Articles on this page are available in 1 other language: Spanish (8) (learn more)

Ecology

Habitat

Habitat and Ecology

Systems
  • Terrestrial
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Barcode data: Eutoxeres aquila

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There are 2 barcode sequences available from BOLD and GenBank.  Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.  See the BOLD taxonomy browser for more complete information about this specimen and other sequences.

CCTGTACTTAATTTTCGGGGCATGGGCCGGAATGGTCGGAACTGCCCTCAGCCTCCTAATCCGAGCAGAACTCGGTCAACCAGGCTCCCTTTTAGGAGACGACCAAATTTATAACGTAATCGTTACCGCCCACGCCTTCGTAATAATCTTCTTCATAGTTATACCTATCCTGATCGGGGGCTTTGGAAACTGATTAGTCCCCCTCATAATCGGGGCCCCTGACATAGCATTTCCACGCATAAATAACATAAGCTTCTGACTTCTCCCACCCTCATTCCTCCTCCTCCTAGCATCCTCTACTGTAGAAGCAGGAGCAGGCACAGGATGAACCGTGTATCCACCCCTGGCCGGCAATCTAGCCCACGCAGGCGCATCAGTAGACCTAGCCATCTTCTCACTCCACCTATCAGGTATCTCATCCATCCTAGGGGCAATCAACTTTATCACCACCGCAATCAACATAAAACCACCCGCCCTGTCACAATACCAAACTCCACTATTTGTTTGATCCGTCCTTATCACCGCCGTACTACTCCTTCTCTCACTCCCTGTGCTCGCCGCTGGAATTACCATGCTACTCACAGACCGAAACCTAAATACCACATTCTTTGATCCCGCCGGAGGAGGAGACCCCATCCTGTACCAACACTTA
-- end --

Download FASTA File
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Statistics of barcoding coverage: Eutoxeres aquila

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 2
Specimens with Barcodes: 5
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Conservation

Conservation Status

IUCN Red List Assessment


Red List Category
LC
Least Concern

Red List Criteria

Version
3.1

Year Assessed
2009

Assessor/s
BirdLife International

Reviewer/s
Bird, J., Butchart, S.

Contributor/s

Justification
This species has a very large range, and hence does not approach the thresholds for Vulnerable under the range size criterion (Extent of Occurrence <20,000 km2 combined with a declining or fluctuating range size, habitat extent/quality, or population size and a small number of locations or severe fragmentation). The population trend is not known, but the population is not believed to be decreasing sufficiently rapidly to approach the thresholds under the population trend criterion (>30% decline over ten years or three generations). The population size has not been quantified, but it is not believed to approach the thresholds for Vulnerable under the population size criterion (<10,000 mature individuals with a continuing decline estimated to be >10% in ten years or three generations, or with a specified population structure). For these reasons the species is evaluated as Least Concern.

History
  • 2008
    Least Concern
  • 2004
    Least Concern
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Population

Population
The global population size has not been quantified, but this species is described as 'uncommon' (Stotz et al. 1996).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Wikipedia

White-tipped Sicklebill

The White-tipped Sicklebill (Eutoxeres aquila) is a species of hummingbird in the Trochilidae family. It is found in Costa Rica and Panama of Central America, and Colombia, Ecuador, and far northern Peru. There is also a single recent record from Mérida in Venezuela.

Its natural habitat is the undergrowth of subtropical or tropical humid lowland or montane forest. Its curved bill helps it reach nectar deep in its favorite flower.

References

Creative Commons Attribution Share Alike 3.0 (CC BY-SA 3.0)

 

Source: Wikipedia

Unreviewed

Article rating from 0 people

Average rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!