Overview

Distribution

Range

Trop. e Panama to Colombia, Venezuela, e Bolivia and Brazil.
  • Clements, J. F., T. S. Schulenberg, M. J. Iliff, D. Roberson, T. A. Fredericks, B. L. Sullivan, and C. L. Wood. 2014. The eBird/Clements checklist of birds of the world: Version 6.9. Downloaded from http://www.birds.cornell.edu/clementschecklist/download/

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Ecology

Habitat

Habitat and Ecology

Systems
  • Terrestrial
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Barcode data: Chrysolampis mosquitus

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There are 5 barcode sequences available from BOLD and GenBank.

Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.

See the BOLD taxonomy browser for more complete information about this specimen and other sequences.

GTGACCTTTATTAACCGATGACTATTCTCAACCAACCACAAAGACATTGGCACTTTATACCTAATCTTCGGAGCATGGGCTGGAATAGTTGGAACTTCCCTTAGCCTACTAATTCGAGCAGAACTTGGCCAACCAGGCACTCTACTCGGAGACGACCAAATTTATAATGTAATCGTCACTGCTCATGCCTTCGTAATAATCTTCTTTATAGTTATACCAATCATGATCGGAGGATTTGGAAACTGACTAATTCCCCTTATAATCGGAGCCCCAGACATAGCATTTCCTCGTATAAACAACATAAGCTTCTGACTCCTACCACCATCATTCTTACTACTCCTTGCCTCCTCCACAGTAGAAGCAGGCGCCGGCACAGGATGAACCGTATACCCACCTTTAGCTGGCAACTTAGCTCATGCAGGAGCATCAGTAGACCTAGCCATCTTCTCCCTTCACCTGTCAGGCGTTTCATCAATCCTGGGGGCAATTAACTTCATCACTACCGCAATCAACATAAAACCGCCCGCACTATCACAGTATCAAACCCCACTATTTGTCTGATCCGTCCTTATCACCGCCGTTCTACTCCTCCTCTCACTCCCAGTGCTCGCCGCTGGAATCACCATGTTACTTACAGATCGAAACCTAAATACCACATTCTTTGACCCAGCCGGAGGAGGAGACCCCATCTTATACCAACATCTATTCTGATTCTTCGGACACCCCGAAGTGTACATCCTCATCCTTCCAGGATTTGGAATTATCTCCCACGTAGTAACCTACTACACA
-- end --

Download FASTA File

Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Statistics of barcoding coverage: Chrysolampis mosquitus

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 5
Specimens with Barcodes: 8
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Conservation

Conservation Status

IUCN Red List Assessment


Red List Category
LC
Least Concern

Red List Criteria

Version
3.1

Year Assessed
2012

Assessor/s
BirdLife International

Reviewer/s
Butchart, S. & Symes, A.

Contributor/s

Justification
This species has an extremely large range, and hence does not approach the thresholds for Vulnerable under the range size criterion (Extent of Occurrence <20,000 km2 combined with a declining or fluctuating range size, habitat extent/quality, or population size and a small number of locations or severe fragmentation). The population trend is not known, but the population is not believed to be decreasing sufficiently rapidly to approach the thresholds under the population trend criterion (>30% decline over ten years or three generations). The population size has not been quantified, but it is not believed to approach the thresholds for Vulnerable under the population size criterion (<10,000 mature individuals with a continuing decline estimated to be >10% in ten years or three generations, or with a specified population structure). For these reasons the species is evaluated as Least Concern.

History
  • Least Concern (LC)
  • Least Concern (LC)
  • Least Concern (LC)
  • Lower Risk/least concern (LR/lc)
  • Lower Risk/least concern (LR/lc)
  • Lower Risk/least concern (LR/lc)
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5