Overview

Brief Summary

Biology

Very little is known about the biology of the Philippine hawk-eagle, possibly due to its habit of perching in the canopy, concealed with foliage (4). However, it soars frequently, and its presence is often revealed by its distinctive two-note call given in flight or while perched (4). Whilst its diet has not been recorded, like other birds of prey it is likely to use its powerful, hooked bill and long, sharp talons to kill a variety of forest animals.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Description

While only a medium-sized hawk-eagle, this inhabitant of the Philippines has a striking appearance due to its long crest of four or five feathers, up to seven centimetres long, protruding from its crown (4). The plumage on the upperparts is dark brown, and the dark brown tail is striped with four to five darker, narrow bands. The head and underparts are reddish-brown with black streaking, and the throat is whitish (4) (5). The wings are broad and rounded and barred flight feathers can be seen in flight (5). There are two subspecies of the Philippine hawk-eagle: S.p. philippensis and S.p. pinskeri. Some believe that due to genetic and morphological differences S.p. pinskeri should be upgraded to the species level, Pinsker's hawk-eagle S. pinskeri (6), although this has not yet been fully accepted (1). S.p. philippensis is larger and darker below and has an unbarred reddish-brown lower belly. S.p. pinskeri is smaller, lighter below, and has a barred brown, black and white belly (4).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Distribution

Range Description

Spizaetus philippensis is endemic to the northern Philippines, where there have been records from 15 localities on Luzon (primarily in the Sierra Madre mountains) since 1980, and on Mindoro (Collar et al. 1999). It is uncommon in the Sierra Madre lowlands, very scarce on Mindoro, and is very probably already extinct on some smaller islands within its former range. In the late 1990s 200-220 pairs were estimated to remain on Luzon (Preleuthner and Gamauf 1998).

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Range

Endemic to the Philippines, whereit has been recorded on at least 12 islands, including Luzon, Mindoro, Mindanao, Negros, Samar, Basilan, Bohol and Leyte (7).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Physical Description

Type Information

Type for Spizaetus philippensis
Catalog Number: USNM 578113
Collection: Smithsonian Institution, National Museum of Natural History, Department of Vertebrate Zoology, Division of Birds
Sex/Stage: Female;
Preparation: Skin: Whole
Collector(s): D. Rabor
Year Collected: 1963
Locality: Car-Can-Mad-Lan area, Surigao Del Sur, Mindanao, Philippines, Asia
Elevation (m): 305 to 640
  • Type: Preleuthner & Gamauf, A. June 1998. Journal of Raptor Research. 32 (2): 126-135.
Creative Commons Attribution 3.0 (CC BY 3.0)

© Smithsonian Institution, National Museum of Natural History, Department of Vertebrate Zoology, Division of Birds

Source: National Museum of Natural History Collections

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Ecology

Habitat

Habitat and Ecology

Habitat and Ecology
It inhabits primary, selectively logged and disturbed forest, occasionally frequenting open areas, from the lowlands to lower mountain slopes, almost exclusively below 1,000 m. It appears not to tolerate much forest degradation. No migration is known, although unconfirmed reports from the migration funnel of Dalton Pass (Luzon) hint at intra-island movements.


Systems
  • Terrestrial
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

The Philippine hawk-eagle inhabits forest, from the lowlands up to montane mossy forest at 1,900 meters (2) (4). As well as primary forest it has been recorded in disturbed and selectively logged forest (7).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Barcode data: Spizaetus philippensis

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There is 1 barcode sequence available from BOLD and GenBank.

Below is the sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.

See the BOLD taxonomy browser for more complete information about this specimen.

Other sequences that do not yet meet barcode criteria may also be available.

CTTTGGCGCCTGAGCCGGCATGGTCGGCACCGCCCTCAGCCTACTCATCCGCGCAGAACTCGGCCAACCAGGCACTCTCCTAGGCGATGACCAAATCTACAACGTAGTCGTCACCGCCCATGCTTTCGTAATAATCTTCTTCATAGTTATACCAATCATAATCGGAGGCTTCGGAAACTGACTTGTCCCACTCATAATCGGCGCCCCTGACATAGCCTTCCCACGCATAAACAACATAAGCTTCTGACTACTCCCCCCATCCTTCCTTCTCCTACTAGCCTCCTCGACAGTAGAAGCAGGAGCTGGTACCGGATGAACAGTCTATCCCCCGCTAGCTGGTAACATAGCTCACGCCGGAGCTTCAGTAGACCTAGCCATCTTTTCTCTACATCTAGCAGGGATCTCGTCCATCCTAGGGGCAATCAACTTCATCACAACCGCCATTAACATAAAACCCCCAGCCCTCTCTCAATACCAGACACCCCTATTCGTTTGATCCGTCCTCATTACCGCCGTCCTACTACTACTCTCACTCCCCGTCCTAGCTGCTGGCATCACCATACTTCTCACAGACCGAAACCTTAACACAACATTCTTCGACCCTGCCGGTGGCGGCGATCCAGTCCTGTACCAACACCTCTTCTGGTTCTTCGGACACCCCGAAGTCTACATCCTAATTCTAC
-- end --

Download FASTA File

Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Statistics of barcoding coverage: Spizaetus philippensis

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 1
Specimens with Barcodes: 1
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Conservation

Conservation Status

IUCN Red List Assessment


Red List Category
EN
Endangered

Red List Criteria
A2cd+3cd+4cd

Version
3.1

Year Assessed
2014

Assessor/s
BirdLife International

Reviewer/s
Butchart, S.

Contributor/s
Allen, D. & Ibanez, J.

Justification
This newly-split forest eagle qualifies as Endangered because its very small population, of which the majority is in two main subpopulations, is undergoing a continuing and very rapid decline owing to lowland forest loss, exacerbated by hunting and trade.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Status

Classified as Vulnerable (VU) on the IUCN Red List (1), and listed on Appendix II of CITES (3).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Population

Population
The species stronghold appears to be Luzon where 200-220 pairs were estimated in the late 1990s (Preleuthner and Gamauf 1998). Given that rapid declines have presumably continued since then, a preliminary population estimate is of a total of 400-600 mature individuals, roughly equating to 600-900 individuals.

Population Trend
Decreasing
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Threats

Major Threats
Deforestation for plantation agriculture, livestock and logging throughout its extensive, predominantly lowland range is the chief threat. In 1988, forest cover was as low as 24% on Luzon, which is likely to be an overestimate, with most lowland forest leased to logging concessions. Habitat loss is exacerbated by considerable hunting and trapping pressure.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Dependent on forests in which to forage and breed, the Philippine hawk-eagle is likely to be threatened by habitat destruction throughout its predominantly lowland range (7). Forest cover in the Philippines has been drastically reduced; for example, on Mindanao, only 29 percent of the forest cover remains, while on Bohol just six percent is still standing (8). These remnant forest patches continue to be cleared, with most remaining forests being leased to logging concessions or covered by mining applications, the acceptance of which would give companies the right to clear forests (8). The impact of habitat loss is being compounded by significant hunting and trapping pressure (7).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Management

Conservation Actions

Conservation Actions
Conservation Actions Underway
CITES Appendix II. It has been recorded recently from numerous protected areas, including Mts Isarog and Makiling National Parks, the Northern Sierra Madre Natural Park and Bataan Natural Park/Subic Bay and recently on Mount Irid-Angilo-Binuang of the Southern Sierra Madre in Luzon (J. Ibanez in litt. 2007), as well as Tadao Ilocos Norte, Mt Palay Palay and Mt Banahao (D. Allen in litt. 2012). These sites are legally protected through local government decrees, but the efficacy of this legislation is often unclear and is ineffective at Mt Malindang and in the Southern Sierra Madre (D. Allen in litt. 2012). The species is regularly recorded during surveys for Philippine Eagle Pithecophaga jeffreyi in Luzon (J. Ibanez in litt. 2007).

Conservation Actions Proposed
Conduct further surveys in areas from which the species is known (e.g. Mt Los Dos Cuernos on Luzon), which may merit formal protection. Study the species's ecology, particularly home-range size and dispersal ability to help inform a global population estimate and assess the likely impact of habitat fragmentation. Promote more effective enforcement of legislation designed to control hunting and trading. Gazette the proposed Southern Sierra Madre Protected Landscape. Use remote-sensing to assess forest loss in the Philippines and gauge the species's likely rate of decline and degree of fragmentation of its populations. Research hunting and trade by interviewing local people and visiting wildlife markets.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Conservation

The Philippine hawk-eagle is listed on Appendix II of the Convention on International Trade in Endangered Species (CITES), which means that any international trade in this species should be carefully controlled in order to be compatible with its continued survival (3). However, more effective legislation is required to control hunting and trading within the Philippines (5). In addition, while the Philippine hawk-eagle has been recorded from numerous protected areas, the degree of protection these sites actually afford is unclear and there may be further important sites, the protection of which would greatly benefit this magnificent bird of prey (5).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Wikipedia

Philippine hawk-eagle

The Philippine hawk-eagle (Nisaetus philippensis), earlier treated under Spizaetus,[2] is a species of bird of prey in the Accipitridae family. Many taxonmists consider the Pinsker's hawk-eagle, a former subspecies, raised to full species status.[3][4][5] It is endemic to the Philippines.

Its natural habitat is subtropical or tropical moist lowland forests. It is threatened by habitat loss.

References[edit]

  1. ^ BirdLife International (2014). "Nisaetus philippensis". IUCN Red List of Threatened Species. Version 2014.3. International Union for Conservation of Nature. Retrieved 17 December 2014. 
  2. ^ Helbig AJ, Kocum A, Seibold I & Braun MJ (2005) A multi-gene phylogeny of aquiline eagles (Aves: Accipitriformes) reveals extensive paraphyly at the genus level. Molecular phylogenetics and evolution 35(1):147-164 PDF
  3. ^ Gamauf A, Gjershaug JO, Rov N, Kvaly K and Haring E (2005). "Species or subspecies? The dilemma of taxonomic ranking of some South-East Asian hawk-eagles (genus Spizaetus)". Bird Conservation International 15: 99–117. doi:10.1017/S0959270905000080. 
  4. ^ Gamauf A, Preleuthner M & W. Pinsker (1998). "Distribution and field identification of Philippine birds of prey: 1. Philippine Hawk-Eagle (Spizaetus philippensis) and Changeable Hawk Eagle (Spizaetus cirrhatus)" (PDF). Forktail 14: 1–11. 
  5. ^ Preleuthner, M. and Gamauf, A. (1998). "A possible new subspecies of the Philippine Hawk-eagle (Spizaetus philippensis) and its future prospects." (PDF). J. Raptor Res. 32 (2): 126–135. 
Creative Commons Attribution Share Alike 3.0 (CC BY-SA 3.0)

Source: Wikipedia

Unreviewed

Article rating from 0 people

Default rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!