Articles on this page are available in 1 other language: Spanish (8) (learn more)

Overview

Brief Summary

Eutoxeres aquila (White-tipped Sicklebill) is a species of large sized hummingbird that is found from Costa Rica to West Ecuador and North Eastern Peru (Stiles & Skutch 1989, Hilty & Brown 1986, Ridgely & Greenfield 2001, Schulenberg et al. 2010).  It has bronze, dark green upperparts with underparts that are white and heavily streaked with dusky. The rectrices are tipped with white. The species gets the name sicklebill from its distinctive sickle-shaped beak that has a curvature of nearly 90o (Stiles & Skutch 1989). The curved bill of this hummingbird allows it to feed on the curved flowers of Heliconia species and Centropogon granulous (Stiles & Skutch 1995). The IUCN has given this hummingbird the conservation status of Least Concern, as the population size is not believed to be approaching the threshold of Vulnerable (BirdLife International 2012).

Creative Commons Attribution 3.0 (CC BY 3.0)

© Lidia Boghean

Supplier: JohelChaves

Unreviewed

Article rating from 0 people

Default rating: 2.5 of 5

Distribution

The White-tipped Sicklebill can be found from Costa Rica to Western Ecuador and North Eastern Peru (Stiles & Skutch 1989). It is widespread on both slopes in Costa Rica (Stiles & Skutch 1989) and in Panama. Its distribution extends along the Pacific slope of Colombia to southwestern Ecuador (Hilty & Brown 1986, Ridgely & Greenfield 2001). It has been recorded as far south as Cordillera Azul, Peru (Schulenberg et al. 2010). Additionally, this species was reportedly seen recently in Mérida, Venezuela, extending the known distribution (Rengifo et al. 2007).

In Costa Rica, it is found at an elevation of 300-700 m on the Caribbean slope, and from the lowlands up to 1000-1200 m on the Pacific slope (Stiles & Skutch 1989); the elevational range in western Colombia is from the lowlands up to 1400 m (Hilty & Brown 1986). In Peru it is found between 750–2000 m (Schulenberg et al. 2010).

Creative Commons Attribution 3.0 (CC BY 3.0)

© Lidia Boghean

Supplier: JohelChaves

Unreviewed

Article rating from 0 people

Default rating: 2.5 of 5

Physical Description

Diagnostic Description

The White-tipped Sicklebill is 12.7 cm in length and weighs 11 grams.  It is a large, robust hermit (a hummingbird in the subfamily Phaethornithinae), that has a distinctive strongly decurved bill. The adults have a black upper bill with a yellow lower bill. The upper plumage is a dark bronzy-green. The throat and breast are blackish in color, and is broadly streaked with white to buffy. The tail is a dark green with a pointed white tip. This species is not sexually dimorphic although females have slightly shorter wings than males (Stiles & Skutch 1989).

The White-tipped Sicklebill is a highly distinctive hummingbird. The only similar species is the Buff-tailed Sicklebill (Eutoxeres condamini). The Buff-tailed Sicklebill, however, is found from southeastern Colombia to Bolivia, a more southern distribution than the White-tipped. The species do overlap from southeastern Colombia to northern Peru. The primary difference between the two can be seen in the tail pattern. The outer rectrices (long feathers of the tail) of White-tipped Sicklebill are dusky with broad white tips, whereas in Buff-tailed Sicklebill the rectrices are cinnamon buff tipped with white. The Buff-tailed Sicklebill also has a bluish green patch on the side of the neck, which is not seen in the White-tipped Sicklebill. (Schulenberg et al. 2010).

Creative Commons Attribution 3.0 (CC BY 3.0)

© Lidia Boghean

Supplier: JohelChaves

Unreviewed

Article rating from 0 people

Default rating: 2.5 of 5

Ecology

Habitat

Habitat and Ecology

Systems
  • Terrestrial
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Trophic Strategy

Primarily nectarivorous, this hummingbird usually feeds on the nectar of curved flower corollas. (Stiles & Skutch 1995). The Sicklebill visits only a limited selection of flowers. These species include Heliconia with curved flowers, including species pogonantha, longa, trichocarpa, and reticulate. It also visits the similarly curved flowers of Centropogon granulous. Even though the Sicklebill’s extraordinary bill gives it an advantage to feeding on curved flowers, its distinctive bill does not give it exclusive feeding rights to these flowers. Other hermits, including the relatively short-billed Barbthroat and the Bronzy Hermit also feed on these flowers. The Sicklebill almost always perches to feed, though it has sometimes been seen hovering at Centropogon granulosus (Fogden & Fogden 2006). The sicklebill also feeds on insects, (Remsen et al. 1986) often from spider webs or from trunks and branches (Hilty & Brown 1986, Stiles 1995).

White-tipped Sicklebill forages low near the ground in forest understory. Often clings to the flowers on which it is foraging (Stiles & Skutch 1989). The bill and head often are held slightly up when perched (Hilty & Brown 1989).

The foraging strategy of this hummingbird is called traplining. Traplining hummingbirds have long, often curved bills and feed at tubular flowers that are too long for hummingbirds with shorter bills to reach. These flowers produce abundant nectar, but are scattered throughout the forest. Trapliners exploit them by tracing a long route through the forest, visiting as many flowers as possible and retracing the route several times a day (Fogden & Fogden 2006). 

Creative Commons Attribution 3.0 (CC BY 3.0)

© Lidia Boghean

Supplier: JohelChaves

Unreviewed

Article rating from 0 people

Default rating: 2.5 of 5

Life History and Behavior

Behavior

Vocalizations

Calls of White-tipped Sicklebill are described as "high, thin, sharp piercing tsitting notes" (Stiles & Skutch 1989). The song of White-tipped Sicklebill is variously described as "a long series of variably squeaky notes in regular rhythm" (Costa Rica; Stiles & Skutch 1989). There may be geographic variation in the song. 

Creative Commons Attribution 3.0 (CC BY 3.0)

© Lidia Boghean

Supplier: JohelChaves

Unreviewed

Article rating from 0 people

Default rating: 2.5 of 5

Reproduction

 The White-tipped Sicklebill breeds in Costa Rica from January to May (Stiles and Skutch 1989). Nests are reported in Ecuador in January and September (Vigle 1982). In Colombia there are possibly two peaks of reproduction, one between April and June and another between November and December (Hilty & Brown 1986, Hinkelmann 1999).

Calls of White-tipped Sicklebill are described as "high, thin, sharp piercing tsitting notes" (Stiles & Skutch 1989). The song of White-tipped Sicklebill is variously described as "a long series of variably squeaky notes in regular rhythm" (Costa Rica; Stiles & Skutch 1989). There may be geographic variation in the song.

Male Sicklebills join small leks (aggregations of males that gather to engage in competitive displays) in Heliconia thickets, drawing attention to themselves with their song. Occasionally, they are heard singing alone. (Fogden & Fogden 2006). Like most hummingbirds, this species is polygynous, a mating system in which one male mates with multiple females, but each female only mates with a single male (Schuchmann 1999).

The nest of the Sicklebill is cup-shaped and is made out of fine rootlets, animal hair, fallen feathers, fungi rhizomes and some vegetable fibers. The female usually uses spider webs to stick all materials together. The nest is often hung between 1 and 4 m above brooks and streams. Generally, the nest is adhered to Heliconia leaves or to the underside of large leaves. (Vigle 1982).

The nests are built solely by females, and males do not help choose the nest site, build it or raise the chicks. Two white, elliptical eggs are incubated for 16 or 17 days. The female protects and feed the little chicks by regurgitating food. The chicks will stay in the nest for 22 to 25 days (Hinkelmann 1999).

  • BirdLife International 2012. Eutoxeres aquila. The IUCN Red List of Threatened Species. Version 2014.3. .
  • Brown, J.H., and M.A. Bowers. 1985. Community organization in hummingbirds: relationships between morphology and ecology. Auk 102: 251-269.
  • Fogden, Michael, and Patricia Fogden. 2006. Hummingbirds of Costa Rica. Richmond Hill, Ont.: Firefly.
  • Hilty, S. L., and Brown, W. L. 2001. Guía de las Aves de Colombia. (p. 1030). Princeton: Princeton University Press.
  • Hinkelmann, C. 1999. White-tipped Sicklebill Eutoxeres aquila. Page 537 in J. del Hoyo, J., A. Elliott, and J. Sargatal. Handbook of the birds of the world. Volume 5. Barn-Owls to hummingbirds. Lynx Edicions, Barcelona, Spain.
  • Remsen, J.V., Jr., F.G. Stiles, and P.E. Scott. 1986. Frequency of arthropods in stomachs of tropical hummingbirds. Auk 103: 436-441.
  • Rengifo, C., M.H. Bakermans, R. Puente, A.Vitz, A.D. Rodewald, and M. Zambrano. 2007. First record of the White-tipped Sicklebill (Eutoxeres aquila aquila: Trochilidae) for Venezuela. Wilson Journal of Ornithology 119: 292-295.
  • Ridgely, R.S., and P.J. Greenfield. 2001. The birds of Ecuador: status, distribution, and taxonomy. Cornell University Press, Ithaca, New York.
  • Schuchmann, K.L. 1999. Family Trochilidae (Hummingbirds. In J, Del Hoyo, A. Elliott and J. Sargatal. (eds). Handbook of the Birds of the World. Barn-owls to Hummingbirds. Barcelona: Lynx Edicions 5: 468-680.
  • Schulenberg, T.S., D.F. Stotz, D.F. Lane, J.P. O’Neill, and T.A. Parker III. 2010. Birds of Peru. Revised and updated edition. Princeton University Press, Princeton, New Jersey.
  • Stiles, F.G. 1995. Behavioral, ecological and morphological correlates of foraging for arthropods by the hummingbirds of a tropical wet forest. Condor 97: 853-878.
  • Stiles, F.G., and A.F. Skutch. 1989. A guide to the birds of Costa Rica. Cornell University Press, Ithaca, New York.
  • Stiles, F.G., and A.F. Skutch. 1995. Guía de aves de Costa Rica. INBio, San José, Costa Rica.
  • Vigle, G.O. 1982. A nest of Eutoxeres aquila heterura in western Ecuador. Auk 99: 172-173.
Creative Commons Attribution 3.0 (CC BY 3.0)

© Lidia Boghean

Supplier: JohelChaves

Unreviewed

Article rating from 0 people

Default rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Barcode data: Eutoxeres aquila

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There are 2 barcode sequences available from BOLD and GenBank.

Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.

See the BOLD taxonomy browser for more complete information about this specimen and other sequences.

CCTGTACTTAATTTTCGGGGCATGGGCCGGAATGGTCGGAACTGCCCTCAGCCTCCTAATCCGAGCAGAACTCGGTCAACCAGGCTCCCTTTTAGGAGACGACCAAATTTATAACGTAATCGTTACCGCCCACGCCTTCGTAATAATCTTCTTCATAGTTATACCTATCCTGATCGGGGGCTTTGGAAACTGATTAGTCCCCCTCATAATCGGGGCCCCTGACATAGCATTTCCACGCATAAATAACATAAGCTTCTGACTTCTCCCACCCTCATTCCTCCTCCTCCTAGCATCCTCTACTGTAGAAGCAGGAGCAGGCACAGGATGAACCGTGTATCCACCCCTGGCCGGCAATCTAGCCCACGCAGGCGCATCAGTAGACCTAGCCATCTTCTCACTCCACCTATCAGGTATCTCATCCATCCTAGGGGCAATCAACTTTATCACCACCGCAATCAACATAAAACCACCCGCCCTGTCACAATACCAAACTCCACTATTTGTTTGATCCGTCCTTATCACCGCCGTACTACTCCTTCTCTCACTCCCTGTGCTCGCCGCTGGAATTACCATGCTACTCACAGACCGAAACCTAAATACCACATTCTTTGATCCCGCCGGAGGAGGAGACCCCATCCTGTACCAACACTTA
-- end --

Download FASTA File

Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Statistics of barcoding coverage: Eutoxeres aquila

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 2
Specimens with Barcodes: 6
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Conservation

Conservation Status

IUCN Red List Assessment


Red List Category
LC
Least Concern

Red List Criteria

Version
3.1

Year Assessed
2012

Assessor/s
BirdLife International

Reviewer/s
Butchart, S. & Symes, A.

Contributor/s

Justification
This species has a very large range, and hence does not approach the thresholds for Vulnerable under the range size criterion (Extent of Occurrence <20,000 km2 combined with a declining or fluctuating range size, habitat extent/quality, or population size and a small number of locations or severe fragmentation). The population trend is not known, but the population is not believed to be decreasing sufficiently rapidly to approach the thresholds under the population trend criterion (>30% decline over ten years or three generations). The population size has not been quantified, but it is not believed to approach the thresholds for Vulnerable under the population size criterion (<10,000 mature individuals with a continuing decline estimated to be >10% in ten years or three generations, or with a specified population structure). For these reasons the species is evaluated as Least Concern.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Population

Population
The global population size has not been quantified, but this species is described as 'uncommon' (Stotz et al. 1996).

Population Trend
Unknown
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Wikipedia

White-tipped sicklebill

The white-tipped sicklebill (Eutoxeres aquila) is a species of hummingbird in the Trochilidae family. It is found in Costa Rica and Panama of Central America, and Colombia, Ecuador, and far northern Peru. There is also a single recent record from Mérida in Venezuela.

Its natural habitat is the undergrowth of subtropical or tropical humid lowland or montane forest. Its curved bill helps it reach nectar deep in its favorite flower.

References[edit]

Creative Commons Attribution Share Alike 3.0 (CC BY-SA 3.0)

Source: Wikipedia

Unreviewed

Article rating from 0 people

Default rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!