Articles on this page are available in 1 other language: Spanish (18) (learn more)

Overview

Distribution

Range

Forests of s Mexico to n Argentina and Brazil.
  • Clements, J. F., T. S. Schulenberg, M. J. Iliff, D. Roberson, T. A. Fredericks, B. L. Sullivan, and C. L. Wood. 2014. The eBird/Clements checklist of birds of the world: Version 6.9. Downloaded from http://www.birds.cornell.edu/clementschecklist/download/

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Ecology

Habitat

Chocó-Darién Moist Forests Habitat

This taxon can be found in the Chocó-Darién moist forests ecoregion, one of the most species rich lowland areas on Earth, with exceptional abundance and endemism over a broad range of taxa including plants, birds, amphibians and arthropods. The biological distinctiveness is exceptional, with considerable biodiversity.

There are three principal geomorphologic types in the ecoregion: alluvial plains of recent origin, low mountains formed by the relatively recent dissection of sediments from the Tertiary and Pleistocene periods, and the complexes in mountain areas consisting of mesozoic rocks. The high precipitation and the topography mean that the ecoregion includes a complex of great hydrographic basins, the most important being those of the Atrato, Baudó, and San Juan Rivers and the Micay and Patía Rivers in the south. The force of the water in many of these rivers form deep gorges cutting through the mountains, creating spectacular rapids and waterfalls in the mountains. At lower elevations, large rivers become very wide and with many meanders. Given the high precipitation in the region, it is not surprising that the soils are severely leached and poor in nutrients. Most of the ecoregion has typical laterite soils with reddish clay, although the soils are younger and less leached in some areas, especially close to the base of the Andes and in the floodplains of the major rivers. Of particular botanical interest are the white clay soils in the region of Bajo Calima in Colombia, which are associated with the gigantic sclerophyllous leafed and unusually large fruited vegetation.

Depending on the altitudinal gradient, soil water content and the effect of the sea, there are various types of vegetation that make up the ecoregion. In broad terms, in the northern part of the ecoregion, the lowland rainforests correlate to the Brosimun utilis alliance, including communities dominated by the deciduous Cuipo tree (Cavanillesia platanifolia), the Espavé wild cashew (Anacardium excelsum), the Panamanian rubber tree (Castilla elastica), Brosimum guianense, Bombacopsis spp., Ceiba pentandra, Dipteryx panamensis, and others. In the undergrowth Mabea occidentalis, Clidemia spp., Conostegia spp. and Miconia spp. are abundant. In zones that are occasionally flooded, the Cativo (Prioria copaifera) flourishes as well. In the southern part of the ecoregion, these rainforests have multiple strata, with two layers of trees, lianas, and epiphytes with vigorous growth rates. The number of deciduous plants increases in the north and south, where there is a dry season, particularly near the coast. The forests at higher altitudes, starting at 600 meters, have communities with the following species: Guamos (Inga spp.), Billia columbiana, Brosimum sp., Sorocea spp., Jacaranda hesperia, Pourouma chocoana, Guatteria ferruginea, Cecropia spp., Elaegia utilis, and Brunellia spp.

There are at least 127 species of amphibians in the Choco-Darien, including the following endemic anuran species: Isla Bonita robber frog (Craugastor crassidigitus); Kokoe poison frog (Phyllobates aurotaenia NT), found on western slopes of the Cordillera Occidental , along the Ra­o San Juan drainage south to the Ra­o Raposo; Golden poison frog (Phyllobates terribilis EN); La Brea poison frog (Oophaga occultator); Andagoya robber frog (Pristimantis roseus); Antioquia beaked toad (Rhinella tenrec); Atrato glass frog (Hyalinobatrachium aureoguttatum); Blue-bellied poison arrow frog (Ranitomeya minuta); Colombian egg frog (Ctenophryne minor), known only to the in the upper Ra­o Saija drainage; Condoto stubfoot toad (Atelopus spurrelli VU); Flecked leaf frog (Phyllomedusa psilopygion); LeDanubio robber frog (Strabomantis zygodactylus). An endemic salamander present in the Choco-Darien is the Finca Chibigui salamander (Bolitoglossa medemi VU).

Some other non-endemic anurans found here are: Anatipes robber frog (Strabomantis anatipes); Banded horned treefrog (Hemiphractus fasciatus); Black-legged poison frog (Phyllobates bicolor NT); Horned marsupial frog (Gastrotheca cornuta EN), known for having the largest amphibian eggs in the world; El Tambo stubfoot toad (Atelopus longibrachius EN); Elegant stubfoot toad (Atelopus elegans CR). Endemic caecilians in the ecoregion include the Andagoya caecilian (Caecilia perdita).

There are a number of reptilian taxa within the ecoregion, including: Adorned graceful brown snake (Rhadinaea decorata); the endemic Black centipede snake (Tantilla nigra); Boulenger's least gecko (Sphaerodactylus scapularis VU); the endemic Iridescent ground snake (Atractus iridescens); the endemic Cauca coral snake (Micrurus multiscutatus); the endemic Colombian coral snake (Micrurus spurelli); the endemic Dark ground snake (Atractus melas); the endemic Colombian mud turtle (Atractus melas VU); and the endemic Echternacht's ameiva (Ameiva anomala).

There are 577 species of birds recorded; Tyrannidae is listed as the most diverse avian family, presenting 28 genera and 60 species within the ecoregion. The Choco-Daroemis is a center of avian endemism of the Neotropics; moreover, according to Stattersfield, this ecoregion spans two Endemic Bird Areas, one in Central America and one in South America.

Between these two Endemic Bird Areas there are over sixty restricted range species, including the Chocó tinamou (Crypturellus kerriae VU), Chestnut-mantled Oropendola (Psarocolius cassini EN), Viridian dacnis (Dacnis viguieri), Crested ant-tanager (Habia cristata), Lita woodpecker (Piculus litea), and Plumbeous forest-falcon (Micrastur plumbeus EN). Also to be noted is the presence of the Harpy eagle (Harpia harpyja), the Black and white crowned eagle (Spizastur melanoleucus), taxa increasingly rare in many areas of the Neotropics, and possibly the Speckled antshrike (Xenornis setifrons EN) although one has not been recorded in Colombia since the 1940s.

The region is rich in mammalian taxa, but the larger animals have received inadequate research. These include the Bush dog (Speothos venaticus NT); Chocó tamarin (Saguinus geoffroyi EN), the Baird's Tapir (Tapirus bairdii EN), the Giant anteater (Myrmecophaga tridactyla VU), the Brown-headed spider monkey (Ateles fuscipens CR), the Puma (Puma concolor VU), the Ocelot (Leopardus pardalis LC), and the jaguar (Panthera onca NT).

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© C. Michael Hogan & World Wildlife Fund

Supplier: C. Michael Hogan

Trusted

Article rating from 1 person

Average rating: 5.0 of 5

Habitat and Ecology

Systems
  • Terrestrial
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Barcode data: Spizaetus melanoleucus

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There is 1 barcode sequence available from BOLD and GenBank.

Below is the sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.

See the BOLD taxonomy browser for more complete information about this specimen.

Other sequences that do not yet meet barcode criteria may also be available.

TCTATACCTAATTTTCGGGGCCTGAGCCGGCATAGTTGGCACTGCCCTTAGCCTACTTATCCGTGCAGAACTTGGCCAACCGGGTACCCTCCTAGGCGATGACCAAATCTATAATGTAATCGTCACCGCCCATGCTTTCGTAATAATCTTCTTCATAGTCATGCCAATTATAATCGGGGGCTTTGGGAACTGACTTATCCCACTCATAATCGGCGCCCCCGACATAGCCTTCCCACGCATAAACAACATAAGCTTCTGACTACTCCCCCCATCCTTCCTCCTCCTACTAGCCTCCTCAACAGTAGAAGCAGGAGCCGGTACCGGATGAACTGTCTACCCCCCTCTAGCAGGTAACATAGCTCATGCCGGAGCCTCAGTAGATCTAGCCATCTTTTCTCTACATCTAGCAGGAATCTCATCCATCCTAGGAGCAATCAACTTTATCACAACCGCCATCAACATAAAACCCCCAGCCCTCTCCCAATACCAGACCCCCCTATTCGTATGGTCAGTTCTCATCACCGCCGTTCTACTATTACTCTCACTCCCCGTTCTAGCCGCTGGCATTACCATACTACTCACAGACCGAAACCTTAACACAACATTCTTCGACCCCGCCGGCGGCGGTGACCCAGTCC
-- end --

Download FASTA File

Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Statistics of barcoding coverage: Spizaetus melanoleucus

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 1
Specimens with Barcodes: 5
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Conservation

Conservation Status

IUCN Red List Assessment


Red List Category
LC
Least Concern

Red List Criteria

Version
3.1

Year Assessed
2012

Assessor/s
BirdLife International

Reviewer/s
Butchart, S. & Symes, A.

Contributor/s

Justification
This species has an extremely large range, and hence does not approach the thresholds for Vulnerable under the range size criterion (Extent of Occurrence <20,000 km2 combined with a declining or fluctuating range size, habitat extent/quality, or population size and a small number of locations or severe fragmentation). Despite the fact that the population trend appears to be decreasing, the decline is not believed to be sufficiently rapid to approach the thresholds for Vulnerable under the population trend criterion (>30% decline over ten years or three generations). The population size may be moderately small to large, but it is not believed to approach the thresholds for Vulnerable under the population size criterion (<10,000 mature individuals with a continuing decline estimated to be >10% in ten years or three generations, or with a specified population structure). For these reasons the species is evaluated as Least Concern.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Population

Population
Partners in Flight estimated the population to number <50,000 individuals (A. Panjabi in litt. 2008).

Population Trend
Decreasing
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Wikipedia

Black-and-white hawk-eagle

"Spizaetus melanoleucus" redirect here. This name was also used for the Black-chested eagle-buzzard (Geranoaetus melanoleucus or Buteo melanoleucus).

The black-and-white hawk-eagle (Spizaetus melanoleucus, formerly Spizastur melanoleucus) is a bird of prey species in the eagle and hawk family (Accipitridae). It is found throughout a large part of tropical America, from southern Mexico to northern Argentina.

Description[edit]

As its name suggest, this is a black and white eagle, resembling the small typical eagles sometimes separated in "Hieraaetus". It is some 20–24 in (50–60 cm) long overall and weighs about 30 oz (850 g). The head, neck and body are white; a small crest forms a black spot on top of the head, and the area around the eyes, particularly towards the bill, is also black. The wings are black, and the bird has a brownish tail barred black-dark grey and with white tip. The iris is orange, the feet pale to bright yellow with black talons. The bill is black with a yellow cere.[2]

The sexes are alike in color, but the female is larger. Immature birds have pale edges on the upperwing coverts and some brownish-grey feathers on the back.[2]

The black-and-white hawk-eagle is hard to confuse with any other bird in its range. The black-faced hawk (Leucopternis melanops) is very similar in overall coloration, but it is much smaller and has a black tail with a single bold white bar in the middle. The ornate hawk-eagle (Spizaetus ornatus), presumably a very close relative of S. melanoleucus, looks quite similar when young. However, the wings, back and tail are much lighter in young S. ornatus, and they do not have the black eye-ring.[2]

Distribution and ecology[edit]

This species occurs from Oaxaca to Veracruz in southern Mexico southwards throughout Central America, with the exception of most of El Salvador and the Pacific coast of Nicaragua. In South America, it occurs on the Pacific side of the Andes south to Ecuador. The bulk of its range extends along the Caribbean coast from northern Colombia and Venezuela to the Guianas, and south through eastern Brazil, Paraguay and Uruguay to NE Argentina, and from there westwards again to Beni and Santa Cruz in NE Bolivia. A black-and-white hawk-eagle population is also found in the Loreto Region of NE Peru; it is not known in how far this is isolated from the rest of the bird's range. The species is absent from western Amazonia, and it is not common in the lands to the east (e.g. in Minas Gerais).[2][3]

Its natural habitats are lowland forests of any type, though very dense and humid as well as savanna-like semiarid habitat are not preferred. Habitat fragmentation is not very well tolerated; though the species prefers a diverse habitat of mixed forest and shrubland, it requires large stands of closed-canopy forest to thrive. Its range does not extend very far into the uplands, but one individual was sighted at an altitude of about 4,000 ft (c.1,200 m) ASL in the Buena Vista Nature Reserve in Colombia's Sierra Nevada de Santa Marta.[2][3][4]

The food of this carnivore consists of mammals, toads, squamates and in particular a wide variety of birds. Among the latter, it is known to prefer tree-living species, such as oropendolas, aracaris, tanagers and cotingas. But ground- and waterbirds like tinamous, chachalacas, cormorants and the highly threatened Brazilian merganser (Mergus octosetaceus) have also been recorded as its prey. The black-and-white hawk-eagle has been known to attack small monkeys, though it is not clear with which intent. For as it seems, it has not been recorded to actually kill and eat a monkey.[2]

Its preferred hunting technique is to soar high until it has spotted suitable prey, and then dive down on it, usually right into the forest canopy, but it has also been observed to catch a white woodpecker (Melanerpes candidus) that had been mobbing it in mid-air, after launching itself from its perch.[5] It likes to hunt along ridges and forest edges where it can access the canopy-level from an oblique direction rather than just from directly above, and where ground-living prey is also more accessible.[2]

It nests in the forest canopy, building a stick nest high up in exposed trees on ridges and similar locations, from where good hunting grounds can be watched. Detailed observations on its nesting habits are nearly non-existent however. In Panama, birds started to construct a nest in September, during a dry spell in the rainy season. But the main nesting season may start before the onset of the rainy season as the nesting attempt was abandoned when heavy rains recommenced. The scant other data agrees with this, and at least in Central America the nesting season seems to run from March to June or so.[2]

There is a general lack of information on the black-and-white hawk-eagle's movements and population status. Each bird seems to require a hunting territory of about 3,500 acres (1,400 hectars) at least. While the variety of habitat types in which it is found suggests that it is not particularly susceptible to changes in land use, it is apparently still a rare and local species almost anywhere in its range. The IUCN until 2000 classified it as a Near Threatened species due to the uncertainties surrounding its status, but as no evidence of a marked decline has been found and as the bird is found across a wide range, it was downlisted to a Species of Least Concern.[1][2][4][5]

Taxonomy and systematics[edit]

This species is often placed in the monotypic genus Spizastur, but has recently been moved to Spizaetus e.g. by the American Ornithologists' Union, as it appears that the ornate hawk-eagle (S. ornatus) is its sister taxon.[6] This has created quite some taxonomic confusion, which has largely gone unnoticed however:

Originally, the name Spizaetus melanoleucus was given by Louis Jean Pierre Vieillot to the black-chested buzzard-eagle in 1819, while the black-and-white hawk-eagle had been described in 1816 by the very same scientist as Buteo melanoleucus. The former species was placed in Geranoaetus – also a monotypic genus – in 1844, while the black-and-white hawk-eagle had been moved out of Buteo and into Spizastur a few years earlier.[2][7]

Thus, the identical specific epithets never came into direct conflict until recently. But the Black-chested eagle-buzzard's placement in a monotypic genus was always disputed, and several authors treated it in Buteo.[8] However, they overlooked that Buteo melanoleucus was the original name of the black-and-white hawk-eagle and thus as a senior homonym could not be applied to the later-described species. The correct specific name for the Black-chested eagle-buzzard when placed in Buteo, Buteo fuscescens, was reestablished in the mid-20th century for a short time more by accident than anything else;[9] as most late-20th-century researchers argued for retaining Geranoaetus, this name was dismissed as erroneous and essentially forgotten.[10]

As the black-and-white hawk-eagle has not been placed in Buteo since long, Article 59.3 of the ICZN Code applies. According to this, a junior homonym replaced before 1961 is not rendered permanently invalid (as junior homonyms usually are) if "the substitute name is not in use"[11] – which has been the case after Amadon's 1963 revision. Hence, in this case the scientific name Buteo melanoleucus can apply to the black-chested eagle-buzzard, even though the black-and-white hawk-eagle was described under exactly that name earlier, while the senior homonym melanoleucus still applies to the latter species when placed in Spizaetus according to the usual ICZN rules. Consequently, the proper name to use for each bird has through a number of coincidences become the senior synonym of the other species.

References[edit]

  1. ^ a b BirdLife International (2012). "Spizaetus melanoleucus". IUCN Red List of Threatened Species. Version 2013.2. International Union for Conservation of Nature. Retrieved 26 November 2013. 
  2. ^ a b c d e f g h i j Bierregaard, Richard O. (1994): 224. Black-and-white Hawk-eagle. In: del Hoyo, Josep; Elliott, Andrew & Sargatal, Jordi (eds.): Handbook of Birds of the World (Vol.2: New World Vultures to Guineafowl): 201, plate 21. Lynx Edicions, Barcelona. ISBN 84-87334-15-6
  3. ^ a b Zorzin, Giancarlo; Carvalho, Carlos Eduardo Alencar; de Carvalho Filho, Eduardo Pio Mendes & Canuto, Marcus (2006). "Novos registros de Falconiformes raros e ameaçados para o estado de Minas Gerais" [New records of rare and threatened Falconiformes for the state of Minas Gerais]. Revista Brasileira de Ornitologia (in Portuguese with English abstract) 14 (4): 417–421. 
  4. ^ a b Strewe, Ralf & Navarro, Cristobal (2004). "New and noteworthy records of birds from the Sierra Nevada de Santa Marta region, north-eastern Colombia". Bulletin of the British Ornithologists' Club 124 (1): 38–51. 
  5. ^ a b Olmos, Fábio; Pacheco, José Fernando & Silveira, Luís Fábio (2006). "Notas sobre aves de rapina (Cathartidae, Acciptridae e Falconidae) brasileiras" [Notes on Brazilian birds of prey]. Revista Brasileira de Ornitologia (in Portuguese with English abstract) 14 (4): 401–404. 
  6. ^ Banks, Richard C.; Chesser, R. Terry; Cicero, Carla; Dunn, Jon L.; Kratter, Andrew W.; Lovette, Irby J.; Rasmussen, Pamela C.; Remsen, J.V. Jr; Rising, James D. & Stotz, Douglas F. (2007). "Forty-eighth Supplement to the American Ornithologists' Union Check-List of North American Birds". Auk 124 (3): 1109–1115. doi:10.1642/0004-8038(2007)124[1109:FSTTAO]2.0.CO;2. 
  7. ^ Bierregaard, Richard O. (1994): 170. Black-chested Buzzard-eagle. In: del Hoyo, Josep; Elliott, Andrew & Sargatal, Jordi (eds.): Handbook of Birds of the World (Vol. 2: New World Vultures to Guineafowl): 175, plate 16. Lynx Edicions, Barcelona. ISBN 84-87334-15-6
  8. ^ Wetmore, Alexander (1933). "Status of the Genus Geranoaëtus". Auk 50 (2): 212. doi:10.2307/4076880. 
  9. ^ Hellmayr, Carl Edward and Conover, Henry Boardman (1949). "Catalogue of birds of the Americas". Field Mus. Nat. Hist. Zool. Ser. 13 (Part 1(4)): 144–148. 
  10. ^ Amadon, Dean (1963). "Comparison of Fossil and Recent Species: Some Difficulties". Condor 65 (5): 407–409. doi:10.2307/1365146. 
  11. ^ International Commission on Zoological Nomenclature (1999): International Code of Zoological Nomenclature. International Trust for Zoological Nomenclature, London. ISBN 0-85301-006-4

Further reading[edit]

  • Amorim, James Faraco & Piacentini, Vítor de Queiroz (2006): Novos registros de aves raras em Santa Catarina, Sul do Brasil, incluindo os primeiros registros documentados de algumas espécies para o Estado [New records of rare birds, and fi rst reports of some species, in the state of Santa Catarina, southern Brazil]. Revista Brasileira de Ornitologia 14(2): 145–149 [Portuguese with English abstract]. PDF fulltext Electronic supplement
Creative Commons Attribution Share Alike 3.0 (CC BY-SA 3.0)

Source: Wikipedia

Unreviewed

Article rating from 0 people

Default rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!