Ecology
Habitat
Molecular Biology and Genetics
Molecular Biology
Statistics of barcoding coverage: Spizaetus nipalensis
Barcode of Life Data Systems (BOLDS) Stats
Public Records: 0
Specimens with Barcodes: 6
Species With Barcodes: 1
Public Records: 0
Specimens with Barcodes: 6
Species With Barcodes: 1
Trusted
Barcode data: Nisaetus nipalensis
The following is a representative barcode sequence, the centroid of all available sequences for this species.

There are 2 barcode sequences available from BOLD and GenBank. Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species. See the BOLD taxonomy browser for more complete information about this specimen and other sequences.
Download FASTA File
There are 2 barcode sequences available from BOLD and GenBank. Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species. See the BOLD taxonomy browser for more complete information about this specimen and other sequences.
AATCGATGACTATTCTCAACCAACCACAAAGACATCGGCACTCTATACCTAATCTTTGGCGCCTGGGCTGGCATAGTTGGTACCGCCCTTAGCCTACTTATCCGCGCAGAACTCGGCCAACCGGGTACCCTCCTGGGCGAT---GACCAAATCTACAATGTAGTCGTCACTGCCCATGCTTTCGTAATAATCTTCTTCATAGTCATACCAATCATAATCGGAGGCTTTGGAAACTGACTTGTCCCACTCATAATCGGCGCCCCTGACATAGCCTTCCCACGCATAAACAACATAAGCTTCTGACTACTCCCCCCATCCTTCCTCCTCCTACTAGCCTCTTCAACAGTAGAAGCCGGGGCTGGCACCGGATGAACAGTCTACCCTCCACTAGCTAGCAACATAGCCCATGCTGGCGCCTCAGTAGACTTGGCCATCTTTTCTCTACACCTAGCAGGAATCTCATCCATCTTAGGGGCAATCAACTTCATCACAACCGCTATTAACATAAAACCTCCAGCCCTCTCTCAGTACCAAACGCCCCTATTCGTCTGATCTGTACTCATCACCGCTGTCCTACTACTACTCTCACTCCCCGTCCTAGCTGCCGGCATTACTATATTACTCACAGACCGAAACCTCAACACAACATTCTTCGACCCCGCCGGCGGCGGTGACCCGGTCCTGTACCAACACCTCTTTTGATTCTTCGGTCACCCTGAAGTCTACATCCTAATTCTACCAGGCTTTGGAATCATCTCTCACGTAGTGACATACTACGCAGGCAAAAAAGAACCATTCGGCTACATAGGAATAGTCTGAGCCATACTATCTATCGGATTCCTGGGTTTCATCGTATGAGCCCACCATATATTTACAGTAGGTATAGACGTAGACACCCGAG
-- end --
-- end --
Download FASTA File
Trusted
Statistics of barcoding coverage: Nisaetus nipalensis
Barcode of Life Data Systems (BOLDS) Stats
Public Records: 2
Specimens with Barcodes: 2
Species With Barcodes: 1
Public Records: 2
Specimens with Barcodes: 2
Species With Barcodes: 1
Trusted
Conservation
Conservation Status
IUCN Red List Assessment
Red List Category
LC
Least Concern
Red List Criteria
Version
3.1
Year Assessed
2009
Assessor/s
BirdLife International
Reviewer/s
Bird, J., Butchart, S.
Contributor/s
Justification
This species has an extremely large range, and hence does not approach the thresholds for Vulnerable under the range size criterion (Extent of Occurrence <20,000 km2 combined with a declining or fluctuating range size, habitat extent/quality, or population size and a small number of locations or severe fragmentation). Despite the fact that the population trend appears to be decreasing, the decline is not believed to be sufficiently rapid to approach the thresholds for Vulnerable under the population trend criterion (>30% decline over ten years or three generations). The population size may be moderately small to large, but it is not believed to approach the thresholds for Vulnerable under the population size criterion (<10,000 mature individuals with a continuing decline estimated to be >10% in ten years or three generations, or with a specified population structure). For these reasons the species is evaluated as Least Concern.
History
- 2008Least Concern
- 2004Least Concern
Trusted

