Articles on this page are available in 2 other languages: Spanish (10), Chinese (Simplified) (5) (learn more)

Overview

Brief Summary

Anas acuta

A large (26-30 inches) duck, the male Northern Pintail is most easily identified by its gray back and flanks, white neck, dark brown head, and long, pin-like tail. Female Northern Pintails are mottled tan overall, with slightly shorter tails and bills. Males are almost unmistakable in their range and habitat, while females may be distinguished from other tan female ducks by their longer necks. The Northern Pintail inhabits much of the Northern Hemisphere. In the New World, this species breeds in Alaska, Canada, and the northern United States, wintering from western Canada and the southern half of the United States south to Central American and the West Indies. In the Old World, this species breeds from Iceland and Scandinavia east to Siberia, wintering in Europe, North and East Africa, South Asia, and several islands in the western Pacific Ocean. Northern Pintails breed in shallow marshes, ponds, and lakes, primarily those surrounded by prairie or tundra. During the winter, this species may be found in freshwater or saltwater wetland habitats, including lakes, marshes, and estuaries. Northern Pintails eat a variety of plant and animal foods, including seeds, aquatic plants, insects, and other small invertebrates. Northern Pintails may be seen swimming on small to medium-sized bodies of water, where they may be observed foraging for food. This species may also be observed taking off straight up from the water or undertaking straight, swift flights on migration or between breeding or foraging grounds. Northern Pintails are most active during the day.

Threat Status: Least concern

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Unknown

Supplier: DC Birds

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Comprehensive Description

Description of Anas acuta

Het mannetje heeft een langere staart dan het vrouwtje.
Creative Commons Attribution 3.0 (CC BY 3.0)

1geron

Source: BioPedia

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Distribution

Global Range: (>2,500,000 square km (greater than 1,000,000 square miles)) BREEDING: Holarctic. In North America, from tundra of Alaska, Canada, western Greenland, to western and central U.S.; also in Old World. NON-BREEDING: in Western Hemisphere, from eastern and southeastern (coastal) U.S., Great Lakes, southeastern Alaska southwestern British Columbia, western and southwestern U.S. south to northern Colombia and Venezuela, rarely to Surinam, including Puerto Rico, Virgin Islands, Hawaii; and Old World. In the U.S. the highest winter densities occur in northern Utah (Bear River refuge) and western Texas (Muleshoe refuge) (Root 1988).

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 1 person

Average rating: 4.0 of 5

Geographic Range

Northern Pintail, also called sprig, are found throughout the world. During the summer they are found mainly in the Northern Hemisphere as far south as Poland and Mongolia in Eurasia and California in North America. In the winter, they migrate to the Southern Hemisphere, including parts of Africa and all of Mexico. Some Pintail even fly all the way to Hawaii to spend the winter.

(Gooders, Boyer 1986)

Biogeographic Regions: nearctic (Native ); palearctic (Native ); oceanic islands (Native )

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 1 person

Average rating: 3.0 of 5

The northern pintail has one of the most extensive breeding ranges of
any North American duck [14]. Its breeding range extends from northern
Alaska across northern Canada to northern and eastern Quebec, New
Brunswick, and Nova Scotia, and from from California across the Great
Lakes region to St. Lawrence River, Maine [3,10]. The northern pintail
also breeds in Greenland, Iceland, Europe, Asia, and in the Kerguelen
and Corozet Islands [10]. These ducks winter from southern Alaska south
to northern New Mexico and east to central Missouri and the Ohio Valley,
and along the Atlantic from Massachusetts south throughout the southern
United States to South America [3,10,13].
  • 3. DeGraaf, Richard M.; Scott, Virgil E.; Hamre, R. H.; [and others]
  • 10. Johnsgard, Paul A. 1979. A guide to North American waterfowl. Bloomington, IN: Indiana University Press. 274 p. [20026]
  • 13. Madge, Steve; Burn, Hilary. 1988. Waterfowl: An indentification guide to the ducks, geese and swans of the world. Boston, MA: Houghton Mifflin Company. 298 p. [20029]
  • 14. Musgrove, Jack W.; Musgrove, Mary R. 1943. Waterfowl in Iowa. Des Moines, IA: State Convservation Committee. 113 p. + index. [20028]

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Regional Distribution in the Western United States

More info on this topic.

This species can be found in the following regions of the western United States (according to the Bureau of Land Management classification of Physiographic Regions of the western United States):

1 Northern Pacific Border
2 Cascade Mountains
3 Southern Pacific Border
4 Sierra Mountains
5 Columbia Plateau
6 Upper Basin and Range
7 Lower Basin and Range
8 Northern Rocky Mountains
9 Middle Rocky Mountains
10 Wyoming Basin
11 Southern Rocky Mountains
12 Colorado Plateau
13 Rocky Mountain Piedmont
14 Great Plains
15 Black Hills Uplift
16 Upper Missouri Basin and Broken Lands

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Gulf of Maine, Gulf of Mexico, New Zealand Exclusive Economic Zone, North West Atlantic, Polish Exclusive Economic Zone, Portuguese Exclusive Economic Zone, Spanish Exclusive Economic Zone, Swedish Exclusive Economic Zone, United Kingdom Exclusive Economic Zone, Wimereux
Creative Commons Attribution 3.0 (CC BY 3.0)

© WoRMS for SMEBD

Source: World Register of Marine Species

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Range

Palearctic and N America; winters to s Eurasia and n S America.
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

 

Partner Web Site: Cornell Laboratory of Ornithology

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Occurrence in North America

AL AK AZ AR CA CO CT DE FL GA
ID IL IN IA KS KY LA ME MD MA
MI MN MS MO MT NE NV NH NJ NM
NY NC ND OH OK OR PA RI SC SD
TN TX UT VT VA WA WV WI WY DC


AB BC MB NB NF NT NS ON PE PQ
SK YT



MEXICO

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Geographic Range

Northern Pintail, also called sprig, are found throughout the world. During the summer they are found mainly in the Northern Hemisphere as far south as Poland and Mongolia in Eurasia and California in North America. In the winter, they migrate to the Southern Hemisphere, including parts of Africa and all of Mexico. Some Pintail even fly all the way to Hawaii to spend the winter.

(Gooders, Boyer 1986)

Biogeographic Regions: nearctic (Native ); palearctic (Native ); oceanic islands (Native )

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

North America Range extends from Labrador to the Gulf of Mexico
Creative Commons Attribution 3.0 (CC BY 3.0)

© WoRMS for SMEBD

Source: World Register of Marine Species

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

occurs (regularly, as a native taxon) in multiple nations

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

National Distribution

Canada

Origin: Native

Regularity: Regularly occurring

Currently: Present

Confidence: Confident

Type of Residency: Year-round

United States

Origin: Native

Regularity: Regularly occurring

Currently: Present

Confidence: Confident

Type of Residency: Year-round

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Asia and Europe. Canada and most of interior United States. In eastern U. S. distributed mostly along the coast.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Gulf of Maine - CoML

Source: Gulf of Maine Area Census of Marine Life

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Physical Description

Morphology

Physical Description

The adult male Northern Pintail is between 23 to 30 inches (58.5 to 76 centimeters) in length and weighs 1 to 3 pounds (454 to 1362 Grams). Adult females measure 20 to 25 inches (51 to 63.5 centimeters) and weighs 1 to 2.5 pounds (454 to 1135 g). Males have a dark brown head and white breast with a white streak extending up the side of its head. From their back extending down and around their bellies, they have black and white speckled feathers with a yellow patch of feathers just above and behind their feet. Males also have a long, thin tail feather that can measure as much as 10 centimeters (4 inches) long. This feather narrows down to a sharp point and is where they get their name. The female has more of a drab, gray color to her feathers to help camouflage her as she sits on her nest, and her pin tail feather is only about one-quarter the length of the males.

These ducks have bluish-gray bills and they have longer necks than most other dabbling ducks, which makes them superb at feeding in deeper water.

Immature pintails measure from 53 to 68.5 centimeters (21 to 27 inches) and weigh 1 to 3 pounds (454 to 1362 g). Their feathers have more of a buff color to them; their bills are dark; and their heads range in color from dark brown to tan, while their bellies are speckled white and brown. Their tail feathers are dark, with cream colored edges and their feet are grayish green.

(Gooders, Boyer 1986; Soothill, Whitehead 1988; Bellrose 1980)

Range mass: 454 to 1362 g.

Range wingspan: 236 to 282 mm.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Physical Description

The adult male Northern Pintail is between 23 to 30 inches (58.5 to 76 centimeters) in length and weighs 1 to 3 pounds (454 to 1362 Grams). Adult females measure 20 to 25 inches (51 to 63.5 centimeters) and weighs 1 to 2.5 pounds (454 to 1135 g). Males have a dark brown head and white breast with a white streak extending up the side of its head. From their back extending down and around their bellies, they have black and white speckled feathers with a yellow patch of feathers just above and behind their feet. Males also have a long, thin tail feather that can measure as much as 10 centimeters (4 inches) long. This feather narrows down to a sharp point and is where they get their name. The female has more of a drab, gray color to her feathers to help camouflage her as she sits on her nest, and her pin tail feather is only about one-quarter the length of the males.

These ducks have bluish-gray bills and they have longer necks than most other dabbling ducks, which makes them superb at feeding in deeper water.

Immature pintails measure from 53 to 68.5 centimeters (21 to 27 inches) and weigh 1 to 3 pounds (454 to 1362 g). Their feathers have more of a buff color to them; their bills are dark; and their heads range in color from dark brown to tan, while their bellies are speckled white and brown. Their tail feathers are dark, with cream colored edges and their feet are grayish green.

(Gooders, Boyer 1986; Soothill, Whitehead 1988; Bellrose 1980)

Range mass: 454 to 1362 g.

Range wingspan: 236 to 282 mm.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Size

Length: 66 cm

Weight: 1035 grams

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Length: 52.5 cm., Wingspan: 85 cm.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Gulf of Maine - CoML

Source: Gulf of Maine Area Census of Marine Life

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Ecology

Habitat

Cover Requirements

More info for the terms: cover, shrubs

Northern pintails are associated with relatively large water areas
generally exceeding 10 acres (4 ha) [9]. They need exposed water
margins for resting [3]. These ducks prefer open shallow waters and
mudflats for resting and preening [9]. Howard and Kantrud [9] suggest
that optimal winter habitat for northern pintails should contain less
than 30 percent coverage by persistent emergent vegetation. In Texas,
use of wetlands by northern pintails was high if relatively tall
emergent growth covered less than 20 percent of the surface; ponds with
greater than 60 percent coverage by tall emergent growth was used
little. Northern pintails use denser cover at night than is typically
used during the day [9]. Areas with small shrubs, grass, or weeds
provide nesting cover for northern pintails [3].
  • 3. DeGraaf, Richard M.; Scott, Virgil E.; Hamre, R. H.; [and others]
  • 9. Howard, Rebecca J.; Kantrud, Harold A. 1986. Habitat suitability index models: northern pintail (Gulf Coast wintering). Biological Report 82(10.121). Washington, DC: U.S. Department of the Interior, Fish and Wildlife Service. 16 p. [20030]

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Preferred Habitat

More info for the terms: marsh, shrubs, tundra

Breeding habitat - The northern pintail's breeding habitat varies
greatly throughout its geographic range. In general, however, the
northern pintail typically inhabit open country with low vegetation and
many scattered small shallow bodies of water. It frequents lakes,
rivers, marshes, and ponds in grasslands, barrens, dry tundra, open
boreal forest, and cultivated fields [3,10,13]. Areas where water is
lined with trees are avoided, but this duck is often associated with
brushy thickets or aspen (Populus spp.) coppices around sloughs in
western Canada [10,19]. In the arctic, it is found in marshy, low
tundra where shallow freshwater lakes occur, especially those with dense
vegetation along the shoreline [10].

Winter habitat - The northern pintail's winter habitat is also diverse;
they winter on freshwater and brackish coastal marshes, shallow lagoons,
mudflats along rivers, and sheltered marine waters [3,10,13].

Nest - The northern pintail builds its nest in a hollow on dry ground
generally within 300 feet (91 m) of water. These nests are generally
hidden in weeds and grasses or under small shrubs [13,14]. This duck
nests in stubble fields, in a dry portion within a large marsh, or in
lightly grazed pasture but generally avoid nesting in timbered or
extensively brushy areas [3].
  • 3. DeGraaf, Richard M.; Scott, Virgil E.; Hamre, R. H.; [and others]
  • 10. Johnsgard, Paul A. 1979. A guide to North American waterfowl. Bloomington, IN: Indiana University Press. 274 p. [20026]
  • 13. Madge, Steve; Burn, Hilary. 1988. Waterfowl: An indentification guide to the ducks, geese and swans of the world. Boston, MA: Houghton Mifflin Company. 298 p. [20029]
  • 14. Musgrove, Jack W.; Musgrove, Mary R. 1943. Waterfowl in Iowa. Des Moines, IA: State Convservation Committee. 113 p. + index. [20028]
  • 19. Vermeer, Kees. 1970. Some aspects of the nesting of ducks on islands in Lake Newell, Alberta. Journal of Wildlife Management. 34(1): 126-129. [20041]

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Habitat: Cover Types

More info on this topic.

This species is known to occur in association with the following cover types (as classified by the Society of American Foresters):

More info for the term: swamp

12 Black spruce
13 Black spruce - tamarack
16 Aspen
17 Pin cherry
18 Paper birch
19 Gray birch - red maple
38 Tamarack
5 Balsam fir
63 Cottonwood
88 Willow oak - water oak - diamondleaf oak
89 Live oak
91 Swamp chestnut oak - cherrybark oak
95 Black willow
201 White spruce
202 White spruce - paper birch
203 Balsam poplar
204 Black spruce
205 Mountain hemlock
206 Engelmann spruce - subalpine fir
217 Aspen
235 Cottonwood - willow
253 Black spruce - white spruce
254 Black spruce - paper birch
252 Paper birch

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Habitat: Plant Associations

More info on this topic.

This species is known to occur in association with the following plant community types (as classified by Küchler 1964):

More info for the term: bog

K001 Spruce - cedar - hemlock forest
K002 Cedar - hemlock - Douglas-fir forest
K004 Fir - hemlock forest
K005 Mixed conifer forest
K008 Lodgepole pine - subalpine forest
K013 Cedar - hemlock - pine forest
K025 Alder - ash forest
K029 California mixed evergreen forest
K047 Fescue - oatgrass
K048 California steppe
K049 Tule marshes
K050 Fescue - wheatgrass
K051 Wheatgrass - bluegrass
K053 Grama - galleta steppe
K054 Grama - tobosa prairie
K056 Wheatgrass - needlegrass shrubsteppe
K057 Galleta - three-awn shrubsteppe
K058 Grama - tobosa shrubsteppe
K063 Foothills prairie
K064 Grama - needlegrass - wheatgrass
K065 Grama - buffalograss
K066 Wheatgrass - needlegrass
K067 Wheatgrass - bluestem - needlegrass
K068 Wheatgrass - grama - buffalograss
K069 Bluestem - grama prairie
K070 Sandsage - bluestem prairie
K072 Sea oats prairie
K073 Northern cordgrass prairie
K074 Bluestem prairie
K075 Nebraska Sandhills prairie
K076 Blackland prairie
K077 Bluestem - sacahuista prairie
K078 Southern cordgrass prairie
K079 Palmetto prairie
K080 Marl - everglades
K081 Oak savanna
K082 Mosaic of K074 and K100
K088 Fayette prairie
K090 Live oak - sea oats
K091 Cypress savanna
K092 Everglades
K093 Great Lakes spruce - fir forest
K094 Conifer bog
K095 Great Lakes pine forest
K096 Northeastern spruce - fir forest
K097 Southeastern spruce - fir forest
K098 Northern floodplain forest
K100 Oak - hickory forest
K106 Northern hardwoods
K107 Northern hardwoods - fir forest
K108 Northern hardwoods - spruce forest
K109 Transition between K104 and K106
K110 Northeastern oak - pine forest
K111 Oak - hickory - pine forest
K113 Southern floodplain forest

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Associated Plant Communities

Northern pintails commonly inhabit wetland communities dominated by
cattail (Typha spp.), bulrush (Scirpus spp.), whitetop (Scolochloa
festucacea), and other emergent and aquatic vegetation [1,5]. Nests of
these ducks are often found in extensive stands of whitetop, bluegrass
(Poa spp.), or hardstem bulrushes (Scirpus acutus); juncus (Juncus spp.)
beds; mixed prairie grasses; and burned weed areas. Northern pintails
nest in farmland habitats more than other species of waterfowl do.
Stubble fields, roadsides, hayfields, pastures, field edges, and fields
of growing grain are often chosen as nest sites [1].

REFERENCES :
NO-ENTRY
  • 1. Bellrose, Frank C. 1980. Ducks, geese and swans of North America. Harrisburg, PA: Stackpole Books. 3rd ed. 540 p. [19802]
  • 5. Fritzell, Erik K. 1975. Effects of agricultural burning on nesting waterfowl. Canadian Field-Naturalist. 89: 21-27. [14635]

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Habitat: Ecosystem

More info on this topic.

This species is known to occur in the following ecosystem types (as named by the U.S. Forest Service in their Forest and Range Ecosystem [FRES] Type classification):

FRES11 Spruce-fir
FRES14 Oak-pine
FRES15 Oak-hickory
FRES17 Elm-ash-cottonwood
FRES18 Maple-beech-birch
FRES19 Aspen-birch
FRES36 Mountain grasslands
FRES37 Mountain meadows
FRES38 Plains grasslands
FRES39 Prairie
FRES41 Wet grasslands
FRES42 Annual grasslands

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Pintail are found in marshes, ponds, lakes, rivers, canals, and grain fields, such as rice, oats, wheat, and barley.

(Palmer 1976)

Habitat Regions: temperate ; terrestrial

Terrestrial Biomes: forest

Aquatic Biomes: lakes and ponds; rivers and streams

Wetlands: marsh

Other Habitat Features: agricultural ; riparian

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

marshes, ponds, lakes, rivers, canals, grain fields
Creative Commons Attribution 3.0 (CC BY 3.0)

© WoRMS for SMEBD

Source: World Register of Marine Species

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Habitat and Ecology

Habitat and Ecology
Behaviour This species is strongly migratory throughout its northern range1, 2 although some populations in the Southern Hemisphere are sedentary1. It breeds in solitary pairs or loose groups1 from April to June3, with males leaving the breeding areas first from May to early-June to undertake extensive moult migrations (females following later)5. During moult, large sexually segregated3 flocks gather in moulting areas2 (e.g. in the Netherlands and Russia), although small gatherings are also possible5. The flightless moult period lasts for around 4 weeks4, 5 between July and August5 after which flocks move southwards to winter quarters from mid-August onwards3, 5. The species is highly gregarious in winter and on passage, often forming enormous concentrations3, 5 (although the size of flock depends on the size of the wetland)7. It feeds nocturnally6, 8, flocks roosting by day on open water6. Habitat The species shows a preference for open lowland grassland7, prairie or tundra habitats4 containing freshwater, brackish and saline wetlands with shallow water (10-30 cm deep7) to facilitate dabbling2. Wetland habitats include shallow freshwater marshes1, 4, 8, small marshy lakes, slow-flowing rivers1, 3, 4, 8, wet meadows3, flood-plains and sewage ponds (southern Africa)8, especially favouring ponds with low, dense marginal vegetation and wetlands interspersed with brushy thickets or copses4. During the winter it also frequents large inland lakes5, brackish coastal lagoons1, 3, 5, brackish3 and saline marshes18, shallow fresh or brackish estuaries4, 6, 7, tidal flats3 and river deltas5 with adjacent agricultural land (e.g. stubble fields7) and scattered impoundments4. Diet This species is omnivorous1 and opportunistic4, its diet consisting of algae6, seeds8 (e.g. cereals1 and rice6), tubers (e.g. potatoes)1, 6, 8, and the vegetative parts of aquatic plants, sedges1, 8 and grasses6, 8, as well as aquatic invertebrates (e.g. insects, molluscs and crustaceans), amphibians1, 6, 8 and small fish1. Breeding site The nest is a slight hollow on the ground amongst vegetation1 (e.g. rushes, grass or low scrub) and can be close to or more than 1 km away from water2, 7. The species is not normally colonial but neighbours may nest as close as 2-3 m apart2.

Systems
  • Terrestrial
  • Freshwater
  • Marine
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Pintail are found in marshes, ponds, lakes, rivers, canals, and grain fields, such as rice, oats, wheat, and barley.

(Palmer 1976)

Habitat Regions: temperate ; terrestrial

Terrestrial Biomes: forest

Aquatic Biomes: lakes and ponds; rivers and streams

Wetlands: marsh

Other Habitat Features: agricultural ; riparian

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Depth range based on 977 specimens in 1 taxon.
Water temperature and chemistry ranges based on 1 sample.

Environmental ranges
  Depth range (m): 0 - 0
  Temperature range (°C): 10.697 - 10.697
  Nitrate (umol/L): 6.485 - 6.485
  Salinity (PPS): 35.176 - 35.176
  Oxygen (ml/l): 6.197 - 6.197
  Phosphate (umol/l): 0.487 - 0.487
  Silicate (umol/l): 2.811 - 2.811
 
Note: this information has not been validated. Check this *note*. Your feedback is most welcome.
Public Domain

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Comments: BREEDING: Lakes, rivers, marshes and ponds in grasslands, barrens, dry tundra, open boreal forest or cultivated fields. Most breeding associated with seasonal and semipermanent wetlands (Suchy and Anderson 1987). Often nests near freshwater lakes and ponds, but may nest some distance from water. Readily uses stock-watering ponds in North Dakota (Suchy and Anderson 1987); uses all sorts of man-made ponds in Quebec (Belanger and Couture 1989). May nest under cover of low vegetation or in open. Broods use emergent vegetation for escape cover. Nest is a depression lined with plant material and down. NON-BREEDING: In migration and winter in both fresh-water and brackish situations (AOU 1983); prefers shallow, open freshwater lagoons, marshes, and slough in Costa Rica (Stiles and Skutch 1989).

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Marshes, prairies, ponds, lakes, and saltwater bays.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Gulf of Maine - CoML

Source: Gulf of Maine Area Census of Marine Life

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Migration

Non-Migrant: No. All populations of this species make significant seasonal migrations.

Locally Migrant: No. No populations of this species make local extended movements (generally less than 200 km) at particular times of the year (e.g., to breeding or wintering grounds, to hibernation sites).

Locally Migrant: Yes. At least some populations of this species make annual migrations of over 200 km.

Moves northward January-March; arrives in nesting areas in northern U.S. and Canada by early April, northern Alaska mid- to late May. Many continue north to arctic wetlands drought reduces wetlands in prairie pothole region. Migrates south beginning in early August. Arrives in Costa Rica in late September or October, departs in January or February, depending on water levels (Stiles and Skutch 1989). Males may engage in extensive migration to molting areas while females incubate (Johnson and Herter 1989).

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Migrates in flocks.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Gulf of Maine - CoML

Source: Gulf of Maine Area Census of Marine Life

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Trophic Strategy

Food Habits

Northern pintails are surface feeders. They generally feed in shallow
waters of marshes, ponds, and wet meadows or grain fields. They mainly
consume seeds, roots, and leaves of aquatic plants, emergents, and many
terrestrial plants [10,14]. Plants commonly eaten by northern pintails
include pondweeds (Potamogeton spp.), sedges (Carex spp.), smartweed
(Polygonum spp.), fall panicum (Panicum dichotomiflorus), brownseed
paspalum (Paspalum plicatulum), panic grass (Panicum spp.), bulrush,
widgeon grass (Ruppia maritima), chufa (Cyperus spp.), and saltgrass
(Distichlis spp.) [1,3]. Northern pintails eat the grains of wheat,
barley, corn, rice, and oats. On their wintering grounds in Texas,
northern pintails make extensive use of barley and rice grains [1].
Northern pintails also eat a small amount of animal matter such as
minnows, crawfish, fairly shrimp, tadpoles, leeches, worms, snails,
insects, and larvae [3,14,18].
  • 1. Bellrose, Frank C. 1980. Ducks, geese and swans of North America. Harrisburg, PA: Stackpole Books. 3rd ed. 540 p. [19802]
  • 3. DeGraaf, Richard M.; Scott, Virgil E.; Hamre, R. H.; [and others]
  • 10. Johnsgard, Paul A. 1979. A guide to North American waterfowl. Bloomington, IN: Indiana University Press. 274 p. [20026]
  • 14. Musgrove, Jack W.; Musgrove, Mary R. 1943. Waterfowl in Iowa. Des Moines, IA: State Convservation Committee. 113 p. + index. [20028]
  • 18. Bent, Arthur Cleveland. 1962. Life histories of North American wild fowl. Part 1. New York: Dover Publications, Inc. 244 p. [20027]

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Food Habits

Pintail feed on grain fields, including rice, wheat, barley, and oats. They also feed on foods that naturally occur, such alkali and hardstem bulrush seeds, sago pondweeds, insects, cladocera, and widgeon grass.

(Bellrose 1980)

Animal Foods: insects; terrestrial non-insect arthropods

Plant Foods: leaves; seeds, grains, and nuts

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Food Habits

Pintail feed on grain fields, including rice, wheat, barley, and oats. They also feed on foods that naturally occur, such alkali and hardstem bulrush seeds, sago pondweeds, insects, cladocera, and widgeon grass.

(Bellrose 1980)

Animal Foods: insects; terrestrial non-insect arthropods

Plant Foods: leaves; seeds, grains, and nuts

Primary Diet: omnivore

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Comments: Eats various plants and animals, depending on availability. Feeds on seeds and nutlets of aquatic plants (sedges, grasses, pondweeds, smartweeds); also eats mollusks, crabs, minnows, worms, fairy shrimp, and aquatic insects. Animal foods important to females during prelaying and laying periods. Diet of juveniles includes mostly insects (Suchy and Anderson 1987). Dabbles for food; may also feed on waste grain in fields and marine animals on tidal flats.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Seeds and insects. Also will consume, especially in summer, mollusks, crustaceans, tadpoles, and small fish.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Gulf of Maine - CoML

Source: Gulf of Maine Area Census of Marine Life

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Associations

Predators

Northern pintails nest early and in more open sites than other species
of ducks and therefore may suffer greater nest loss from predation.
Predators of northern pintails include humans, crows (Corvus spp.),
skunks (Mephitis spp.), magpies (Pica spp.), gulls (Larus spp.), ground
squirrels (Spermophilus spp.), coyotes (Canis latrans), foxes (Vulpes
spp.), racoons (Procyon lotor), and badgers (Taxidea taxus) [1].
  • 1. Bellrose, Frank C. 1980. Ducks, geese and swans of North America. Harrisburg, PA: Stackpole Books. 3rd ed. 540 p. [19802]

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Predation

People are the main predators of adult pintails, but they are also preyed upon by bobcats and coyotes. To avoid predation they take flight.

Farmers, during the process of working in their fields, destroy nests. Crows, magpies, gulls, skunks, ground squirrels, coyotes, foxes, badgers, and raccoons also destroy nests and eat the eggs.

(Bellrose 1980)

Known Predators:

  • humans (Homo_sapiens)
  • bobcats (Lynx_rufus)
  • coyotes (Canis_latrans)
  • crows (Corvus)
  • magpies (Pica)
  • gulls (Laridae)
  • striped skunks (Mephitis_mephitis)
  • ground squirrels (Spermophilus)
  • red fox (Vulpes_vulpes)
  • badgers (Taxidea_taxus)
  • raccoons (Procyon_lotor)
  • Eurasian badgers (Meles_meles)
  • kit foxes (Vulpes_velox)
  • skunks (Mephitidae)
  • gray fox (Urocyon_cinereoargenteus)
  • American badgers (Taxidea_taxus)

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Predation

People are the main predators of adult pintails, but they are also preyed upon by bobcats and coyotes. To avoid predation they take flight.

Farmers, during the process of working in their fields, destroy nests. Crows, magpies, gulls, skunks, ground squirrels, coyotes, foxes, badgers, and raccoons also destroy nests and eat the eggs.

(Bellrose 1980)

Known Predators:

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Known predators

Creative Commons Attribution 3.0 (CC BY 3.0)

© SPIRE project

Source: SPIRE

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Known prey organisms

Anas acuta preys on:
non-insect arthropods

This list may not be complete but is based on published studies.
Creative Commons Attribution 3.0 (CC BY 3.0)

© SPIRE project

Source: SPIRE

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

General Ecology

Habitat-related Fire Effects

More info for the terms: cover, marsh

Fire can destroy nesting cover used by northern pintails. One study of
agricultural spring burning within Manitoba's pothole region showed that
northern pintails preferred unburned nest cover [5]. Here, fires before
May 10 destroy nesting cover and nests of these ducks. Large-scale
autumn burning can have a detrimental effect on marshes by reducing
their ability to catch and retain drifting snow, which adds heavily to
spring run-off. The ability of marsh vegetation to catch and hold snow
can be vital to marsh survival [17].

The effects of fire on northern pintails are not all negative; fire can
create feeding habitat. According to Hoffpauer [8] it is not uncommon
to see large numbers of northern pintails in recently burned areas on
Louisiana and Texas coastal marshes. On these burns, northern pintails
feed upon small aquatic grubs that have been stirred up by snow geese
(Chen caerulescens). Additionally, fire often removes excessive
accumulations of fast-growing hydrophytes permitting better waterfowl
access and growth of more desirable duck foods. Fire can also convert
forested uplands adjacent to aquatic habitats to grasses and sedges,
thus increasing the nesting potential of some waterfowl [16].
  • 5. Fritzell, Erik K. 1975. Effects of agricultural burning on nesting waterfowl. Canadian Field-Naturalist. 89: 21-27. [14635]
  • 8. Hoffpauier, Clark M. 1968. Burning for coastal marsh management. In: Newsom, John D., ed. Proceedings of the marsh and estuary management symposium; 1967; Baton Rouge, LA. Baton Rouge, LA: Louisiana State University: 134-139. [15274]
  • 16. Vogl, Richard J. 1967. Controlled burning for wildlife in Wisconsin. In: Proceedings, 6th annual Tall Timbers Fire Ecology Conference; 1967 March 6-7; Tallahassee, FL. No. 6. Tallahassee, FL: Tall Timbers Research Station: 47-96. [18726]
  • 17. Ward, P. 1968. Fire in relation to waterfowl habitat of the delta marshes. In: Proceedings, annual Tall Timbers fire ecology conference; 1968 March 14-15; Tallahassee, FL. No. 8. Tallahassee, FL: Tall Timbers Research Station: 255-267. [18932]

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Timing of Major Life History Events

More info for the term: formation

Age at first reproduction - Northern pintails become sexually mature in
their first winter of life, and most females attempt to breed as
yearlings [10].

Pair formation/breeding - Pair formation occurs over several months,
starting on wintering areas in early December and continuing through the
spring migration [10]. Pairs generally arrive on their breeding grounds
in early spring and breed from April through June [13].

Nesting - From South Dakota to Utah and California and north to Brooks,
Alberta; Redvers, Saskatchewan; and the Delta marshes, Manitoba, nesting
begins from early to mid-April. However, cold weather just prior to
nesting may delay initiation by as much as 2 weeks [1]. Farther north,
northern pintails nest later. At Yellowknife, Northwest Territories,
first nests were started as early as May 7 and as late as May 21. On
the Yukon flats, northern pintails began to nest May 8 to 18 [1].

Clutch/incubation and fledging - Northern pintails generally lay between
6 and 12 eggs per nest [14]. The average clutch is eight eggs [10].
Incubation takes 22 to 23 days [14]. The ducklings fledge within 40 to
46 days [10].

Migration - After their postbreeding molt, northern pintails migrate to
wintering grounds from mid-August onwards [13]. While some are leaving
their arctic breeding grounds in Alaska in September others are arriving
on their winter grounds in California, Texas, and Louisiana [1].
Northern pintails in the northern Great Plains region are at their
greatest abundance the first week in September. In the central Great
Plains region they are abundant through September and early October.
Small numbers of northern pintails arrive on Gulf Coast marshes and
lagoons of Louisiana and Texas in September. The number of arrivals is
greatest through October to December. They start to leave their
wintering grounds in late January or early February, and departure
continues through March [1].
  • 1. Bellrose, Frank C. 1980. Ducks, geese and swans of North America. Harrisburg, PA: Stackpole Books. 3rd ed. 540 p. [19802]
  • 10. Johnsgard, Paul A. 1979. A guide to North American waterfowl. Bloomington, IN: Indiana University Press. 274 p. [20026]
  • 13. Madge, Steve; Burn, Hilary. 1988. Waterfowl: An indentification guide to the ducks, geese and swans of the world. Boston, MA: Houghton Mifflin Company. 298 p. [20029]
  • 14. Musgrove, Jack W.; Musgrove, Mary R. 1943. Waterfowl in Iowa. Des Moines, IA: State Convservation Committee. 113 p. + index. [20028]

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Nonbreeding: usually in groups or small flocks associated with teals or wigeon (Stiles and Skutch 1989). Female and brood may move among different ponds during first few weeks after hatching.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Life History and Behavior

Life Expectancy

Lifespan/Longevity

Around three-quarters of hatchlings live long enough to fledge, and not more than half of the remaining birds live to produce young of their own.

(Palmer 1976; Gooders, Boyer 1986)

Average lifespan

Status: wild:
267 months.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Lifespan/Longevity

Around three-quarters of hatchlings live long enough to fledge, and not more than half of the remaining birds live to produce young of their own.

(Palmer 1976; Gooders, Boyer 1986)

Average lifespan

Status: wild:
267 months.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Lifespan, longevity, and ageing

Maximum longevity: 27.4 years (wild) Observations: While animals reach maturity in their first year of life, most do not breed until later (http://www.fs.fed.us/database/feis/).
Creative Commons Attribution 3.0 (CC BY 3.0)

© Joao Pedro de Magalhaes

Source: AnAge

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Reproduction

During courtship, the male, all the while whistling, will swim close to the female with his head down and tail up to impress the hen. If there is a group of males all courting the same female, the males will chase the female in flight. The males will lose track of her one by one, until only one male is left, and to his victory comes the opportunity to leave his legacy. Copulation takes place in the water and the female gets ready by laying her body close to the ground. The male then starts bobbing his head up and down. He then mounts the female and takes the feathers on the back of her head in his mouth. After he finishes, he lifts his head and back up and whistles. (Gooders & Boyer 1986; Soothill & Whitehead 1988; Palmer 1976)

Mating System: monogamous

Mating season is in early May, and if predators destroy the hen’s eggs, she can replace the clutch as late as the end of July, a process called double clutching. Pintail become sexually mature at 1 year old.  (Soothill, Whitehead 1988; Palmer 1976)

A Northern Pintail hen lays 7 to 9 cream colored eggs in May usually laying one egg per day, and the hen alone will incubate them for 22 to 24 days. After the chicks hatch, the hen will lead them to the nearest body of water where they will search for dead insects on the surface of the water. The chicks will attain flight in 46 to 47 days after hatching and the family will stay together until the hen re-grows the feathers needed to fly and she leaves her chicks.

(Soothill, Whitehead 1996; Gooders, Boyer 1986; Bellrose 1980)

Breeding season: Spring and summer

Range eggs per season: 7 to 9.

Range time to hatching: 22 to 24 days.

Range fledging age: 46 to 57 days.

Average age at sexual or reproductive maturity (female): 1 years.

Average age at sexual or reproductive maturity (male): 1 years.

Key Reproductive Features: seasonal breeding ; gonochoric/gonochoristic/dioecious (sexes separate)

Average eggs per season: 8.

Average age at sexual or reproductive maturity (male)

Sex: male:
240 days.

Average age at sexual or reproductive maturity (female)

Sex: female:
240 days.

Parental Investment: precocial ; female parental care

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

During courtship, the male, all the while whistling, will swim close to the female with his head down and tail up to impress the hen. If there is a group of males all courting the same female, the males will chase the female in flight. The males will lose track of her one by one, until only one male is left, and to his victory comes the opportunity to leave his legacy. Copulation takes place in the water and the female gets ready by laying her body close to the ground. The male then starts bobbing his head up and down. He then mounts the female and takes the feathers on the back of her head in his mouth. After he finishes, he lifts his head and back up and whistles. (Gooders & Boyer 1986; Soothill & Whitehead 1988; Palmer 1976)

Mating System: monogamous

Mating season is in early May, and if predators destroy the hen’s eggs, she can replace the clutch as late as the end of July, a process called double clutching. Pintail become sexually mature at 1 year old.  (Soothill, Whitehead 1988; Palmer 1976)

A Northern Pintail hen lays 7 to 9 cream colored eggs in May usually laying one egg per day, and the hen alone will incubate them for 22 to 24 days. After the chicks hatch, the hen will lead them to the nearest body of water where they will search for dead insects on the surface of the water. The chicks will attain flight in 46 to 47 days after hatching and the family will stay together until the hen re-grows the feathers needed to fly and she leaves her chicks.

(Soothill, Whitehead 1996; Gooders, Boyer 1986; Bellrose 1980)

Breeding season: Spring and summer

Range eggs per season: 7 to 9.

Range time to hatching: 22 to 24 days.

Range fledging age: 46 to 57 days.

Average age at sexual or reproductive maturity (female): 1 years.

Average age at sexual or reproductive maturity (male): 1 years.

Key Reproductive Features: seasonal breeding ; gonochoric/gonochoristic/dioecious (sexes separate)

Average eggs per season: 8.

Average age at sexual or reproductive maturity (male)

Sex: male:
240 days.

Average age at sexual or reproductive maturity (female)

Sex: female:
240 days.

Parental Investment: precocial ; female parental care

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Clutch size usually 6-10 in older adults, 5-7 in yearlings. Adults nest earlier than do yearlings (Duncan 1987). Incubation 21-25 days, by female. Males abandon females early in incubation. Precocial nestlings tended by female, male usually present. Young fledge in about 6-7 weeks. Readily lays replacement clutch if first is lost. In Alaska, nutrient reserves were important in the formation of first clutches, more so than for any other duck species that has been studied (Esler and Grand, 1994, Condor 96:422-432). Northern Alaska: 0.3-1.5 nests per sq km in various locations; 1.0-1.8 nests per sq km in prairie pothole country (see Suchy and Anderson 1987).

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Nest is built in short vegetation near water by the female. 6-10 eggs are incubated by the female for 21-25 days. Young feed themselves, and can fly after 38-52 days.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Gulf of Maine - CoML

Source: Gulf of Maine Area Census of Marine Life

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Barcode data: Anas acuta

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There are 12 barcode sequences available from BOLD and GenBank.  Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.  See the BOLD taxonomy browser for more complete information about this specimen and other sequences.

GGCACTCTGTACCTTATCTTCGGGGCATGAGCCGGAATAATTGGCACAGCACTCAGCCTACTGATCCGCGCAGAACTAGGCCAGCCAGGAACCCTCCTAGGCGACGACCAAATTTACAACGTGATCGTCACCGCTCACGCCTTTGTAATAATCTTTTTCATGGTAATGCCCATCATAATTGGGGGATTCGGCAACTGATTGGTCCCCCTAATAATCGGTGCCCCCGACATAGCATTCCCACGAATAAACAACATAAGCTTCTGACTCCTCCCACCATCATTCCTCCTTCTACTTGCCTCATCCACTGTAGAGGCCGGCGCCGGCACAGGTTGAACCGTGTACCCGCCCCTAGCAGGCAACCTGGCCCACGCCGGGGCCTCAGTAGACCTGGCCATCTTCTCACTCCACCTAGCCGGTGTCTCCTCCATCCTCGGAGCCATTAACTTCATCACCACAGCCATTAACATAAAACCCCCCGCACTCTCACAATATCAAACACCACTCTTCGTCTGATCGGTCCTAATTACCGCCATCCTGCTCCTCCTATCACTCCCCGTCCTCGCCGCCGGCATCACAATGCTATTAACCGACCGAAACCTAAACACCACATTCTTTGACCCCGCCGGAGGAGGAGATCCAATCCTATACCAGCACCTATTTTGATTCTTCGGCCACCCAGAAGTCTATATCTTAATCCTCCCAGGATTTGGAATT
-- end --

Download FASTA File
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Statistics of barcoding coverage: Anas acuta

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 14
Specimens with Barcodes: 22
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Conservation

Conservation Status

The Northern Pintail is protected by the Migratory Bird Treaty Act, although there is a general hunting season for the bird throughout the United States.

IUCN Red List of Threatened Species: least concern

US Migratory Bird Act: protected

US Federal List: no special status

CITES: no special status

State of Michigan List: no special status

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

IUCN Red List Assessment


Red List Category
LC
Least Concern

Red List Criteria

Version
3.1

Year Assessed
2009

Assessor/s
BirdLife International

Reviewer/s
Bird, J., Butchart, S.

Contributor/s

Justification
This species has an extremely large range, and hence does not approach the thresholds for Vulnerable under the range size criterion (Extent of Occurrence <20,000 km2 combined with a declining or fluctuating range size, habitat extent/quality, or population size and a small number of locations or severe fragmentation). Despite the fact that the population trend appears to be decreasing, the decline is not believed to be sufficiently rapid to approach the thresholds for Vulnerable under the population trend criterion (>30% decline over ten years or three generations). The population size is extremely large, and hence does not approach the thresholds for Vulnerable under the population size criterion (<10,000 mature individuals with a continuing decline estimated to be >10% in ten years or three generations, or with a specified population structure). For these reasons the species is evaluated as Least Concern.

History
  • 2008
    Least Concern
  • 2004
    Least Concern
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

The Northern Pintail is protected by the Migratory Bird Treaty Act, although there is a general hunting season for the bird throughout the United States.

US Migratory Bird Act: protected

US Federal List: no special status

CITES: no special status

State of Michigan List: no special status

IUCN Red List of Threatened Species: least concern

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Status in Egypt

Regular passage visitor and winter visitor.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Bibliotheca Alexandrina

Source: Bibliotheca Alexandrina - EOL Ar

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

National NatureServe Conservation Status

Canada

Rounded National Status Rank: N5B,N5N : N5B: Secure - Breeding, N5N: Secure - Nonbreeding

United States

Rounded National Status Rank: N5B,N5N : N5B: Secure - Breeding, N5N: Secure - Nonbreeding

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

NatureServe Conservation Status

Rounded Global Status Rank: G5 - Secure

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Possible decline in population since the 1960?s, but no official conservation status.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Gulf of Maine - CoML

Source: Gulf of Maine Area Census of Marine Life

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Population

Population
Total regarded as a minimum by Wetlands International (2006).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Threats

Major Threats
The species is threatened by wetland habitat loss on its breeding and wintering grounds5. Reclamation of coastal areas for industrial development poses a threat in Europe, and major river diversion and irrigation schemes threaten wintering areas in Niger and Nigeria5. The species is also threatened by petroleum pollution, wetland drainage, peat-extraction, changing wetland management practices (decreased grazing and mowing in meadows leading to scrub over-growth) and the burning and mowing of reeds in Russia11. The species suffers from over-exploitation in Europe2, and is hunted for sport in North America9, 10. It also suffers poisoning from lead shot ingestion in North America9, poisoning from white phosphorous (from firearms) ingestion in Alaska18, and reproductive impairment as a result of selenium (Se) accumulation in liver tissues (selenium contained in sub-surface agricultural drain-water used for wetland management in California led to bioaccumulation of the element in the food chain21. The pecies is predated by feral cats Felis catus and rats Rattus norvegicus on islands1, and is susceptible to avian botulism12 and avian influenza13, 17 so may be threatened by future outbreaks of these diseases. Utilisation The species is hunted recreationally in Denmark14 and the Po delta, Italy15, and is hunted commercially and recreationally in Iran16. The eggs of this species used to be (and possibly still are) harvested in Iceland19. The species is also traded at traditional medicine markets in Nigeria20.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Comments: Loss of breeding habitat in the prairies may be sufficient to account for declines of upland-nesting prairie populations (Nudds and Cole 1991).

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Management

Use of Fire in Population Management

More info for the terms: cover, succession

Wetlands can be burned to create nesting edge for waterfowl and reverse
plant succession to a subclimax plant community which is more attractive
to waterfowl. Control of woody encroachment is vital if prairie marshes
are to remain in this successional state [17]. Fire can be used to
reduce predator activity through the elimination of hiding cover.
Fritzell [5] found greater hatching success in burned versus unburned
cover, suggesting a reduction of predator activity in burned areas.

Desirable northern pintail foods such as pondweed can be restored using
fire by removing fast-growing undesirable species such as common reed
(Phragmites australis) [15]. The best way to reduce common reed with
prescribed burning is to burn during the summer when carbohydrate
reserves in the plant are low and when the soil is dry [7].

If prescribed burning is used as a management tool in marshes, burning
must be conducted before or after the nesting season [15,17]. Spring
burning in the Manitoba pothole region must be completed before April 20
when northern pintails start nesting [17].
  • 5. Fritzell, Erik K. 1975. Effects of agricultural burning on nesting waterfowl. Canadian Field-Naturalist. 89: 21-27. [14635]
  • 7. Higgins, Kenneth F.; Kruse, Arnold D.; Piehl, James L. 1989. Effects of fire in the Northern Great Plains. Ext. Circ. EC-761. Brookings, SD: South Dakota State University, Cooperative Extension Service, South Dakota Cooperative Fish and Wildlife Research Unit. 47 p. [14749]
  • 15. Schlichtemeier, Gary. 1967. Marsh burning for waterfowl. In: Proceedings, 6th annual Tall Timbers fire ecology conference; 1967 March 6-7; Tallahassee, FL. No. 6. Tallahassee, FL: Tall Timbers Research Station: 40-46. [16450]
  • 17. Ward, P. 1968. Fire in relation to waterfowl habitat of the delta marshes. In: Proceedings, annual Tall Timbers fire ecology conference; 1968 March 14-15; Tallahassee, FL. No. 8. Tallahassee, FL: Tall Timbers Research Station: 255-267. [18932]

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Management Considerations

Northern pintail nests are especially vulnerable to farming operations
because pintails nest in stubble fields. A study of northern pintails
nesting on the Portage Plains, Manitoba, showed that farming operations
directly destroyed 57 percent of all northern pintail nests in 1956 and
41 percent of all nests in 1957. Losses were caused by cultivation,
disking, mowing, plowing, and harrowing [1].

During drought years, many northern pintails will migrate farther north
to breeding areas of the boreal forests and subarctic and arctic deltas
[1]. Arctic coastal plain wetlands with rich invertebrate food
resources and stable water levels are important for northern pintails
during years of drought in the prairie regions [20].

REFERENCES :
NO-ENTRY
  • 1. Bellrose, Frank C. 1980. Ducks, geese and swans of North America. Harrisburg, PA: Stackpole Books. 3rd ed. 540 p. [19802]
  • 20. Derkson, D. V.; Eldridge, W. D. 1980. Drought displacement of pintails to the Arctic Coast Plain, Alaska. Journal of Wildlife Management. 44: 224-229. [20258]

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Preserve Selection and Design Considerations: In North Dakota, few broods on ponds of less than 0.2 ha; broods tend to use semipermanent wetlands. Habitat suitability index model assumes that optimum conditions exist for pairs when a minimum of 150 optimum wetlands account for a minimum of 65 ha per 259-ha section in prairie pothole country; optimum conditions for broods when at least 20.2 ha of optimum wetlands are present on a 259-ha section and at least 6 optimum wetlands of at least 0.4 ha are present (Suchy and Anderson 1987).

Management Requirements: See Barker et al. (1990) for information on the effects of different livestock grazing systems on nesting success in North Dakota. See Marcy (1986) for specifications for the construction and placement of wire nest baskets.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Relevance to Humans and Ecosystems

Benefits

Economic Importance for Humans: Negative

Like other waterfowl species, Pintail damage grain crops and cost farmers a considerable amount of money every year.

Negative Impacts: crop pest

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Economic Importance for Humans: Positive

Northern Pintail are one of the most sought after ducks by duck hunters throughout their habitat. During duck season, hunters spend lots of money on hunting licenses, sporting goods and travel arrangements to towns that live near the migration flyways, and add a considerable amount of revenue to towns’ economy.

Positive Impacts: food

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Economic Importance for Humans: Negative

Like other waterfowl species, Pintail damage grain crops and cost farmers a considerable amount of money every year.

Negative Impacts: crop pest

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Economic Importance for Humans: Positive

Northern Pintail are one of the most sought after ducks by duck hunters throughout their habitat. During duck season, hunters spend lots of money on hunting licenses, sporting goods and travel arrangements to towns that live near the migration flyways, and add a considerable amount of revenue to towns’ economy.

Positive Impacts: food

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Wikipedia

Northern Pintail

The Pintail or Northern Pintail (Anas acuta) is a duck with wide geographic distribution that breeds in the northern areas of Europe, Asia and North America. It is migratory and winters south of its breeding range to the equator. Unusually for a bird with such a large range, it has no geographical subspecies if the possibly conspecific duck Eaton's Pintail is considered to be a separate species.

This is a large duck, and the male's long central tail feathers give rise to the species' English and scientific names. Both sexes have blue-grey bills and grey legs and feet. The drake is more striking, having a thin white stripe running from the back of its chocolate-coloured head down its neck to its mostly white undercarriage. The drake also has attractive grey, brown, and black patterning on its back and sides. The hen's plumage is more subtle and subdued, with drab brown feathers similar to those of other female dabbling ducks. Hens make a coarse quack and the drakes a flute-like whistle.

The Northern Pintail is a bird of open wetlands which nests on the ground, often some distance from water. It feeds by dabbling for plant food and adds small invertebrates to its diet during the nesting season. It is highly gregarious when not breeding, forming large mixed flocks with other species of duck. This duck's population is affected by predators, parasites and avian diseases. Human activities, such as agriculture, hunting and fishing, have also had a significant impact on numbers. Nevertheless, this species' huge range and large population mean that it is not threatened globally.

Contents

Taxonomy

This species was first described by Linnaeus in his Systema naturae in 1758 as Anas acuta[2] The scientific name comes from two Latin words: anas, meaning "duck", and acuta, which comes from the verb acuere, which means "sharpen"; the species term, like the English name, refers to the pointed tail of the male in breeding plumage.[3] Within the large dabbling duck genus Anas,[2] the Northern Pintail's closest relatives are other pintails, such as the Yellow-billed Pintail (A. georgica) and Eaton's Pintail (A. eatoni). The pintails are sometimes separated in the genus Dafila (described by Stephens, 1824), an arrangement supported by morphological, molecular and behavioural data.[4][5][6] The famous British ornithologist Sir Peter Scott gave this name to his daughter, the artist Dafila Scott.[7]

Eaton's Pintail has two subspecies, A. e. eatoni (the Kerguelen Pintail) of Kerguelen Islands, and A. e. drygalskyi (the Crozet Pintail) of Crozet Islands, and was formerly considered conspecific with the northern hemisphere's Northern Pintail. Sexual dimorphism is much less marked in the southern pintails, with the male's breeding appearance being similar to the female plumage. Unusually for a species with such a large range, Northern Pintail has no geographical subspecies if Eaton's Pintail is treated as a separate species.[8] A claimed extinct subspecies from Manra Island, Tristram's Pintail, A. a. modesta, appears to be indistinguishable from the nominate form.[9]

Description

Male in river Ljubljanica, Slovenia

The Northern Pintail is a fairly large duck with a wing chord of 23.6–28.2 cm (9.3–11.1 in) and wingspan of 80–95 cm (31–37 in).[10] The male is 59–76 cm (23–30 in) in length and weighs 450–1360 grammes (1–3 lb), and therefore is considerably larger than the female, which is 51–64 cm (20–25 in) long and weighs 454–1135 grammes (1–2.5 lb).[11] The Northern Pintail broadly overlaps in size with the similarly-widespread Mallard, but is more slender, elongated and gracile, with a relatively longer neck and (in males) a longer tail. The unmistakable breeding plumaged male has a chocolate-brown head and white breast with a white stripe extending up the side of the neck. Its upperparts and sides are grey, but elongated grey feathers with black central stripes are draped across the back from the shoulder area. The vent area is yellow, contrasting with the black underside of the tail,[8] which has the central feathers elongated to as much as 10 centimetres (4 in). The bill is bluish and the legs are blue-grey.[12]

The adult female is mainly scalloped and mottled in light brown with a more uniformly grey-brown head, and its pointed tail is shorter than the male's; it is still easily identified by its shape, long neck, and long grey bill.[8] In non-breeding (eclipse) plumage, the drake Pintail looks similar to the female, but retains the male upperwing pattern and long grey shoulder feathers. Juvenile birds resemble the female, but are less neatly scalloped and have a duller brown speculum with a narrower trailing edge.[13]

The Pintail walks well on land, and swims well.[8] It has a very fast flight, with its wings slightly swept-back, rather than straight out from the body like other ducks. In flight, the male shows a black speculum bordered white at the rear and pale rufous at the front, whereas the female's speculum is dark brown bordered with white, narrowly at the front edge but very prominently at the rear, being visible at a distance of 1600 metres (1 mi).[13]

The male's call is a soft proop-proop whistle, similar to that of the Common Teal, whereas the female has a Mallard-like descending quack, and a low croak when flushed.[8]

Distribution and habitat

Non-breeding males wintering in India

This dabbling duck breeds across northern areas of Eurasia south to about Poland and Mongolia,[11] and in Canada, Alaska and the Midwestern United States. It winters mainly south of its breeding range, reaching almost to the equator in Panama, northern sub-Saharan Africa and tropical South Asia. Small numbers migrate to Pacific islands, particularly Hawaii, where a few hundred birds winter on the main islands in shallow wetlands and flooded agricultural habitats.[8] Transoceanic journeys also occur: a bird that was caught and ringed in Labrador, Canada, was shot by a hunter in England nine days later,[11] and Japanese-ringed birds have been recovered from six US states east to Utah and Mississippi.[14] In parts of the range, such as Great Britain and the northwestern United States, the Pintail may be present all year.[13][15]

The Northern Pintail's breeding habitat is open unwooded wetlands, such as wet grassland, lakesides or tundra. In winter, it will utilise a wider range of open habitats, such as sheltered estuaries, brackish marshes and coastal lagoons. It is highly gregarious outside the breeding season and forms very large mixed flocks with other ducks.[8]

Behaviour

Breeding

Breeding pair

Both sexes reach sexual maturity at one year of age. The male mates with the female by swimming close to her with his head lowered and tail raised, continually whistling. If there is a group of males, they will chase the female in flight until only one drake is left. The female prepares for copulation, which takes place in the water, by lowering her body; the male then bobs his head up and down and mounts the female, taking the feathers on the back of her head in his mouth. After mating, he raises his head and back and whistles.[11]

Breeding takes place between April and June, with the nest being constructed on the ground and hidden amongst vegetation in a dry location, often some distance from water. It is a shallow scrape on the ground lined with plant material and down.[8] The female lays seven to nine cream-coloured eggs at the rate of one per day;[11] the eggs are 55 x 38 millimetres (2.2 x 1.5 in) in size and weigh 45 grammes (1.6 oz), of which 7% is shell.[16] If predators destroy the first clutch, the female can produce a replacement clutch as late as the end of July.[11]

The hen alone incubates the eggs for 22 to 24 days before they hatch. The precocial downy chicks are then led by the female to the nearest body of water, where they feed on dead insects on the water surface. The chicks fledge in 46 to 47 days after hatching, but stay with the female until she has completed moulting.[11]

Around three-quarters of chicks live long enough to fledge, but not more than half of those survive long enough to reproduce.[11] The maximum recorded age is 27 years and 5 months for a Dutch bird.[16]

Feeding

Up-ending to feed (male on right)

The Pintail feeds by dabbling and upending in shallow water for plant food mainly in the evening or at night, and therefore spends much of the day resting.[8] Its long neck enables it to take food items from the bottom of water bodies up to 30 centimetres (1 ft) deep, which are beyond the reach of other dabbling ducks like the Mallard.[12]

The winter diet is mainly plant material including seeds and rhizomes of aquatic plants, but the Pintail sometimes feeds on roots, grain and other seeds in fields, though less frequently than other Anas ducks.[12] During the nesting season, this bird eats mainly invertebrate animals, including aquatic insects, molluscs and crustaceans.[11]

Health

Male preening

Pintail nests and chicks are vulnerable to predation by mammals, such as foxes and badgers, and birds like gulls, crows and magpies. The adults can take flight to escape terrestrial predators, but nesting females in particular may be surprised by large carnivores such as bobcats.[11] Large birds of prey, such as Northern Goshawks, will take ducks from the ground, and some falcons, including the Gyrfalcon, have the speed and power to catch flying birds.[17]

It is susceptible to a range of parasites including Cryptosporidium, Giardia, tapeworms, blood parasites and external feather lice,[18][19][20][21] and is also affected by other avian diseases. It is often the dominant species in major mortality events from avian botulism and avian cholera,[22] and can also contract avian influenza, the H5N1 strain of which is highly pathogenic and occasionally infects humans.[23]

The Northern Pintail is a popular species for game shooting because of its speed, agility, and excellent eating qualities, and is hunted across its range.[24][25] Although one of the world's most numerous ducks,[16] the combination of hunting with other factors has led to population declines, and local restrictions on hunting have been introduced at times to help conserve numbers.[26]

This species' preferred habitat of shallow water is naturally susceptible to problems such as drought or the encroachment of vegetation, but this duck's habitat might be increasingly threatened by climate change.[16] Populations are also affected by the conversion of wetlands and grassland to arable crops, depriving the duck of feeding and nesting areas. Spring planting means that many nests of this early breeding duck are destroyed by farming activities,[27] and a Canadian study showed that more than half of the surveyed nests were destroyed by agricultural work such as ploughing and harrowing.[28]

Female

Hunting with lead shot, along with the use of lead sinkers in angling, has been identified as a major cause of lead poisoning in waterfowl, which often feed off the bottom of lakes and wetlands where the shot collects.[29] A Spanish study showed that Northern Pintail and Common Pochard were the species with the highest levels of lead shot ingestion, higher than in northern countries of the western Palearctic flyway, where lead shot has been banned.[30] In the United States, Canada, and many western European countries, all shot used for waterfowl must now be non-toxic, and therefore may not contain any lead.[31][32][33]

Status

The Northern Pintail has a large range, estimated at 28.4 million square kilometres (11 million sq mi), and a population estimated at 5.3–5.4 million individuals.[34] It is therefore not believed to meet the IUCN Red List threshold criterion of a population decline of more than 30% in ten years or three generations, and is evaluated as Least Concern.

In the Palaearctic, breeding populations are declining in much of the range, including its stronghold in Russia. In other regions, populations are stable or fluctuating.[35]

Pintails in North America at least have been badly affected by avian diseases, with the breeding population falling from more than 10 million in 1957 to 3.5 million by 1964. Although the species has recovered from that low point, the breeding population in 1999 was 30% below the long-term average, despite years of major efforts focused on restoring the species. In 1997, an estimated 1.5 million water birds, the majority being Northern Pintails, died from avian botulism during two outbreaks in Canada and Utah.[22]

The Northern Pintail is one of the species to which the Agreement on the Conservation of African-Eurasian Migratory Waterbirds (AEWA) applies,[36] but it has no special status under the Convention on International Trade in Endangered Species of Wild Fauna and Flora (CITES), which regulates international trade in specimens of wild animals and plants.[11]

References

  1. ^ BirdLife International (2012). "Anas acuta". IUCN Red List of Threatened Species. Version 2012.1. International Union for Conservation of Nature. Retrieved 16 July 2012. 
  2. ^ a b (Latin) Linnaeus, Carolus (1758). Systema naturae per regna tria naturae, secundum classes, ordines, genera, species, cum characteribus, differentiis, synonymis, locis. Tomus I. Editio decima, reformata. Holmiae. (Laurentii Salvii). p. 126. "A. cauda acuminata elongata subtus nigra, occipite utrinque linea alba" 
  3. ^ uk.rec.birdwatching, scientific bird names explained. Retrieved 13 January 2008
  4. ^ Johnson, Kevin P.; Sorenson, Michael D. (1999). "Phylogeny and biogeography of dabbling ducks (genus Anas): a comparison of molecular and morphological evidence". The Auk 116 (3): 792–805. doi:10.2307/4089339. 
  5. ^ Johnson, Kevin P.; McKinney, Frank; Wilson, Robert; Sorenson, Michael D. (2000). "The evolution of postcopulatory displays in dabbling ducks (Anatini): a phylogenetic perspective". Animal Behaviour 59 (5): 953–963. doi:10.1006/anbe.1999.1399. PMID 10860522. 
  6. ^ Livezey, B. C. (1991). "A phylogenetic analysis and classification of recent dabbling ducks (Tribe Anatini) based on comparative morphology". The Auk 108 (3): 471–507. doi:10.2307/4088089. 
  7. ^ "Dafila Scott". Society of Wildlife Artists. Archived from the original on 19 July 2001. Retrieved 16 January 2008. 
  8. ^ a b c d e f g h i Madge, Steve; Burn, Hilary (1988). Wildfowl: An Identification Guide to the Ducks, Geese and Swans of the World (Helm Identification Guides). Christopher Helm. pp. 222–224. ISBN 0-7470-2201-1. 
  9. ^ Hume, Julian P; Walters, Michael (2012). Extinct Birds. London: Poyser. p. 50. ISBN 1-4081-5725-X. 
  10. ^ del Hoyo, J., Elliott, A. and Sargatal, J. (1992) Handbook of the Birds of the World. Volume 1: Ostrich to Ducks. Lynx Edicions, Barcelona.
  11. ^ a b c d e f g h i j k Robinson, Jerry; Johansson, Carl (editor) (2002). "Anas acuta". Animal Diversity Web. University of Michigan Museum of Zoology. Retrieved 13 January 2008. 
  12. ^ a b c Gooders, John; Boyer, Trevor (1997). Ducks of Britain and the Northern Hemisphere. Collins & Brown. pp. 58–61. ISBN 1-85585-570-4. 
  13. ^ a b c Mullarney, Killian; Svensson, Lars, Zetterstrom, Dan; Grant, Peter. (2001). Birds of Europe. Princeton University Press. pp 48–9 ISBN 0-691-05054-6
  14. ^ Towell, Larry (23 January 2008). "From Tokyo to Tupelo". ESPN Outdoors News. ESPN Outdoors. Retrieved 23 January 2008. 
  15. ^ "Northern Pintail species description". Bird Guide. Cornell Lab of Ornithology. Retrieved 14 January 2008. 
  16. ^ a b c d "Pintail Anas acuta [Linnaeus, 1758]". BTOWeb BirdFacts. British Trust for Ornithology. Retrieved 13 January 2008. 
  17. ^ Forsman, Dick (2008). The Raptors of Europe & the Middle East A Handbook of Field Identification. Princeton University Press. pp. 21–25. ISBN 0-85661-098-4. 
  18. ^ Kuhn, Ryan C.; Rock, Channah M; Oshima, Kevin H. (January 2002). "Occurrence of Cryptosporidium and Giardia in Wild Ducks along the Rio Grande River Valley in Southern New Mexico". Applied Environmental Microbiology 68 (1): 161–165. doi:10.1128/AEM.68.1.161-165.2002. PMC 126547. PMID 11772622. 
  19. ^ "Cotugnia fastigata". Parasite species summary page. Retrieved 14 January 2008. 
  20. ^ Williams, NA; Calverley, BK; Mahrt JL (1977). "Blood parasites of mallard and pintail ducks from central Alberta and the Mackenzie Delta, Northwest Territories". Journal of Wildlife Diseases 13 (3): 226–229. PMID 410954. 
  21. ^ "Feather Lice Infection in Waterfowl". Retrieved 14 January 2008. 
  22. ^ a b Friend, Milton; McLean, Robert G; Dein, F. Joshua (April 2001). "Disease emergence in birds: Challenges for the twenty-first century". The Auk 118 (2): 290–303. doi:10.1642/0004-8038(2001)118[0290:DEIBCF]2.0.CO;2. 
  23. ^ "Avian influenza tests complete on wild northern pintail ducks in Montana". News release No. 0402.06. U.S. Department of Agriculture. Retrieved 14 January 2008. 
  24. ^ Marrone, Teresa (2000). Dressing & Cooking Wild Game (Complete Hunter). Creative Publishing International. p. 123. ISBN 0-86573-108-X. 
  25. ^ Cocker, Mark; Mabey, Richard (2005). Birds Britannica. London: Chatto & Windus. ISBN 0-7011-6907-9.  p97
  26. ^ "U.S. Fish and Wildlife Service Proposes Duck Hunting Regulations, Limited Canvasback Season Re-Opened". News Release 1 August 2003. U.S. Fish and Wildlife Service. Archived from the original on 20 August 2007. Retrieved 15 January 2008. 
  27. ^ "Losing ground: The top 10 common birds in decline" (PDF). Common birds in decline; a state of the birds report, summer 2007. Audubon. Retrieved 15 January 2008. 
  28. ^ "Index of Species Information". Wildlife species: Anas acuta. USDA Forest Service. Retrieved 15 January 2008. 
  29. ^ Scheuhammer, A.M.; Norris, S. L. (1996). "The ecotoxicology of lead shot and lead fishing weights". Ecotoxicology 5 (5): 279–295. doi:10.1007/BF00119051. 
  30. ^ Mateo, Rafael; Martínez-Vilalta, Albert; Guitart, Raimon (1997). "Lead shot pellets in the Ebro delta, Spain: Densities in sediments and prevalence of exposure in waterfowl". Environmental Pollution 96 (3): 335–341. doi:10.1016/S0269-7491(97)00046-8. PMID 15093399. 
  31. ^ "Service continues to expand non-toxic shot options". U.S. Fish and Wildlife Service. 25 October 2000. Retrieved 15 January 2008. 
  32. ^ "Crunch time for lead shot ban". New Scientist. 5 April 1997. Retrieved 15 January 2008. 
  33. ^ "Lead & Non-Lead Shot". British Association for Shooting and Conservation. Retrieved 15 January 2008. 
  34. ^ "Northern Pintail Anas acuta". BirdLife International. Retrieved 16 April 2011. 
  35. ^ Snow, David; Perrins, Christopher M (editors) (1998). The Birds of the Western Palearctic concise edition (2 volumes). Oxford: Oxford University Press. pp. 222–225. ISBN 0-19-854099-X. 
  36. ^ "Annex 2: Waterbird species to which the Agreement applies" (PDF). Agreement on the conservation of African-Eurasian migratory Waterbirds (AEWA). AEWA. Retrieved 13 January 2008. 
Creative Commons Attribution Share Alike 3.0 (CC BY-SA 3.0)

 

Source: Wikipedia

Unreviewed

Article rating from 0 people

Average rating: 2.5 of 5

Names and Taxonomy

Taxonomy

Comments: See Livezey (1991) for a phylogenetic analysis and classification (supergenera, subgenera, infragenera, etc.) of dabbling ducks based on comparative morphology. Kerguelen Islands Duck (A. EATONI, including A. DRYGALSKII), split from Acuta (AOU 1997).

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!