Articles on this page are available in 1 other language: Spanish (8) (learn more)

Overview

Brief Summary

The Green-fronted Brilliant (Heliodoxa jacula) is a large (~11 to 13 cm) hummingbird that is found from Costa Rica south to western Ecuador. Geographic variation across this range has led to the recognition of several subspecies. The Green-fronted Brilliant is locally common in Costa Rica and Panama (much less common and more local in Colombia), occurring in the mid-understory up to the canopy of wet subtropical and cloud forest as well as in adjacent semi-open and old second growth in mountains and foothills (from several hundred to 2000 m). These hummingbirds frequently take nectar from the pipe-shaped inflorescence bracts of Marcgravia and from Heliconia, as well as from other epiphytes in the Ericaceae and Gesneriaceae and from flowering shrubs such as Drymonia and Cephaelis. These birds typically perch on the inflorescence when feeding from flowers. Males may defend large clumps of Marcgravia or Heliconia. Insects and spiders are captured both from the air and by foliage gleaning. In Costa Rica, at least, the Green-fronted Brilliant is a seasonal altitudinal migrant, with most of the population moving to lower elevations outside the breeding season, sometimes to as low as 100 m. (Stiles and Skutch 1989; Schuchmann 1999 and references therein) Despite the relative abundance of this bird in Costa Rica, the first known Green-fronted Brilliant nest in Costa Rica was not discovered until 1999, resulting in the first published description of the nest of this species (Sánchez et al 2000).

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Shapiro, Leo

Source: EOL Rapid Response Team

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Ecology

Habitat

Habitat and Ecology

Systems
  • Terrestrial
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Barcode data: Heliodoxa jacula

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There are 3 barcode sequences available from BOLD and GenBank.  Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.  See the BOLD taxonomy browser for more complete information about this specimen and other sequences.

CTTATACCTAATCTTCGGAGCATGGGCCGGAATAGTTGGAACCGCCCTCAGCCTACTAATCCGAGCAGAACTCGGTCAACCAGGTACCCTTCTTGGAGACGACCAAATTTACAACGTAATCGTCACTGCCCATGCCTTCGTAATAATCTTCTTCATAGTCATACCAGTCATAATTGGAGGATTTGGAAACTGACTAATCCCCCTCATAATCGGAGCCCCCGACATGGCATTCCCGCGTATAAACAACATAAGCTTTTGACTCCTACCACCATCGTTCCTCCTGCTCCTTGCCTCCTCTACCGTAGAAGCAGGCGCAGGAACAGGATGAACTGTATACCCACCTCTAGCCGGCAACCTAGCCCACGCAGGCGCATCAGTAGACTTAGCCATCTTTTCTTTACACCTATCCGGCATCTCATCTATCCTGGGAGCAATCAACTTTATTACTACCGCAATCAACATAAAACCACCTGCCCTGTCACAATACCAAACCCCCCTATTCGTTTGATCTGTCCTCATCACCGCTGTCCTTCTTCTCCTCTCACTCCCAGTACTCGCCGCCGGAATTACCATGCTGCTTACAGACCGAAACCTAAACACCACCTTCTTCGACCCCGCTGGGGGAGGAGACCCCATCCTATATCAGCACCTA
-- end --

Download FASTA File
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Statistics of barcoding coverage: Heliodoxa jacula

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 3
Specimens with Barcodes: 6
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Conservation

Conservation Status

IUCN Red List Assessment


Red List Category
LC
Least Concern

Red List Criteria

Version
3.1

Year Assessed
2009

Assessor/s
BirdLife International

Reviewer/s
Bird, J., Butchart, S.

Contributor/s

Justification
This species has a very large range, and hence does not approach the thresholds for Vulnerable under the range size criterion (Extent of Occurrence <20,000 km2 combined with a declining or fluctuating range size, habitat extent/quality, or population size and a small number of locations or severe fragmentation). Despite the fact that the population trend appears to be decreasing, the decline is not believed to be sufficiently rapid to approach the thresholds for Vulnerable under the population trend criterion (>30% decline over ten years or three generations). The population size has not been quantified, but it is not believed to approach the thresholds for Vulnerable under the population size criterion (<10,000 mature individuals with a continuing decline estimated to be >10% in ten years or three generations, or with a specified population structure). For these reasons the species is evaluated as Least Concern.

History
  • 2008
    Least Concern
  • 2004
    Least Concern
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Population

Population
The global population size has not been quantified, but this species is described as 'fairly common but patchily distributed' (Stotz et al. 1996).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Wikipedia

Green-crowned Brilliant

The Green-crowned Brilliant (Heliodoxa jacula) is a large robust hummingbird that is a resident breeder in the highlands from Costa Rica to western Ecuador.

Female feeding in Costa Rica
Male in Costa Rica

This hummingbird inhabits wet mountain forests including edges, gaps and tall second growth. It occurs typically between 700 m and 2000 m in altitude, mainly on the Caribbean slopes.

The nest is a bulky cup of plant fibres and scales of tree ferns saddled on a thin downsloping branch. The female alone incubates the two white 16.5 mm by 11 mm eggs [1].

The male Green-crowned Brilliant is 13 cm long and weighs 9.5 g. It is mainly bronze-green with a glittering green crown, forehead, throat and breast. It has a white spot behind the eye, a small violet throat patch, white thighs, and a deeply forked blue-black tail.

The female is 12 cm long and weighs 8 g. She differs from the male in that she has green-spotted white underparts, a white spot behind the eye and a white stripe below the eye, and a white-cornered shallowly-forked black tail.. Young birds resemble the adult of the same sex, but are duller, bronze-tinged below and have buff throats.

The Green-crowned Brilliant has a loud squeaky kyew call.

This hummingbird feeds at the large inflorescences of Marcgravia vines, which the male will sometimes defend. It will also feed at Heliconia and other large flowers. Unlike many hummingbirds, the Green-crowned Brilliant almost always perches to feed.

References

^ Julio E. Sánchez, Robert S. Mulvihill & Terry L. Master First description of the nest and eggs of the Green-crowned Brilliant (Heliodoxa jacula), with behavioral notes; Ornitologia Neotropical 11: 189–196, 2000

Creative Commons Attribution Share Alike 3.0 (CC BY-SA 3.0)

 

Source: Wikipedia

Unreviewed

Article rating from 0 people

Average rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!