Articles on this page are available in 2 other languages: Chinese (Simplified) (7), Spanish (11) (learn more)

Overview

Brief Summary

Nycticorax nycticorax

A small (23-28 inches), thick-set heron, the Black-crowned Night-Heron is most easily identified by its gray wings, black back and head, pale breast, and, in the breeding season, twin white head plumes. Where their ranges overlap, this species may be distinguished from its relative, the Yellow-crowned Night Heron (Nyctanassa violacea), by the latter species’ black face, gray breast, and, logically, by its yellow crown. Male and female Black-crowned Night-Herons are similar in all seasons. The Black-crowned Night Heron inhabits every continent except Australia and Antarctica. In the North America, this species breeds at lower elevations across much of the United States and southern Canada. Some populations in warmer areas are non-migratory, but others migrate south to the southern U.S., interior Mexico, and Central America. Elsewhere in the New World, other populations exist in the West Indies, coastal Mexico, southern Central America, and South America south to southern Argentina and Chile. In the Old World, this species inhabits warmer parts of Europe, Asia, and Africa, with populations ranging from sedentary to fully migratory depending on climate and habitat. Black-crowned Night-Herons inhabit a variety of wetland habitats, whether flowing or standing, large or small, and freshwater or saltwater. In tropical areas, this species may be found in mangrove wetlands and lagoons. Black-crowned Night Herons primarily eat a number of plant and animal foods, including small fish, crustaceans, mollusks, reptiles, small mammals, and aquatic plant seeds and vegetation. Black-crowned Night-Herons may be best observed wading in shallow water, where they may be seen plunging their bills into the water to catch fish. It is also possible to see Black-crowned Night Herons at their nesting colonies, especially when they return to roost, or while flying with their feet extended and their necks pulled in. As its name suggests, this species hunts mainly from sunset to sunrise, although individuals may be seen during the morning and afternoon as well.

Threat Status: Least concern

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Unknown

Supplier: DC Birds

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Biology

The black-crowned night heron is an opportunistic predator, with a varied diet that includes small fish, crabs, crayfish, snakes, amphibians, small rodents, the chicks of other birds, insects and sometimes plant matter (2) (4) (6). Although a gregarious species, individuals generally forage alone, feeding throughout the night from dusk to early morning (2) (3). In the dimly lit hours of night, prey is pinpointed with the help of exceptional eyesight, and retrieved with a swift grasp of the bill (3). However, during the breeding season, when food is in high demand, daytime foraging is also relatively common (2) (4) Nesting occurs in large colonies, often comprising several different species, and located on islands or other suitable sites where predators pose less of a threat (2). During the breeding season, the male establishes a territory and typically performs a variety of displays to attract a female, including exaggerated bows that accentuate the white neck plumes, bill snapping, and twig shaking (2) (6). Initially the male constructs the nest alone, but following pair formation, the male presents twigs to the female, who in turn works them into the nest. The shallow nest may be located in the branch of a tree or shrub, in a reed bed or even just on the ground (2). Following copulation the female lays three to five greenish eggs, which are incubated by both parent birds for 24 to 26 days before hatching. The young are fed on food regurgitated by the parent birds and fledge after six to seven weeks, sometimes forming small flocks, and may continue to beg for food from the adults (6). Northern populations of the black-crowned night heron are migratory, travelling south over winter after the breeding season. Conversely, tropical populations, which nest during the rainy season, are largely sedentary, but may also exhibit some dispersal movements post-breeding (4).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Description

Despite being fairly ubiquitous on a global level, the slightly unusual nocturnal habit of the black-crowned night heron renders it less conspicuous than most other herons (2) (3) (4). Of moderate size for a heron, this stockily built species has short legs and a short neck, with the male, on average, being the slightly larger of the sexes (2) (5). As its name suggests, the adult black-crowned night heron has a glossy, black cap that extends down the upper back, while the rest of the body plumage generally ranges from white to ashy grey (2) (5). The nape is adorned with two to three long, white plumes reaching up to 25 cm in the breeding season (5). The stout bill is black in colour, the eyes, a piercing crimson, and the legs, yellow-green for most of the year but becoming pink during the breeding season (2) (5). Juveniles are mostly brown, with heavy striping and pale spots, but as they grow towards the adult plumage, become more solidly dark above and pale below (2). Four subspecies that differ subtly in appearance and occupy different ranges are currently recognised: Nycticorax nycticorax nycticorax, N. n. hoactli, N. n. obscurus and N. n. falkandicus (2) (5).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Distribution

Geographic Range

The black-crowned night heron is found across North America from Washington through Quebec, south through coastal Mexico, as well as locally in Central America and the Caribbean. Some winter as far north as Oregon and the New England states. The Old World race 'nycticorax' occurs from Europe to Japan, Africa and India. (Davis, 1993)

Biogeographic Regions: nearctic (Native ); palearctic (Native ); oriental (Native ); ethiopian (Native ); neotropical (Native )

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: BioKIDS Critter Catalog

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Geographic Range

The black-crowned night heron is found across North America from Washington through Quebec, south through coastal Mexico, as well as locally in Central America and the Caribbean. Some winter as far north as Oregon and the New England states. The Old World race 'nycticorax' occurs from Europe to Japan, Africa and India. (Davis, 1993)

Biogeographic Regions: nearctic (Native ); palearctic (Native ); oriental (Native ); ethiopian (Native ); neotropical (Native )

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

occurs (regularly, as a native taxon) in multiple nations

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

National Distribution

Canada

Origin: Native

Regularity: Regularly occurring

Currently: Present

Confidence: Confident

Type of Residency: Breeding

United States

Origin: Native

Regularity: Regularly occurring

Currently: Present

Confidence: Confident

Type of Residency: Year-round

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Global Range: (>2,500,000 square km (greater than 1,000,000 square miles)) BREEDS: Washington, southern Idaho, Saskatchewan, Michigan, and Nova Scotia south to southern South America, including Antilles; also Hawaii (Niihau to Hawaii). See Spendelow and Patton (1988) for information on distribution and abundance of coastal U.S. breeding populations (most coastal breeders are along Gulf Coast and Atlantic coast north of Florida). NORTHERN WINTER: north to Oregon, Utah, New Mexico, Texas, lower Ohio Valley, Gulf Coast, and southern New England. In the U.S., the highest winter densities occur in the vicinity of inland wildlife refuges near the California-Oregon border, along the northern California coast (Humboldt Bay), in the San Joaquin Valley of California, along the lower Colorado River, near Galveston Bay in Texas, and along the coast near Jacksonville, Florida (Root 1988). Also occurs in the Old World and on other Pacific islands.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Range

The black-crowned night heron breeds on every continent except for Antarctica and Australasia (2).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Physical Description

Morphology

Physical Description

The night heron has a stocky body, with a comparatively short neck and legs. The length averages 58-72 cm, with the females averaging slightly smaller than the males. The adult has distinctive coloring, with black cap, upper back and scapulars; gray wings, rump and tail; and white to pale gray underparts. The bill is stout and black, and the eyes are red. For most of the year, the legs of the adult are yellow-green, but by the height of the breeding season, they have turned pink. The eyes of the juvenile black-crowned night heron are yellowish or amber, and the dull gray legs lack the colorful pigmentation of those of the adult. The juvenile has a brown head, neck, chest and belly streaked with buff and white. The wings and back are darker brown, though the tips of the feathers have large white spots. These spots are particularly large on the greater secondary coverts. The young do not acquire full adult plumage until the third year. (Davis, 1993;   http://www.mbr.nbs.gov/id/htmid/h2020id.html)

Average mass: 800 g.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: BioKIDS Critter Catalog

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Physical Description

The night heron has a stocky body, with a comparatively short neck and legs. The length averages 58-72 cm, with the females averaging slightly smaller than the males. The adult has distinctive coloring, with black cap, upper back and scapulars; gray wings, rump and tail; and white to pale gray underparts. The bill is stout and black, and the eyes are red. For most of the year, the legs of the adult are yellow-green, but by the height of the breeding season, they have turned pink. The eyes of the juvenile black-crowned night heron are yellowish or amber, and the dull gray legs lack the colorful pigmentation of those of the adult. The juvenile has a brown head, neck, chest and belly streaked with buff and white. The wings and back are darker brown, though the tips of the feathers have large white spots. These spots are particularly large on the greater secondary coverts. The young do not acquire full adult plumage until the third year. (Davis, 1993;   http://www.mbr.nbs.gov/id/htmid/h2020id.html)

Average mass: 800 g.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Size

Length: 64 cm

Weight: 883 grams

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Diagnostic Description

Adult differs from adult yellow-crowned night-heron in having a black back that contrasts with the gray wings (vs. back and wings same color). Immature differs from immature yellow-crowned nigh-heron in browner upperparts with bolder white spotting, thicker neck, paler face, and longer thinner bill with the lower mandible mostly pale (vs. dark). All ages have shorter legs than does yellow-crowned night-heron (in flight, legs extend barely beyond tail vs. well beyond tail). Immature differs from American bittern in having flight feathers that are not conspicuously darker than the brown areas of the back.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Ecology

Habitat

Habitat and Ecology

Habitat and Ecology
Behaviour Northern populations of this species are migratory, with those breeding in the western Palearctic travelling on a broad front across the Sahara (del Hoyo et al. 1992) and those breeding in North American travelling on a narrow front along the Atlantic and Pacific coasts (Kushlan and Hancock 2005). Post-breeding southward movements occur from September to October and return northward movements occur from March to May (Kushlan and Hancock 2005). Tropical populations are not migratory but may undergo seasonal post-breeding dispersive movements (del Hoyo et al. 1992). In temperate regions breeding occurs in the local spring, with tropical and subtropical nesting generally coinciding with the rains (Kushlan and Hancock 2005). The species usually nests in small numbers (Snow and Perrins 1998) in single- or mixed-species colonies (del Hoyo et al. 1992), although sometimes groups may reach several thousand pairs (del Hoyo et al. 1992). When nesting within mixed-species colonies the species tends to form monospecific clusters (Kushlan and Hancock 2005). The species's aggregatory behaviour outside of the breeding season varies much throughout its range, some populations (e.g. in America) remaining highly gregarious throughout the year (Snow and Perrins 1998) and gathering in flocks of hundreds or even thousands to roost (del Hoyo et al. 1992), others (e.g. Palearctic breeders) being largely solitary except when roosting or on migration (Snow and Perrins 1998) (roosting flocks of 2-6 to 200 are known in Africa (Brown et al. 1992) and small flocks occur on migration) (del Hoyo et al. 1992). The species is largely crepuscular and nocturnal, but may feed diurnally especially during the breeding season (del Hoyo et al. 1992). Habitat The species inhabits fresh, brackish or saline waters with aquatic vegetation and bamboo or trees (e.g. pine, oak or mangroves) for roosting and nesting in (del Hoyo et al. 1992), showing a preference for islands or predator-free areas for nesting sites (Kushlan and Hancock 2005). It occupies the forested margins of shallow rivers, streams, lagoons, pools, ponds, lakes, marshes and mangroves and may feed on pastures, reservoirs, canals, aquaculture ponds (del Hoyo et al. 1992) and rice-fields (up to 96 % of a colony's food resources may be taken from nearby rice-fields) (Kushlan and Hancock 2005). On migration the species may also frequent dry grasslands or marine coasts (del Hoyo et al. 1992), kelp beds (Kushlan and Hancock 2005) and estuaries (Hockey et al. 2005). It breeds up to 4,800 m (Chile) (Kushlan and Hancock 2005) but is more common at elevations of up to c.2,000 m (Snow and Perrins 1998). Diet It is an opportunistic feeder taking fish, frogs, tadpoles, turtles, snakes, lizards, adult and larval insects (del Hoyo et al. 1992) (e.g. beetles, bugs, grasshoppers, crickets, flies and dragonflies) (Kushlan and Hancock 2005), spiders, crustaceans, molluscs, leeches, small rodents, bats and the eggs and chicks of other bird species (del Hoyo et al. 1992). Breeding site The nest is platform constructed of sticks and vegetation (del Hoyo et al. 1992, Kushlan and Hancock 2005) placed 2-50 m above water or on dry ground near water (Snow and Perrins 1998) in trees, bushes, reedbeds, on cliff ledges (del Hoyo et al. 1992) (overhanging rivers) (Hockey et al. 2005) and on the ground (del Hoyo et al. 1992) in protected sites (Kushlan and Hancock 2005). The species nests close together in single- and mixed-species colonies (del Hoyo et al. 1992) with as many as 20-30 pairs in the same tree (Kushlan and Hancock 2005). Colony sites may be reused in consecutive years or flocks may move to new sites (usually such movements are a result of nesting trees being destroyed due to the colony's nesting activities) (Kushlan and Hancock 2005). Colony sites are dispersed throughout the landscape in relation to distance from feeding areas (Kushlan and Hancock 2005). Management information A study carried out in north-west Italy suggests that existing nesting sites should be protected and that breeding habitats should be actively managed in order to maintain suitable habitat characteristics (Fasola and Alieri 1992). The creation of a network of new nesting sites spaced at 4-10 km in relation to available foraging habitats in zones currently without suitable nesting sites is also recommended (Fasola and Alieri 1992).

Systems
  • Terrestrial
  • Freshwater
  • Marine
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Most colonies of black-crowned night herons are associated with large wetlands. They inhabit a variety of wetland habitats such as swamps, streams, rivers, marshes, mud flats and the edges of lakes that have become overgrown with rushes and cattails. (Davis, 1993;   http://www.biology.ualberta.ca/uamz.hp/heron.html)

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: BioKIDS Critter Catalog

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Most colonies of black-crowned night herons are associated with large wetlands. They inhabit a variety of wetland habitats such as swamps, streams, rivers, marshes, mud flats and the edges of lakes that have become overgrown with rushes and cattails. (Davis, 1993;   http://www.biology.ualberta.ca/uamz.hp/heron.html)

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Comments: Marshes, swamps, wooded streams, mangroves, shores of lakes, ponds, lagoons; salt water, brackish, and freshwater situations. Roosts by day in mangroves or swampy woodland. Eggs are laid in a platform nest in groves of trees near coastal marshes or on marine islands, swamps, marsh vegetation, clumps of grass on dry ground, orchards, and in many other situations. Nests usually with other heron species.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Occurs in a broad range of fresh, brackish and salt-water habitats, from rivers, lakes and swamps to lagoons, mudflats, and salt-marsh (2). Aquatic and marginal vegetation such as reed beds, bamboo, mangroves and other trees are important for nesting and roosting (4).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Migration

Non-Migrant: Yes. At least some populations of this species do not make significant seasonal migrations. Juvenile dispersal is not considered a migration.

Locally Migrant: Yes. At least some populations of this species make local extended movements (generally less than 200 km) at particular times of the year (e.g., to breeding or wintering grounds, to hibernation sites).

Locally Migrant: Yes. At least some populations of this species make annual migrations of over 200 km.

Arrives in northern breeding areas March-May, departs by September-November. Extensive postbreeding dispersal to areas outside breeding range (Palmer 1962).

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Trophic Strategy

Food Habits

The black-crowned night heron is an opportunistic feeder. Its diet consists mainly of fish, though it is frequently rounded out by other items such as leeches, earthworms, aquatic and terrestrial insects. It also eats crayfish, mussels, squid, amphibians, lizards, snakes, rodents, birds, eggs, carrion, plant materials, and garbage and refuse at landfills. It is usually a solitary forager, and it strongly defends its feeding territory. The night heron prefers to feed in shallow waters, where it grasps its prey with its bill instead of stabbing it. A technique called 'bill vibrating'--which is opening and closing the bill rapidly in water--creates a disturbance which may lure prey. Evening to early morning are the usual times it feeds, but when food is in high demand, such as during the breeding season, it will feed at any time of the day. (Davis, 1993)

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: BioKIDS Critter Catalog

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Food Habits

The black-crowned night heron is an opportunistic feeder. Its diet consists mainly of fish, though it is frequently rounded out by other items such as leeches, earthworms, aquatic and terrestrial insects. It also eats crayfish, mussels, squid, amphibians, lizards, snakes, rodents, birds, eggs, carrion, plant materials, and garbage and refuse at landfills. It is usually a solitary forager, and it strongly defends its feeding territory. The night heron prefers to feed in shallow waters, where it grasps its prey with its bill instead of stabbing it. A technique called 'bill vibrating'--which is opening and closing the bill rapidly in water--creates a disturbance which may lure prey. Evening to early morning are the usual times it feeds, but when food is in high demand, such as during the breeding season, it will feed at any time of the day. (Davis, 1993)

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Comments: Feeds opportunistically on small animals; usually fishes, amphibians, and invertebrates obtained in shallow water but also small mammals and young birds on land.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Associations

Known prey organisms

Nycticorax nycticorax preys on:
Pimephales notatus

This list may not be complete but is based on published studies.
Creative Commons Attribution 3.0 (CC BY 3.0)

© SPIRE project

Source: SPIRE

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Population Biology

Number of Occurrences

Note: For many non-migratory species, occurrences are roughly equivalent to populations.

Estimated Number of Occurrences: > 300

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Global Abundance

100,000 to >1,000,000 individuals

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Life History and Behavior

Cyclicity

Comments: Sometimes feeds by day (especially immatures), usually crepuscular and nocturnal.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Life Expectancy

Lifespan/Longevity

Average lifespan

Status: wild:
253 months.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: BioKIDS Critter Catalog

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Lifespan/Longevity

Average lifespan

Status: wild:
253 months.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Lifespan, longevity, and ageing

Maximum longevity: 21.1 years (wild) Observations: In the wild, most animals do not live more than 3 years (John Terres 1980).
Creative Commons Attribution 3.0 (CC BY 3.0)

© Joao Pedro de Magalhaes

Source: AnAge

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Reproduction

Black-crowned night herons are presumed to be monogamous. Pair formations are signaled by males becoming aggressive and performing Snap Displays, in which they walk around in a crouched position, head lowered, snapping their mandibles together or grasping a twig. The Snap Display is followed by the Advertisement Display--sometimes called the Stretch, Snap-hiss, or Song and Dance display--to attract females. In this display a male stretches his neck out and bobs his head, and when his head is level with his feet, he gives a snap-hiss vocalization. Twig-shaking and preening may be occur between songs. It has been suggested that these displays provide social stimulus to other birds, prompting them to display. This stimultion in colonial species may be crucial for successful reproduction. Females that come near the displaying male are rejected at first, but eventually a female is allowed to enter his territory. The newly-formed pair then allopreens and engages in mutual billing. At the time of pair formation, the legs of both sexes turn pink. Copulation usually takes place on or near the nest, and begins the first or second day after the pair is formed.

There is one brood per season. Black-crowned night herons nest colonially, and often there can be more than a dozen nests in one tree. The nest is built near the trunk of a tree or in the fork of branches, either in the open or deep in foliage. The male initiates nest building by beginning to build a new nest or refurbishing an old one. The nest is usually a platform lined with roots and grass. During and after pair formation, the male collects sticks and presents them to the female, who works them into the nest. The male's twig ceremony gradually changes to nest building.

The eggs are laid at 2 day intervals, beginning 4-5 days after pair formation. Incubation, which lasts 24-26 days, is carried out by both adults. The clutch size is 3-5 eggs. The eggs are greenest on the first day and fade to pale blue or green after that. On hot days, the parents wet their feathers, perhaps to keep the eggs cool. Both parents brood the young. After 2 weeks, the young leave the nest, although they don't go far. By 3 weeks, they can be found clustered at the tops of trees if they are disturbed. By Week 6-7 they fly well and depart for the feeding grounds. Adult black-crowned night herons do not recognize their own young and will accept and brood young from other nests. The young have a tendancy to regurgitate their food onto intruders when disturbed. (Davis, 1993)

Average time to hatching: 25 days.

Average eggs per season: 4.

Average age at sexual or reproductive maturity (male)

Sex: male:
730 days.

Average age at sexual or reproductive maturity (female)

Sex: female:
730 days.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: BioKIDS Critter Catalog

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Black-crowned night herons are presumed to be monogamous. Pair formations are signaled by males becoming aggressive and performing Snap Displays, in which they walk around in a crouched position, head lowered, snapping their mandibles together or grasping a twig. The Snap Display is followed by the Advertisement Display--sometimes called the Stretch, Snap-hiss, or Song and Dance display--to attract females. In this display a male stretches his neck out and bobs his head, and when his head is level with his feet, he gives a snap-hiss vocalization. Twig-shaking and preening may be occur between songs. It has been suggested that these displays provide social stimulus to other birds, prompting them to display. This stimultion in colonial species may be crucial for successful reproduction. Females that come near the displaying male are rejected at first, but eventually a female is allowed to enter his territory. The newly-formed pair then allopreens and engages in mutual billing. At the time of pair formation, the legs of both sexes turn pink. Copulation usually takes place on or near the nest, and begins the first or second day after the pair is formed.

There is one brood per season. Black-crowned night herons nest colonially, and often there can be more than a dozen nests in one tree. The nest is built near the trunk of a tree or in the fork of branches, either in the open or deep in foliage. The male initiates nest building by beginning to build a new nest or refurbishing an old one. The nest is usually a platform lined with roots and grass. During and after pair formation, the male collects sticks and presents them to the female, who works them into the nest. The male's twig ceremony gradually changes to nest building.

The eggs are laid at 2 day intervals, beginning 4-5 days after pair formation. Incubation, which lasts 24-26 days, is carried out by both adults. The clutch size is 3-5 eggs. The eggs are greenest on the first day and fade to pale blue or green after that. On hot days, the parents wet their feathers, perhaps to keep the eggs cool. Both parents brood the young. After 2 weeks, the young leave the nest, although they don't go far. By 3 weeks, they can be found clustered at the tops of trees if they are disturbed. By Week 6-7 they fly well and depart for the feeding grounds. Adult black-crowned night herons do not recognize their own young and will accept and brood young from other nests. The young have a tendancy to regurgitate their food onto intruders when disturbed. (Davis, 1993)

Average time to hatching: 25 days.

Average eggs per season: 4.

Average age at sexual or reproductive maturity (male)

Sex: male:
730 days.

Average age at sexual or reproductive maturity (female)

Sex: female:
730 days.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Breeding season varies geographically, occurs in spring-early summer in north, earlier in Florida. Clutch size usually is 3-5 in north, 2-4 in south. Incubation lasts apparently 24-26 days, by both sexes. Young are tended by both sexes, first fly at about 42 days. Usually first breeds at 2-3 years. Nests in small to large colonies. See Custer et al. (1983) for data on certain Atlantic coast colonies.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Barcode data: Nycticorax nycticorax

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There are 8 barcode sequences available from BOLD and GenBank.  Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.  See the BOLD taxonomy browser for more complete information about this specimen and other sequences.

GTGACCTTCATTACCCGATGATTATTTTCAACTAACCACAAAGATATCGGTACCCTATATCTAATCTTTGGAGCATGAGCTGGCATAATCGGAACTGCCCTAAGCCTGCTCATCCGAGCCGAACTCGGACAGCCAGGAACACTACTTGGAGACGACCAAATCTACAATGTAATTGTTACCGCCCACGCCTTTGTAATAATCTTCTTTATAGTGATACCAATCATAATTGGAGGATTCGGAAACTGACTAGTACCACTAATAATTGGTGCCCCAGACATAGCATTCCCCCGTATAAACAACATGAGCTTCTGGCTCCTACCACCATCATTTATACTACTATTAGCCTCTTCTACAGTTGAAGCAGGGGCAGGTACAGGTTGAACAGTATATCCACCACTAGCCGGTAATCTAGCTCATGCCGGAGCCTCAGTCGACCTAGCTATCTTCTCCCTTCACCTAGCAGGTGTATCCTCTATCCTAGGGGCAATTAACTTCATTACAACCGCTATCAATATAAAACCCCCAGCCCTGTCACAATATCAAACCCCTCTGTTCGTATGATCTGTCCTAATTACCGCCGTCTTACTCCTACTTTCACTTCCAGTTCTTGCCGCAGGTATTACAATACTACTAACTGATCGAAACTTAAATACCACATTCTTTGATCCTGCTGGAGGCGGGGACCCAGTTCTCTACCAACACCTATTTTGATTCTTTGGCCACCCAGAAGTCTACATCCTAAT
-- end --

Download FASTA File
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Statistics of barcoding coverage: Nycticorax nycticorax

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 18
Specimens with Barcodes: 25
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Conservation

Conservation Status

IUCN Red List Assessment


Red List Category
LC
Least Concern

Red List Criteria

Version
3.1

Year Assessed
2012

Assessor/s
BirdLife International

Reviewer/s
Butchart, S. & Symes, A.

Contributor/s

Justification
This species has an extremely large range, and hence does not approach the thresholds for Vulnerable under the range size criterion (Extent of Occurrence <20,000 km2 combined with a declining or fluctuating range size, habitat extent/quality, or population size and a small number of locations or severe fragmentation). Despite the fact that the population trend appears to be decreasing, the decline is not believed to be sufficiently rapid to approach the thresholds for Vulnerable under the population trend criterion (>30% decline over ten years or three generations). The population size is very large, and hence does not approach the thresholds for Vulnerable under the population size criterion (<10,000 mature individuals with a continuing decline estimated to be >10% in ten years or three generations, or with a specified population structure). For these reasons the species is evaluated as Least Concern.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

In the late 1960s, declines in many black-crowned night heron populations were noted, and were attributed to the use of DDT. The status of these populations is indicative of environmental quality due to the high rank of these birds in the food chain, and their wide geographic distribution.

Adults were often killed or trapped near fish-culture establishments, due to their fishy diet, but other methods of discouraging them from eating the fish are now available. It is estimated that 1,300 birds were killed per year at fish hatcheries in nine states. Herons that nested too close to human settlements were considered pests and were also often killed, but other methods that do not involve killing have been developed. Since most populations are stablized or increasing, management has not been a major focus, though habitat destruction is an important factor in the conservation of this species. (Davis, 1993) This is a species of special concern in Michigan.

IUCN Red List of Threatened Species: least concern

US Migratory Bird Act: protected

US Federal List: no special status

CITES: no special status

State of Michigan List: special concern

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: BioKIDS Critter Catalog

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

In the late 1960s, declines in many black-crowned night heron populations were noted, and were attributed to the use of DDT. The status of these populations is indicative of environmental quality due to the high rank of these birds in the food chain, and their wide geographic distribution.

Adults were often killed or trapped near fish-culture establishments, due to their fishy diet, but other methods of discouraging them from eating the fish are now available. It is estimated that 1,300 birds were killed per year at fish hatcheries in nine states. Herons that nested too close to human settlements were considered pests and were also often killed, but other methods that do not involve killing have been developed. Since most populations are stablized or increasing, management has not been a major focus, though habitat destruction is an important factor in the conservation of this species. (Davis, 1993) This is a species of special concern in Michigan.

US Migratory Bird Act: protected

US Federal List: no special status

CITES: no special status

State of Michigan List: special concern

IUCN Red List of Threatened Species: least concern

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Status in Egypt

Resident breeder?, regular passage visitor and winter visitor.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Bibliotheca Alexandrina

Source: Bibliotheca Alexandrina - EOL Ar

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

National NatureServe Conservation Status

Canada

Rounded National Status Rank: N4B - Apparently Secure

United States

Rounded National Status Rank: N5B,N5N : N5B: Secure - Breeding, N5N: Secure - Nonbreeding

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

NatureServe Conservation Status

Rounded Global Status Rank: G5 - Secure

Reasons: Very large range (southern Canada to southern South America; Old World); fairly common in many local areas.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Status

Classified as Least Concern (LC) on the IUCN Red List (1).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Population

Population
The global population is estimated to number c.510,000-3,600,000 individuals (Wetlands International 2006), while national population estimates include: c.100,000-1 million breeding pairs, >c.10,000 individuals on migration and >c.10,000 wintering individuals in China; c.100,000-1 million breeding pairs in Taiwan; c.10,000-100,000 breeding pairs and c.50-1,000 wintering individuals in Korea and c.10,000-100,000 breeding pairs and c.1,000-10,000 individuals on migration in Japan (Brazil 2009).

Population Trend
Decreasing
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Global Short Term Trend: Relatively stable (=10% change)

Comments: Stable or increasing in most areas of North America, but has declined in some areas (Herkert 1992). Populations in the south-central U.S. may be benefiting from crayfish aquaculture; bird population increases may be related to favorable foraging opportunities afforded by expanding crayfish aquaculture (Fleury and Sherry 1995). Hawaiian population was a few hundred and increasing in the mid-1980s (Scott et al. 1988); summer counts declined in the mid- and late 1980s, apparently due to a control program instituted by federal and state agencies at the request of aquaculture farmers on Oahu (Engilis and Pratt 1993).

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Threats

Major Threats
The species is threatened by wetland drainage and destruction (del Hoyo et al. 1992, Kushlan and Hancock 2005) and by drought in wintering areas (Hafner and Kushlan 2002). It is highly susceptible to pesticides (del Hoyo et al. 1992, Kwon et al. 2004, Kushlan and Hancock 2005) such as organophosphates, carbamates (Kwon et al. 2004) and DDE (a breakdown product of DDT) which negatively affect hatching success (Kushlan and Hancock 2005). There are also cases of genetic damage to chicks as a result of petroleum contamination (Custer 2000). The species is susceptible to avian influenza (Melville and Shortridge 2006) and Newcastle disease so may be threatened by future outbreaks (Kuiken et al. 2006). It is also persecuted (anti-predation killing) at aquaculture facilities due to its depredation on fish stocks (Kushlan and Hancock 2005), and has suffered declines due to the exploitation of chicks from nesting colonies in the past (del Hoyo et al. 1992). Utilisation Chicks of the species are still taken for food in some areas (e.g. Madagascar) (Kushlan and Hancock 2005, Hafner 200) and adults are hunted and traded at traditional medicine markets in Nigeria (Nikolaus 2001).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Comments: Has declined in some areas due to disturbance, degradation, and/or destruction of nesting and foraging areas (Herkert 1992). Particularly sensitive to disturbance just before and during laying (Tremblay and Ellison 1979). Certain U.S. breeding populations in the intermountain west have high DDT levels and exhibit low productivity; DDT may be accumulated in southwestern U.S. wintering areas. Custer et al. (1983) found that environmental contaminants had a minimal impact on overall reproductive success of U.S. Atlantic coast populations.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Although the black-crowned night heron is still relatively widespread and abundant, localised threats do present a concern for some populations (4). Some of the main threats cited for this species in different parts of its range include habitat loss, wetland degradation, pesticide and petroleum contamination, disease and hunting (2) (4) (6).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Management

Management Requirements: In Illinois, a public viewing area used once a week by humans 229 m from a rookery did not cause any overt responses from nesting birds (DeMauro 1993).

Predation on shrimp and fishes in aquaculture ponds in Oahu, Hawaii, has resulted in control actions (Engilis and Pratt 1993).

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Conservation

There are no known conservation efforts for the black-crowned night heron at an international level but local conservation groups are working towards preserving declining populations in parts of its range. For instance, in Pennsylvania, where the species has been listed as Endangered following ongoing population declines, several important colonies are now protected (6)
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Relevance to Humans and Ecosystems

Benefits

Economic Importance for Humans: Negative

At fish hatcheries, humans claimed that the amount of fish the birds were consuming were becoming destructive. If they nest near human settlements, they are considered pests. (Davis, 1993)

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: BioKIDS Critter Catalog

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Economic Importance for Humans: Positive

Black-crowned night herons have been hunted for food, though they are hunted for this purpose much less frequently now.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: BioKIDS Critter Catalog

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Economic Importance for Humans: Negative

At fish hatcheries, humans claimed that the amount of fish the birds were consuming were becoming destructive. If they nest near human settlements, they are considered pests. (Davis, 1993)

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Economic Importance for Humans: Positive

Black-crowned night herons have been hunted for food, though they are hunted for this purpose much less frequently now.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Economic Uses

Comments: Predation on shrimp and fishes in aquaculture ponds in Oahu, Hawaii, has resulted in control actions (Engilis and Pratt 1993).

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Wikipedia

Black-crowned Night Heron

The Black-crowned Night Heron (Nycticorax nycticorax), commonly abbreviated to just Night Heron in Eurasia, is a medium-sized heron found throughout a large part of the world, except in the coldest regions and Australasia (where it is replaced by the closely related Rufous Night Heron, with which it has hybridized in the area of contact).

Description[edit]

Juvenile
Carrying snake, Taipei, Taiwan

Adults are approximately 64 cm (25 in) long and weigh 800 g (28 oz). They have a black crown and back with the remainder of the body white or grey, red eyes, and short yellow legs. They have pale grey wings and white under parts. Two or three long white plumes, erected in greeting and courtship displays, extend from the back of the head. The sexes are similar in appearance although the males are slightly larger. Black-crowned Night Herons do not fit the typical body form of the heron family. They are relatively stocky with shorter bills, legs, and necks than their more familiar cousins, the egrets and "day" herons. Their resting posture is normally somewhat hunched but when hunting they extend their necks and look more like other wading birds.

Immature birds have dull grey-brown plumage on their heads, wings, and backs, with numerous pale spots. Their underparts are paler and streaked with brown. The young birds have orange eyes and duller yellowish-green legs. They are very noisy birds in their nesting colonies, with calls that are commonly transcribed as quok or woc, woc.

Distribution[edit]

The breeding habitat is fresh and salt-water wetlands throughout much of the world. The subspecies N. n. hoactli breeds in North and South America from Canada as far south as northern Argentina and Chile, N. n. obscurus in southernmost South America, N. n. falklandicus in the Falkland Islands, and the nominate race N. n. nycticorax in Europe, Asia and Africa. Black-crowned Night Herons nest in colonies on platforms of sticks in a group of trees, or on the ground in protected locations such as islands or reedbeds. Three to eight eggs are laid.

This heron is migratory in the northernmost part of its range, but otherwise resident (even in the cold Patagonia). The North American population winters in Mexico, the southern United States, Central America, and the West Indies, and the Old World birds winter in tropical Africa and southern Asia.

Feeding

Behaviour[edit]

These birds stand still at the water's edge and wait to ambush prey, mainly at night or early morning. They primarily eat small fish, crustaceans, frogs, aquatic insects, small mammals, reptiles and small birds. During the day they rest in trees or bushes. N. n. hoactli is more gregarious outside the breeding season than the nominate race.

Etymology[edit]

The scientific name, Nycticorax, means "night raven", and refers to this species' nocturnal habits and harsh crow-like call.

In the Falkland Islands, the bird is called "quark", which is an onomatopoeia similar to its name in many other languages, like "kwak" in Dutch and Frisian, "kvakoš noční" in Czech, "квак" in Ukrainian, "кваква" in Russian, "Vạc" in Vietnamese, "Kowak-malam" in Indonesian, and "Waqwa" in Quechua.

References[edit]

Creative Commons Attribution Share Alike 3.0 (CC BY-SA 3.0)

Source: Wikipedia

Unreviewed

Article rating from 0 people

Average rating: 2.5 of 5

Names and Taxonomy

Taxonomy

Comments: Constitutes a superspecies with N. CALEDONICUS (AOU 1998).

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!