Overview

Distribution

Range

Trop. e Panama to Colombia, Venezuela, e Bolivia and Brazil.

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Ecology

Habitat

Habitat and Ecology

Systems
  • Terrestrial
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Barcode data: Chrysolampis mosquitus

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There are 5 barcode sequences available from BOLD and GenBank.

Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.

See the BOLD taxonomy browser for more complete information about this specimen and other sequences.

GTGACCTTTATTAACCGATGACTATTCTCAACCAACCACAAAGACATTGGCACTTTATACCTAATCTTCGGAGCATGGGCTGGAATAGTTGGAACTTCCCTTAGCCTACTAATTCGAGCAGAACTTGGCCAACCAGGCACTCTACTCGGAGACGACCAAATTTATAATGTAATCGTCACTGCTCATGCCTTCGTAATAATCTTCTTTATAGTTATACCAATCATGATCGGAGGATTTGGAAACTGACTAATTCCCCTTATAATCGGAGCCCCAGACATAGCATTTCCTCGTATAAACAACATAAGCTTCTGACTCCTACCACCATCATTCTTACTACTCCTTGCCTCCTCCACAGTAGAAGCAGGCGCCGGCACAGGATGAACCGTATACCCACCTTTAGCTGGCAACTTAGCTCATGCAGGAGCATCAGTAGACCTAGCCATCTTCTCCCTTCACCTGTCAGGCGTTTCATCAATCCTGGGGGCAATTAACTTCATCACTACCGCAATCAACATAAAACCGCCCGCACTATCACAGTATCAAACCCCACTATTTGTCTGATCCGTCCTTATCACCGCCGTTCTACTCCTCCTCTCACTCCCAGTGCTCGCCGCTGGAATCACCATGTTACTTACAGATCGAAACCTAAATACCACATTCTTTGACCCAGCCGGAGGAGGAGACCCCATCTTATACCAACATCTATTCTGATTCTTCGGACACCCCGAAGTGTACATCCTCATCCTTCCAGGATTTGGAATTATCTCCCACGTAGTAACCTACTACACA
-- end --

Download FASTA File

Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Statistics of barcoding coverage: Chrysolampis mosquitus

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 5
Specimens with Barcodes: 8
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Conservation

Conservation Status

IUCN Red List Assessment


Red List Category
LC
Least Concern

Red List Criteria

Version
3.1

Year Assessed
2012

Assessor/s
BirdLife International

Reviewer/s
Butchart, S. & Symes, A.

Contributor/s

Justification
This species has an extremely large range, and hence does not approach the thresholds for Vulnerable under the range size criterion (Extent of Occurrence <20,000 km2 combined with a declining or fluctuating range size, habitat extent/quality, or population size and a small number of locations or severe fragmentation). The population trend is not known, but the population is not believed to be decreasing sufficiently rapidly to approach the thresholds under the population trend criterion (>30% decline over ten years or three generations). The population size has not been quantified, but it is not believed to approach the thresholds for Vulnerable under the population size criterion (<10,000 mature individuals with a continuing decline estimated to be >10% in ten years or three generations, or with a specified population structure). For these reasons the species is evaluated as Least Concern.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Population

Population
The global population size has not been quantified, but this species is described as 'uncommon' (Stotz et al. 1996).

Population Trend
Unknown
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Wikipedia

Ruby-topaz hummingbird

Male ruby topaz hummingbird by Georges-Louis Leclerc de Buffon (1707-1788)

The ruby-topaz hummingbird (Chrysolampis mosquitus), commonly referred to simply as the ruby topaz, is a small bird that breeds in the Lesser Antilles and tropical northern South America from Colombia, Venezuela and the Guyanas, south to central Brazil and northern Bolivia; also from Colombia into southern Panama. It is the only member of the genus Chrysolampis. It is a seasonal migrant, although its movements are not well understood.

This hummingbird inhabits open country, gardens and cultivation. It is 8.1 cm long and weighs 3.5 g. Compared to most other hummingbirds, the almost straight, black bill is relatively short.

The male has green-glossed dark brown upperparts. The crown and nape are glossy red, and the throat and breast are brilliant golden-orange. The rest of the underparts are brown, and the chestnut tail is tipped black. The male often looks very dark, until he turns and the brilliant colours flash in the sunlight.

Female ruby-topaz hummingbird

The female ruby-topaz hummingbird has bronze-green upperparts and pale grey underparts. The tail is chestnut with a dark subterminal band and a white tip. Females from Trinidad typically have a greenish throat-streak (it may appear dark), but this is not common elsewhere in its range. Juvenile females are similar to adult females, but with a white-tipped dusky-brown tail. Juvenile males resemble the juvenile female, but with a variable amount of iridescent orange to the throat.

The female ruby-topaz hummingbird lays two eggs in a tiny cup nest in the fork of a low branch. Incubation takes 16 days, and fledging another 18 or 19.

Ruby-topaz hummingbird in flight

The food of this species is nectar, taken from a wide variety of flowers, and some small insects. Ruby-topaz hummingbird males perch conspicuously and defend their territories aggressively. The call of this species is a high-pitched tsip.

References[edit]

  • ffrench, Richard (1991). A Guide to the Birds of Trinidad and Tobago (2nd ed.). Comstock Publishing. ISBN 0-8014-9792-2. 
  • Hilty, Steven L. (2003). Birds of Venezuela. London: Christopher Helm. ISBN 0-7136-6418-5. 
Creative Commons Attribution Share Alike 3.0 (CC BY-SA 3.0)

Source: Wikipedia

Unreviewed

Article rating from 0 people

Default rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!