Ecology

Habitat

Habitat and Ecology

Systems
  • Terrestrial
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Statistics of barcoding coverage: Spizaetus nipalensis

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 0
Specimens with Barcodes: 6
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Barcode data: Nisaetus nipalensis

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There are 2 barcode sequences available from BOLD and GenBank.  Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.  See the BOLD taxonomy browser for more complete information about this specimen and other sequences.

AATCGATGACTATTCTCAACCAACCACAAAGACATCGGCACTCTATACCTAATCTTTGGCGCCTGGGCTGGCATAGTTGGTACCGCCCTTAGCCTACTTATCCGCGCAGAACTCGGCCAACCGGGTACCCTCCTGGGCGAT---GACCAAATCTACAATGTAGTCGTCACTGCCCATGCTTTCGTAATAATCTTCTTCATAGTCATACCAATCATAATCGGAGGCTTTGGAAACTGACTTGTCCCACTCATAATCGGCGCCCCTGACATAGCCTTCCCACGCATAAACAACATAAGCTTCTGACTACTCCCCCCATCCTTCCTCCTCCTACTAGCCTCTTCAACAGTAGAAGCCGGGGCTGGCACCGGATGAACAGTCTACCCTCCACTAGCTAGCAACATAGCCCATGCTGGCGCCTCAGTAGACTTGGCCATCTTTTCTCTACACCTAGCAGGAATCTCATCCATCTTAGGGGCAATCAACTTCATCACAACCGCTATTAACATAAAACCTCCAGCCCTCTCTCAGTACCAAACGCCCCTATTCGTCTGATCTGTACTCATCACCGCTGTCCTACTACTACTCTCACTCCCCGTCCTAGCTGCCGGCATTACTATATTACTCACAGACCGAAACCTCAACACAACATTCTTCGACCCCGCCGGCGGCGGTGACCCGGTCCTGTACCAACACCTCTTTTGATTCTTCGGTCACCCTGAAGTCTACATCCTAATTCTACCAGGCTTTGGAATCATCTCTCACGTAGTGACATACTACGCAGGCAAAAAAGAACCATTCGGCTACATAGGAATAGTCTGAGCCATACTATCTATCGGATTCCTGGGTTTCATCGTATGAGCCCACCATATATTTACAGTAGGTATAGACGTAGACACCCGAG
-- end --

Download FASTA File
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Statistics of barcoding coverage: Nisaetus nipalensis

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 2
Specimens with Barcodes: 2
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Conservation

Conservation Status

IUCN Red List Assessment


Red List Category
LC
Least Concern

Red List Criteria

Version
3.1

Year Assessed
2012

Assessor/s
BirdLife International

Reviewer/s
Butchart, S. & Symes, A.

Contributor/s

Justification
This species has an extremely large range, and hence does not approach the thresholds for Vulnerable under the range size criterion (Extent of Occurrence <20,000 km2 combined with a declining or fluctuating range size, habitat extent/quality, or population size and a small number of locations or severe fragmentation). Despite the fact that the population trend appears to be decreasing, the decline is not believed to be sufficiently rapid to approach the thresholds for Vulnerable under the population trend criterion (>30% decline over ten years or three generations). The population size may be moderately small to large, but it is not believed to approach the thresholds for Vulnerable under the population size criterion (<10,000 mature individuals with a continuing decline estimated to be >10% in ten years or three generations, or with a specified population structure). For these reasons the species is evaluated as Least Concern.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Population

Population Trend
Decreasing
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Wikipedia

Mountain hawk-eagle

The mountain hawk-eagle or Hodgson's hawk-eagle (Nisaetus nipalensis, earlier treated under Spizaetus[2]) is a bird of prey. Like all eagles, it is in the family Accipitridae. It breeds in the Indian subcontinent, from India, Nepal to Thailand, Taiwan, Indonesia and Japan.[3]

The mountain hawk-eagle is a medium-large raptor at 69–84 cm (27–33 in) in length and a wingspan of 134–175 cm (53–69 in). The typical adult has brown upperparts and pale underparts, with barring on the undersides of the flight feathers and tail. The breast and belly and underwing coverts are heavily streaked. The wings are broad with a curved trailing edge, and are held in a shallow V in flight. Sexes are similar, but young birds are often whiter-headed.

The Sri Lankan and south Indian population is smaller and has unstreaked buff underwing coverts. A 2008 study based on the geographic isolation and differences in call suggest that this be treated as a full species, Nisaetus kelaarti, Legge's hawk-eagle.[4]

The Japanese subspecies N. n. orientalis is larger, lighter, and has only a very small crest, which is large in the other two subspecies. The Japanese subspecies usually weighs 2.2–3.6 kg (4.8–8 lbs).[5]

The heavier underpart streaking and wing shape help to distinguish this species from the similar crested hawk-eagle (Nisaetus cirrhatus).

It is a bird of mountain woodland, which builds a stick nest in a tree and lays usually a single egg. Mountain hawk-eagles eat small mammals, birds and reptiles.

Though it is not considered a globally threatened species, the Japanese population is declining. As the species is a K-strategist like all eagles, it was feared that the ongoing population reduction of N. n. orientalis might lead to loss of genetic diversity, and consequently inbreeding depression. However, genetic diversity was shown to be still considerable at present.[6]

Notes[edit]

  1. ^ BirdLife International (2012). "Nisaetus nipalensis". IUCN Red List of Threatened Species. Version 2013.2. International Union for Conservation of Nature. Retrieved 26 November 2013. 
  2. ^ Helbig AJ, Kocum A, Seibold I & Braun MJ (2005) A multi-gene phylogeny of aquiline eagles (Aves: Accipitriformes) reveals extensive paraphyly at the genus level. Molecular phylogenetics and evolution 35(1):147-164 PDF
  3. ^ Grimmett, Richard; Inskipp, Carol, Inskipp, Tim & Byers, Clive (1999): Birds of India, Pakistan, Nepal, Bangladesh, Bhutan, Sri Lanka, and the Maldives. Princeton University Press, Princeton, N.J. ISBN 0-691-04910-6
  4. ^ Gjershaug, J. O.; Diserud, O. H.; Rasmussen, P. C. & Warakagoda, D. (2008) "An overlooked threatened species of eagle: Legge’s Hawk Eagle Nisaetus kelaarti (Aves: Accipitriformes)" (PDF) Zootaxa 1792: 54–66
  5. ^ http://www.jstor.org/pss/1592923
  6. ^ Asai, Shigeki; Yamamoto, Yoshihiro & Yamagishi, Satoshi (2006): Genetic diversity and extent of gene flow in the endangered Japanese population of Hodgson’s hawk-eagle, Spizaetus nipalensis. Bird Conservation International 16(2): 113–129. doi:10.1017/S0959270906000050

References[edit]

Creative Commons Attribution Share Alike 3.0 (CC BY-SA 3.0)

Source: Wikipedia

Unreviewed

Article rating from 0 people

Default rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!