Articles on this page are available in 1 other language: Spanish (8) (learn more)

Overview

Brief Summary

The Fiery Throated Hummingbird (Panterpe insignis) is a medium sized hummingbird endemic to the mountains of Costa Rica and Panama. It is vibrantly colored and highly territorial (Stiles and Skutch 1989). Like all hummingbirds, it feeds on nectar and insects, has an extremely high metabolism, and is a very skilled flier. They use the adaptation of torpor at night to survive in their cool montane habitats (Fogden 2005).

Unreviewed

Article rating from 0 people

Average rating: 2.5 of 5

Distribution

P. insignis is a medium sized hummingbird endemic to the Cordilleras mountain range of Costa Rica to Western Panama. They live in the oak forests between 1500 and 2000m (Stiles and Sktuch 1989).

Unreviewed

Article rating from 0 people

Average rating: 2.5 of 5

Physical Description

Morphology

P. insignis are the most vibrant of the montane hummingbirds, unmistakable with a stunning glittery copper throat, violet blue breast, and green blue stomach. However, if viewed from behind or the side they can often appear a simple dull green. The juveniles have similar but duller coloration, with slightly rusty feathers fringing the face (Stiles and Skutch 1989). The females, while much smaller, are unique because they have the exact same coloration as the males, a characteristic that is uncommon among hummingbirds (Fogden 2005). The iridiscent color of hummingbirds is caused by the interference of light in the mirror-like structures of the barbules on their feathers. These little mirrors can either highly focus light to create brilliant color only seen from certain angles, such as the copper on the throat of the P. insignis, or scatter light, to form the general green body color found in most hummingbirds (Fogden 2005).

Unreviewed

Article rating from 0 people

Average rating: 2.5 of 5

Size

They are about 4.5 inches (11cm) long and weigh about 5.7g (Stiles and Skutch 1989)

Unreviewed

Article rating from 0 people

Average rating: 2.5 of 5

Ecology

Habitat

Habitat and Ecology

Systems
  • Terrestrial
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Trophic Strategy

Like all hummingbirds, P. insignis has a long, forked tongue used to lap up nectar from flowers. This tongue can go in and out of a flower up to 12 times per second. Hummingbirds possess the unique ability to hover for long periods of time in front of flowers, a skill they accomplish by creating lift from both the forward and the backward strokes of their wings. They are incredibly precise fliers due to the fact that their wings are completely rigid except at the shoulder, which can be rotated up to 180 degrees, allowing for tiny changes in their flight. They can beat their wings 50 to 80 times a second and their flight is rivaled in the animal kingdom only by dragonflies and hawkmoths. Hummingbirds have one of the highest metabolic rates of any warm blooded animal and therefore need to eat half their body weight in nectar a day. They eat insects for protein but visit a flower for nectar every 20 to 30 minutes throughout the day. Studies have shown that the crop volume in hummingbirds limits the amount of nectar they can consume in one sitting because the nectar goes to the crop first for storage before entering the rest of the digestive tract. Larger hummingbirds have larger crops and can therefore afford to eat less frequently because they can store more energy. However, this is not true for P. insignis because the sucrose concentration in nectar is much lower in the highlands than in the lowlands. This means that although P. insignis is a medium-sized hummingbird it must eat more often than hummingbirds of similar sizes in the lowlands because the nectar it is consuming has less energy (Hainsworth and Wolf 1971).

Unreviewed

Article rating from 0 people

Average rating: 2.5 of 5

Associations

While P. insignis defend their territories well against other hummingbirds, there are several competitors that they are not able to keep out. These include a passerine called the Slaty Flower-piercer (Diglossa plumbea). These small gray birds have sharp bills they use to pierce the long corollas of some flowers in order to drink the nectar. These can be a pest in the territory of P. insignis but they can also be beneficial. These hummingbirds have medium sized bills that cannot reach the nectar of flowers with long corollas. They have often been observed following Diglossa around to drink from the holes they make in order to get nectar they would ordinarily not be able to obtain (Stiles 1983). Other major competitors include a large bee called Bombus ephippiatus, and two species of Rhinoseius mites that live in flowers and hitch rides from flower to flower on the beaks of feeding hummingbirds (Colwell 1983, Stiles 1983).

Unreviewed

Article rating from 0 people

Average rating: 2.5 of 5

Life History and Behavior

Behavior

The most important usage of the iridescent plumage in this species is the defense of territory. It is brightest when viewed straight on in order to warn and intimidate intruders (Fogden 2005). P. insignis hummingbirds are known for their extreme territoriality. They are the dominant hummingbird in montane regions and are therefore able to secure the best patches of flowers, which is important for breeding (Stiles 1983). Females will choose males who have the most impressive flower patches in their territories. Hummingbirds are highly polygamous, but P. insignis is unique because they form a pair bond during one breeding season. The male will defend more flowers than necessary so that the female will be able to access the surplus food source in exchange for guaranteed paternity for the male (Fogden 2005). Like all hummingbirds, P. insignis breeds in close conjunction with its favorite flower; in this case, the nectar rich ericad Macleania glabra, which blooms between late July and November, the wettest and coldest time of the year (Stiles 1983). Males do not have a song, but they are very noisy during breeding season, emitting sharp high pitched chirps and twitters as well as a peculiar buzzing sound for courtship (Stiles and Skutch 1989).

Unreviewed

Article rating from 0 people

Average rating: 2.5 of 5

Reproduction

Females are completely in charge of all the nesting duties. She will build her nest out of treefern scales and plant down woven together with cobwebs and heavily decorate the outside with moss and lichens. Nests can be found from August to January 6-13 feet (2-4m) off the ground, commonly at the end of a drooping bamboo stems or on rootlets overhanging banks (Stiles and Skutch 1989). She will lay 2 tiny white eggs, incubated for 14-19 days. When they hatch, she will feed her chicks every half hour or so by regurgitation of insects and nectar. The chicks will fledge after about 18-28 days, but high predation rates mean that more nests fail than succeed (Fogden 2005).

Unreviewed

Article rating from 0 people

Average rating: 2.5 of 5

Physiology and Cell Biology

Physiology

The high metabolism of this species is hard to maintain at night, especially in montane regions when the temperature drops significantly. In order to cope with this difficulty, P. insignis has the ability to go into torpor at night, meaning they slow their heart-rate and metabolism and lower their body temperature to air temperature (Fogden 2005). Studies on this species have shown that they lower their body temperature to between 10-12°C every night and that their body temperature is regulated very closely to the average ambient temperature. This close regulation to ambient conditions is thought to be an adaptation to reduce the energy cost of arousing from torpor in the morning. All hummingbird species have been found to have the ability to go into torpor, and unlike most other metabolic processes of hummingbirds, torpor is not related to body weight (Hainsworth and Wolf 1972). Torpor is similar to a miniature hibernation every night and is essential for survival in montane regions.

Unreviewed

Article rating from 0 people

Average rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Barcode data: Panterpe insignis

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There are 3 barcode sequences available from BOLD and GenBank.  Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.  See the BOLD taxonomy browser for more complete information about this specimen and other sequences.

CCTCTATCTAATTTTCGGAGCATGAGCCGGAATAGTTGGAACCTCCCTAAGCCTACTAATTCGAGCAGAACTTGGCCAACCGGGTACTCTTCTAGGAGACGATCAAATCTACAACGTAATTGTCACCGCCCACGCTTTCGTGATAATTTTCTTTATAGTTATACCAATCATGATCGGGGGCTTTGGAAACTGATTAATTCCCCTAATAATTGGAGCACCTGACATAGCATTCCCACGTATAAATAACATAAGCTTCTGACTCCTCCCTCCATCATTCCTCTTACTTCTTGCCTCCTCTACCATTGAAGCAGGCGCGGGTACAGGATGAACTGTATACCCGCCCCTAGCTGGCAACCTAGCCCACGCAGGAGCATCAGTAGACCTGGCCATCTTTTCCCTTCACCTATCCGGCATCTCATCAATCCTAGGGGCAATCAACTTTATCACCACCGCAATCAACATAAAACCACCCGCCCTATCACAATACCAAACTCCCCTATTTGTCTGGTCTGTCCTAATCACTGCCGTCCTACTCCTTCTCTCGCTCCCAGTACTTGCTGCTGGGATCACCATACTACTCACAGACCGAAACCTAAACACCACATTCTTCGACCCCGCTGGAGGAGGAGACCCCATTCTATACCAACACCTA
-- end --

Download FASTA File
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Statistics of barcoding coverage: Panterpe insignis

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 3
Specimens with Barcodes: 3
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Conservation

Conservation Status

IUCN Red List Assessment


Red List Category
LC
Least Concern

Red List Criteria

Version
3.1

Year Assessed
2012

Assessor/s
BirdLife International

Reviewer/s
Butchart, S. & Symes, A.

Contributor/s

Justification
Although this species may have a small range, it is not believed to approach the thresholds for Vulnerable under the range size criterion (Extent of Occurrence <20,000 km2 combined with a declining or fluctuating range size, habitat extent/quality, or population size and a small number of locations or severe fragmentation). The population trend is not known, but the population is not believed to be decreasing sufficiently rapidly to approach the thresholds under the population trend criterion (>30% decline over ten years or three generations). The population size has not been quantified, but it is not believed to approach the thresholds for Vulnerable under the population size criterion (<10,000 mature individuals with a continuing decline estimated to be >10% in ten years or three generations, or with a specified population structure). For these reasons the species is evaluated as Least Concern.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Population

Population
The global population size has not been quantified, but this species is described as 'common' (Stotz et al. (1996).

Population Trend
Unknown
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Threats

BecauseP. insignis Hummingbirds are restricted to high altitude climates, it is extremely difficult if not impossible for them to travel from mountaintop to mountaintop. This creates the possibility of species divergence on specific mountaintops after long periods of time. Evidence of this was already found by F. Gary Stiles in 1983, who discovered the subspecies Panterpe insignis eisenmanni on top of Volcan Maravalles, the tallest mountain in the Cordillera de Guanacastte in Costa Rica (Foster 1985). Recent global warming issues are restricting Panterpe habitat even further. As temperatures rise, they are being forced further up their mountain homes (Fogden 2005).

Unreviewed

Article rating from 0 people

Average rating: 2.5 of 5

Wikipedia

Fiery-throated Hummingbird

The Fiery-throated Hummingbird (Panterpe insignis) is a medium-sized hummingbird which breeds only in the mountains of Costa Rica and western Panama. It is the only member of the genus Panterpe.

This is a common to abundant bird of montane forest canopy above 1400 m, and also occurs in scrub at the woodland edges and clearings.

This bird is 11 cm long and weighs 5.7 g. It has a straight black bill and dusky feet.

The adult Fiery-throated Hummingbird has shiny green body plumage, a blue tail, and a white spot behind the eye. It often looks dark, but when the light catches it at the right angle, it shows a brilliant blue crown, yellow-bordered bright orange throat, and blue chest patch. The sexes are similar, but young birds have rufous fringes to the head plumage. The call is a high-pitched twittering.

The female Fiery-throated Hummingbird is entirely responsible for nest building and incubation. She lays two white eggs in a bulky plant-fibre cup nest 2–4 m high at the end of a descending bamboo stem or on a rootlet under a bank. Incubation takes 15–19 days, and fledging another 20-26.

Very little color from the side.

The food of this species is nectar, taken from a variety of small flowers, including epiphytic Ericaceae and bromeliads. Like other hummingbirds it also takes small insects as an essential source of protein. Male Fiery-throated Hummingbird defend flowers and scrubs in their feeding territories, and are dominant over most other hummingbirds. They will, however, allow females to share their food resources.

Range
Creative Commons Attribution Share Alike 3.0 (CC BY-SA 3.0)

Source: Wikipedia

Unreviewed

Article rating from 0 people

Average rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!