitat

Marbled murrelets are coastal birds that occur mainly near saltwater within 1.2 miles (2 km) of shore.[2] However, marbled murrelets have been found up to 59 miles (80 km) inland in Washington, 35 miles (56 km) inland in Oregon, 22 miles (37 km) inland in northern California, and 11 miles (18 km) inland in central California. Over 90% of all marbled murrelet observations in the northern Washington Cascades were within 37 miles (60 km) of the coast. In Oregon, marbled murrelets are observed most often within 12 miles (20 km) of the ocean.[3] Many marbled murrelets regularly visit coastal lakes. Most lakes used by marbled murrelets are within 12 miles (20 km) of the ocean, but a few birds have been found at lakes as far inland as 47 miles (75 km). All lakes used by marbled murrelets occur within potential nesting habitat.[6]

Nesting habitat

From southeast Alaska southward, marbled murrelets use mature or old-growth forest stands near the coastline for nesting.[2][3] These forests are generally characterized by large trees (>32 inches [80 cm] diameter at breast height (d.b.h.)), a multistoried canopy, moderate to high canopy closure or an open crown canopy,[5][7] large snags, and numerous downed snags in all stages of decay.[3] Marbled murrelets tend to nest in the oldest trees in the stand.[3] In Oregon, forests begin to exhibit old-growth characteristics at about 175 to 250 years of age. Moss, on which marbled murrelets nest, forms on the limbs of Douglas-fir that are more than 150 years old.[2]

The only four marbled murrelet tree nests found before 1990 shared the following characteristics: (1) located in a large tree (>47 inches [120 cm] d.b.h.) with an open crown structure, (2) on a moss-covered limb that is camouflaged, partially shaded, and approximately horizontal with a diameter (including associated moss) of at least 14 inches (36 cm), and (3) located within the middle or lower part of a live crown.[7] However, Marshall [8] stated that because of their low aerial buoyancy marbled murrelets often nest high in the treetops or on steep slopes. Habitat must be sufficiently open to allow for easy flight.[5] All marbled murrelet nests found in Washington, Oregon, and California were located in old-growth trees that ranged from 38 inches (88 cm) d.b.h. to 210 inches (533 cm) d.b.h. with a mean of 80 inches (203 cm) d.b.h. Nests were located high above the ground and had good overhead protection but allowed easy access to the exterior forest.[3] It was initially believed that marbled murrelets might use the same nest in successive years but there has been little evidence of this.[8]

Stand size is also important in nest sites. Marbled murrelets more commonly occupy stands greater than 500 acres (202 ha) than stands less than 100 acres (40 ha). However, marbled murrelets may nest in remnant old-growth trees or groves that are surrounded by younger trees.[5] In California, marbled murrelets are usually absent from stands less than 60 acres (24 ha) in size. In Washington, marbled murrelets are found more often when old-growth and mature forests make up over 30% of the landscape. Fewer marbled murrelets are found when clearcut and meadow areas make up more than 25% of the landscape. Concentrations of marbled murrelets offshore are almost always adjacent to old-growth or mature forests onshore,[2][3] although marbled murrelets may not use the interior of dense stands.[8]

Where large trees are absent in the northern parts of marbled murrelet range, marbled murrelets nest in depressions on the ground, in rock cavities on the ground, or on rock outcrops.[7] Marbled murrelets are both ground nesters and tree nesters where forests and treeless areas meet.[2]

Foraging habitat

Marbled murrelets forage in the ocean near shore and in inland saltwater areas such as bays, sounds, and saltwater passageways. Some also forage on inland freshwater lakes. Flocks of 50 or more birds have been observed near freshwater lakes.[6] Subadults occur at sea throughout the summer. Marbled murrelets feed within 1,640 feet (500 m) of shore.[9]

Winter habitat

Marbled murrelet winter habitat is the same as the nesting and foraging habitat. During the winter marbled murrelets use inland old-growth or mature sites for roosting, courtship, and investigating nest sites. The use of inland lakes during the nonbreeding season occurs in conjunction with visits to nesting areas.[6]

Food habits

Marbled murrelets feed below the water surface on small fish and invertebrates.[2][5] Some principal foods include sand lance (Ammodytes hexapterus), Pacific herring (Clupea haringus), capelin (Mallotus villosus), and the invertebrates Euphausia pacifica and Thysanoessa spinifera.[2]

Marbled murrelets often forage in pairs but do not feed in large flocks as do other alcids. Loose aggregations of 500 or more birds occasionally occur in winter. DNA tests have shown that the foraging duos are not necessarily breeding pairs.[10] Subadults feed singly; but in early July, when pairs of adults are still feeding young, mixed flocks begin to form.[2] Marbled murrelets feed during the day and at night.[5]

Predators

Steller's jays (Cyanocitta stelleri) and common ravens (Corvus corax) prey on marbled murrelet eggs and nestlings.[7]

Marbled Murrelets and humans

The Marbled Murrelet is considered globally endangered,[1] with some evidence of decline across its range over the last few decades. The biggest threat to the marbled murrelet was long considered to be loss of nesting habitat (old-growth and mature forests) to logging. Additional factors including high predation rates due to human disturbances and climate-driven changes in ocean conditions are also considered important now.

Scientists at Redwood National Park have established a connection between human presence in marbled murrelet territory and corvid predation of marbled murrelet chicks. Corvid populations, such as Steller's jays, crows, and ravens, are expanding into old-growth forests. Lured by food scraps left by campers and hikers, with increased access aggravated by the patchwork forests created by industrial logging, corvids more frequently discover marbled murrelet nests in areas where these predator species were not previously found.

The populations in Washington, Oregon and California were listed as threatened in 1992 by the U.S. Fish and Wildlife Service due to concerns about loss of nesting habitat, entanglement in fishing gear and oil spills. The Canadian population was declared "nationally threatened" in 1990. The status of Alaskan populations are currently under review. The species became a flagship species in efforts to prevent the logging of old-growth forests along the Pacific coast from California to Alaska.

References

 This article incorporates public domain material from the United States Department of Agriculture document "Brachyramphus marmoratus".

  1. ^ a b BirdLife International (2012). "Brachyramphus marmoratus". IUCN Red List of Threatened Species. Version 2012.1. International Union for Conservation of Nature. Retrieved 16 July 2012. 
  2. ^ a b c d e f g h i j k l m n "Status of the marbled murrelet in North America: with special emphasis on populations in California, Oregon, and Washington". Biological Report (Washington, DC: U.S. Department of the Interior, Fish and Wildlife Service) 88 (30).  Unknown parameter |Marshall, David B.year= ignored (help)
  3. ^ a b c d e f g h i j "Determination of threatened status for the Washington, Oregon, and California population of the marbled murrelet". Oregon Birds 18 (4): 120–121. 1992. 
  4. ^ Paton, Peter W. C.; Ralph, C. John (1990). "Distribution of the marbled murrelet at inland sites in California". Northwestern Naturalist 71 (3): 72–84. doi:10.2307/3536775. 
  5. ^ a b c d e f Marshall, David B. (1989). The marbled murrelet. Audubon Wildlife Report, pp. 435–455
  6. ^ a b c Carter, Harry R.; Sealy, Spencer G. (1986). "Year-round use of coastal lakes by marbled murrelets". Condor 88 (4): 473–477. doi:10.2307/1368273. JSTOR 1368273. 
  7. ^ a b c d Singer, Steven W.; Naslund, Nancy L.; Singer, Stephanie A.; Ralph, C. John (1991). "Discovery and observations of two tree nests of the marbled murrelet". Condor 93 (2): 330–339. doi:10.2307/1368948. JSTOR 1368948. 
  8. ^ a b c Marshall, David B. (1988). "The marbled murrelet joins the old-growth forest conflict". American Birds 42 (2): 202–212. 
  9. ^ Sealy, Spencer G. (1975). "Feeding ecology of the ancient and marbled murrelets near Langara Island, British Columbia". Canadian Journal of Zoology 53 (4): 418–433. doi:10.1139/z75-055. 
  10. ^ Vanderkist BA, Xiao-Hua Xue, Griffiths R, Martin K, Beauchamp W, Williams TD (1999). "Evidence of male-bias in capture samples of Marbled Murrelets from genetic studies in British Columbia". Condor 101 (2): 398–402. doi:10.2307/1370004. JSTOR 1370004. 

Further reading

Creative Commons Attribution Share Alike 3.0 (CC BY-SA 3.0)

 

Source: Wikipedia

Unreviewed

Article rating from 0 people

Average rating: 2.5 of 5

Names and Taxonomy

Taxonomy

Comments: Tree- and ground-nesting populations exhibit no morphological divergence and little genetic divergence (Pitocchelli et al. 1995).

Populations on Asian and North American sides of Beringia exhibit mtDNA differentiation consistent with species-level distinctness (Zink et al. 1995); because sample sizes were small, Zink et al. did not recommend a formal taxonomic change. However, the (Asian) long-billed murrelet (B. perdix) was subsequently split from the American B. marmoratus (Friesen et al. 1996, AOU 1997).

Friesen et al. (1996) examined variation in the mitochondrial cytochrome b gene and in 39 allozyme loci for North American and Asian (then B. m. perdix) marbled murrelets and Kittlitz's murrelet (B. brevirostris) and found significant genetic variation among marbled murrelet populations from different sites within North America.

Genetic data presented by Piatt et al. (2007) indicate that the marbled murrelet is represented by three populations, comprising birds in (1) the central and western Aleutian Islands, (2) central California, and (3) the center of the range from the eastern Aleutians to northern California.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!