Articles on this page are available in 1 other language: Spanish (8) (learn more)

Ecology

Habitat

Habitat and Ecology

Systems
  • Terrestrial
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Barcode data: Panterpe insignis

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There are 3 barcode sequences available from BOLD and GenBank.  Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.  See the BOLD taxonomy browser for more complete information about this specimen and other sequences.

CCTCTATCTAATTTTCGGAGCATGAGCCGGAATAGTTGGAACCTCCCTAAGCCTACTAATTCGAGCAGAACTTGGCCAACCGGGTACTCTTCTAGGAGACGATCAAATCTACAACGTAATTGTCACCGCCCACGCTTTCGTGATAATTTTCTTTATAGTTATACCAATCATGATCGGGGGCTTTGGAAACTGATTAATTCCCCTAATAATTGGAGCACCTGACATAGCATTCCCACGTATAAATAACATAAGCTTCTGACTCCTCCCTCCATCATTCCTCTTACTTCTTGCCTCCTCTACCATTGAAGCAGGCGCGGGTACAGGATGAACTGTATACCCGCCCCTAGCTGGCAACCTAGCCCACGCAGGAGCATCAGTAGACCTGGCCATCTTTTCCCTTCACCTATCCGGCATCTCATCAATCCTAGGGGCAATCAACTTTATCACCACCGCAATCAACATAAAACCACCCGCCCTATCACAATACCAAACTCCCCTATTTGTCTGGTCTGTCCTAATCACTGCCGTCCTACTCCTTCTCTCGCTCCCAGTACTTGCTGCTGGGATCACCATACTACTCACAGACCGAAACCTAAACACCACATTCTTCGACCCCGCTGGAGGAGGAGACCCCATTCTATACCAACACCTA
-- end --

Download FASTA File
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Statistics of barcoding coverage: Panterpe insignis

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 3
Specimens with Barcodes: 3
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Conservation

Conservation Status

IUCN Red List Assessment


Red List Category
LC
Least Concern

Red List Criteria

Version
3.1

Year Assessed
2009

Assessor/s
BirdLife International

Reviewer/s
Bird, J., Butchart, S.

Contributor/s

Justification
Although this species may have a small range, it is not believed to approach the thresholds for Vulnerable under the range size criterion (Extent of Occurrence <20,000 km2 combined with a declining or fluctuating range size, habitat extent/quality, or population size and a small number of locations or severe fragmentation). The population trend is not known, but the population is not believed to be decreasing sufficiently rapidly to approach the thresholds under the population trend criterion (>30% decline over ten years or three generations). The population size has not been quantified, but it is not believed to approach the thresholds for Vulnerable under the population size criterion (<10,000 mature individuals with a continuing decline estimated to be >10% in ten years or three generations, or with a specified population structure). For these reasons the species is evaluated as Least Concern.

History
  • 2008
    Least Concern
  • 2004
    Least Concern
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Population

Population
The global population size has not been quantified, but this species is described as 'common' (Stotz et al. (1996).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Wikipedia

Fiery-throated Hummingbird

The Fiery-throated Hummingbird (Panterpe insignis) is a medium-sized hummingbird which breeds only in the mountains of Costa Rica and western Panama. It is the only member of the genus Panterpe.

This is a common to abundant bird of montane forest canopy above 1400 m, and also occurs in scrub at the woodland edges and clearings.

This bird is 11 cm long and weighs 5.7 g. It has a straight black bill and dusky feet.

The adult Fiery-throated Hummingbird has shiny green body plumage, a blue tail, and a white spot behind the eye. It often looks dark, but when the light catches it at the right angle, it shows a brilliant blue crown, yellow-bordered bright orange throat, and blue chest patch. The sexes are similar, but young birds have rufous fringes to the head plumage. The call is a high-pitched twittering.

The female Fiery-throated Hummingbird is entirely responsible for nest building and incubation. She lays two white eggs in a bulky plant-fibre cup nest 2–4 m high at the end of a descending bamboo stem or on a rootlet under a bank. Incubation takes 15–19 days, and fledging another 20-26.

Very little color from the side.

The food of this species is nectar, taken from a variety of small flowers, including epiphytic Ericaceae and bromeliads. Like other hummingbirds it also takes small insects as an essential source of protein. Male Fiery-throated Hummingbird defend flowers and scrubs in their feeding territories, and are dominant over most other hummingbirds. They will, however, allow females to share their food resources.

Range
Creative Commons Attribution Share Alike 3.0 (CC BY-SA 3.0)

 

Source: Wikipedia

Unreviewed

Article rating from 0 people

Average rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!