Articles on this page are available in 1 other language: Spanish (9) (learn more)

Overview

Brief Summary

Egretta thula

Smaller (20-27 inches) than North America’s other light-colored herons and egrets, the Snowy Egret is most easily identified by its black bill, black legs, yellow feet, and regal breeding plumes. Other field marks include an all-white body, short tail, and small yellow skin patch on the face. Male and female Snowy Egrets are similar to one another in all seasons. The Snowy Egret breeds along the east coast of the United States north to Maine and locally in the interior southeast and west. Coastal birds are non-migratory, while interior birds migrate to the Atlantic and Gulf coasts, the Pacific coast of California and in the interior from northern Mexico south to Panama. Other non-migratory populations occur along both coasts of Mexico and Central America as well as in the West Indies. Snowy Egrets live in and around small bodies of water. In summer, Snowy Egrets nest in colonies, called ‘rookeries,’ in trees surrounding lakes and ponds. This species utilizes similar habitats during the winter. Snowy Egrets mainly eat fish, but may also take crustaceans and small vertebrates (such as frogs, lizards, and mice) when the opportunity arises. Snowy Egrets may be best observed wading in shallow water, where they may be seen plunging their bills into the water to catch fish. It is also possible to see Snowy Egrets at their rookeries, especially when they return to roost at sunset, or while flying with their feet extended and their necks pulled in. Snowy Egrets are primarily active during the day.

Threat Status: Least concern

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Unknown

Supplier: DC Birds

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Distribution

Global Range: (>2,500,000 square km (greater than 1,000,000 square miles)) BREEDING: northern California, southern Idaho, Kansas, lower Mississippi Valley, and Gulf and Atlantic coasts north to Maine, south through Mexico and the Antilles to South America (to southern Chile and central Argentina). See Spendelow and Patton (1988) for information on the distribution and abundance of coastal U.S. breeding colonies. NON-BREEDING: northern California, southwestern Arizona, Gulf Coast, and South Carolina southward through the breeding range. In the U.S., areas with the highest densities in winter include the Gulf Coast along the Texas-Louisiana border, the mouth of the Mississippi River, the lower Colorado River, and Florida (Root 1988). Wanders irregularly outside usual range; rare straggler to Hawaii.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 1 person

Average rating: 4.0 of 5

North America
Creative Commons Attribution 3.0 (CC BY 3.0)

© WoRMS for SMEBD

Source: World Register of Marine Species

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Gulf of Maine, Gulf of Mexico, North West Atlantic
Creative Commons Attribution 3.0 (CC BY 3.0)

© WoRMS for SMEBD

Source: World Register of Marine Species

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Geographic Range

Egretta thula is found throughout North, Central, and South America as well as the Caribbean. It breeds in coastal and inland wetlands, but its range limits have changed over time due to the effects of hunting and habitat loss. Small breeding populations are located in Nova Scotia, Canada, and more heavily populated locations are found across the United States. Egretta thula is common among northern Nevada, Utah, and southeastern states, especially Florida and states bordering the Gulf of Mexico. This egret is most prevalent throughout Mexico, Central America, and South America. Egretta thula is a partially migratory species, as it relocates from its northern habitats of the United States and Canada to its winter ranges located in Mexico, Central America, South America, the West Indies, and Bermuda. Snowy Egrets begin their northward migration in early March and depart in September to migrate to their wintering areas.

Biogeographic Regions: nearctic (Native ); neotropical (Native ); oceanic islands (Native )

  • Parsons, K., T. Master. 2000. Snowy Egret. The Birds of North America, 489: 1-23.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

occurs (regularly, as a native taxon) in multiple nations

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

National Distribution

Canada

Origin: Native

Regularity: Regularly occurring

Currently: Present

Confidence: Confident

Type of Residency: Breeding

United States

Origin: Native

Regularity: Regularly occurring

Currently: Present

Confidence: Confident

Type of Residency: Year-round

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Physical Description

Morphology

Physical Description

Egretta thula is a medium-sized heron with a delicate build. Adult egrets generally measure between 56 to 66 cm and have a wingspan of approximately 100 cm. Egrets average 370 g in weight and the males tend to be slightly larger than the females. Egretta thula has entirely white plumage, a long, slender black bill, bright yellow lores, and long, slender black legs with bright yellow feet. Eyes are yellow. Breeding adults develop long, delicate plumes off their breast and are also characterized by their change in foot color, from yellow to orange. There are no overall differences in appearance between breeding populations, however, populations studied in North America and Central America are found to have a larger bill than egrets of South America.

Average mass: 370 g.

Average length: 56-66 cm.

Average wingspan: 100 cm.

Sexual Dimorphism: male larger

Average mass: 314 g.

  • Chandler, R. 1997. Snowy Egret. Journal of Field Ornithology, 68: 287-295.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Size

Length: 61 cm

Weight: 371 grams

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Diagnostic Description

Differs from great egret in being much smaller (length 61 cm vs. 99 cm) and in having a black bill rather than a yellow one. Differs from immature little blue heron in having predominantly dark legs (vs. dull yellow), a slimmer mostly black bill (vs. two-toned with gray base and dark tip), and usually paler wing tips. Differs from cattle egret in being larger (length 61 cm vs. 51 cm), slim rather than stocky, and in having a black bill (vs. yellow or red-orange) and predominantly dark legs (vs. yellow or dusky-red). Differs from rare white-phase adult reddish egret in having yellow toes and lacking a two-toned pink-and-black bill.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Ecology

Habitat

Habitat and Ecology

Systems
  • Terrestrial
  • Freshwater
  • Marine
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Egretta thula generally prefers an environment of shallow water inlets for feeding purposes. Salt-marsh pools, tidal channels, shallow bays, and mangroves are among the most preferred habitats in North America. Habitats are most common among coastal areas and islands due to the availability of stable and abundant food sources. During the winter months, egrets migrate to the Caribbean to nest and roost in the mangroves. The Caribbean is home to other favorable egret habitats including salt-water lagoons, freshwater swamps, grassy ponds, beaches, shallow reef areas, flooded rice fields, and wet grassy meadows. Throughout Central America, E. thula prefers mainly lowland areas near freshwater swamps, lakes, and large river mouths. South American species also prefer coastal mangroves, mudflats, and swamps rather than highland areas.

Habitat Regions: temperate ; tropical ; terrestrial

Wetlands: marsh ; swamp

Other Habitat Features: riparian ; estuarine

  • Howell, S., S. Webb. 1995. A Guide to the Birds of Mexico and Northern Central America. Oxford: Oxford University Press.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Depth range based on 6 specimens in 1 taxon.

Environmental ranges
  Depth range (m): 0 - 0
 
Note: this information has not been validated. Check this *note*. Your feedback is most welcome.
Public Domain

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Comments: Marshes, lakes, ponds, lagoons, mangroves, and shallow coastal habitats.

Nests in trees or shrubs or, in some areas, on ground or in marsh vegetation. Often nests with other colonial water birds. Nests over water or ground. See references in Spendelow and Patton (1988) for further details.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Migration

Non-Migrant: Yes. At least some populations of this species do not make significant seasonal migrations. Juvenile dispersal is not considered a migration.

Locally Migrant: Yes. At least some populations of this species make local extended movements (generally less than 200 km) at particular times of the year (e.g., to breeding or wintering grounds, to hibernation sites).

Locally Migrant: Yes. At least some populations of this species make annual migrations of over 200 km.

Migratory in north. Northern birds winter largely in Middle America (Stiles and Skutch 1989).

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Trophic Strategy

Food Habits

Egretta thula prefers foraging habitats near bodies of shallow water, which are ideal for food sources. Its broad diet consists of earthworms, annelid worms, aquatic and terrestrial insects, crabs, shrimp, crayfish, snails, freshwater and marine fish, frogs, toads, lizards and snakes. The egret's diet is generally composed of 75% fish and 25% crustaceans. This egret has the widest range of foraging behaviors when compared to other herons. Food capturing is performed by pecking, walking slowly or quickly, running, hopping, hovering, and "disturb and chase" behaviors. Snowy egrets primarily feed during the early morning and evening hours. Egrets occasionally engage in group flights to fly to far-away foraging environments. Otherwise, egrets independently fly approximately 3 km from their colonies to foraging sites. However, foraging in larger groups allows for greater success in finding substantial food sources and helps provide protection from predators.

Animal Foods: amphibians; reptiles; fish; insects; mollusks; terrestrial worms

Primary Diet: carnivore (Piscivore )

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Comments: Eats small fishes, frogs, lizards, snakes, crustaceans, worms, snails, and insects; forages actively in shallow water, sometimes in fields. (Palmer 1962). May forage in coordinated groups in coastal areas (Costa Rica, Stiles and Skutch 1989).

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Associations

Ecosystem Roles

Egretta thula serves as a biological indicator of ecosystem health and habitat quality. In marshes, bays, and swamp habitats, the absence of egrets may reflect disturbances in the ecosystem, such as pollution, contamination of water, habitat loss, or human disturbance. In some habitats, researchers have sampled eggs and feathers to test levels of environmental contamination. Egrets are positioned at the top of the food chain, thus their decline may also infer a decline of other species, such as fish or insects. Egretta thula is a highly social bird and will not attack humans or disturb other bird species in its habitat.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Predation

Egretta thula has shown an increased preference for island nest sites in urbanized, coastal estuaries. Egrets choose urbanized locations over isolated locations, because isolated locations have more predators. Egrets use flight to escape predation from terrestrial animals and they are known to have innate recognition and avoidance of poisonous snakes.

Known predators include: Procyon lotor (racoon), Bubo virginianus (great-horned owl), Strix varia (barred owl), Corvus brachyrhynchos (American crow), Corvus ossifragus (fish crow), Alligator mississippiensis (American alligator), Pantherophis obsoletus (rat snake) and Buteogallus anthracinus (common black-hawk).

Known Predators:

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Known predators

Creative Commons Attribution 3.0 (CC BY 3.0)

© SPIRE project

Source: SPIRE

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Known prey organisms

Egretta thula preys on:
Actinopterygii
Annelida
Mollusca
Insecta
Amphibia
Reptilia

This list may not be complete but is based on published studies.
Creative Commons Attribution 3.0 (CC BY 3.0)

© SPIRE project

Source: SPIRE

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Population Biology

Number of Occurrences

Note: For many non-migratory species, occurrences are roughly equivalent to populations.

Estimated Number of Occurrences: > 300

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Global Abundance

Unknown

Comments: Inadequate data on numbers at the breeding sites make it difficult to judge abundance.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

General Ecology

Usually occurs in loose groups. Roosts usually communally.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Life History and Behavior

Behavior

Communication and Perception

Egretta thula communicates through sound vocalizations and posture. Young birds produce soft, buzzing calls and mature birds produce high and low-pitched calls. High-pitched calls signify plentiful foraging sites and low-pitched calls signify aggressive situations. Greeting calls are common among egrets. Only males tend to use high sound vocalizations, especially to attract a female mate. Communication sounds are also used to defend the territory surrounding the nest. An egret's upright posture with fully erect feathers marks the onset of an attack on another bird.

Communication Channels: visual ; acoustic

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Cyclicity

Comments: Forages during daylight (Powell 1987).

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Life Cycle

Development

Female egrets generally lay 3-6 eggs and both parents incubate the eggs for approximately 22-25 days. Upon hatching, the young nestling is a grayish color. It has a dark blue area around the eyes and the bill is a pale, pinkish gray. Once the eggs are fully hatched, the adults remove the eggshells from the nest. The hatchlings are covered in white down except for their wings. Pinfeathers appear by the first week. Juvenal feathers emerge on the body and wings by 2 to 3 weeks of age. Leg color varies from yellow to black. The hatchlings have a yellow colored bill tipped with black until five weeks of age, when the entire bill changes to black. Both parents brood their semialtricial young for the first 10 days. After 10 days, only one parent remains in the nest for 50% of the time. This generally lasts until the nestlings become 14 days old. The nestlings leave the nest after two weeks, but some may leave the nest as early as 10 days (Howell 1995; Parsons 2000).

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Life Expectancy

Lifespan/Longevity

Egretta thula has a 71.6% mortality rate during its first year and a 31.4% mortality rate during years 2 to 17. The oldest egret was recorded in Utah and lived 22 years, 10 months. Snowy egrets generally live between 2 and 17 years. Egretta thula has been subject to nematode parasitism, which causes death. Starvation and inclement weather are likely causes of death for young nestlings.

Range lifespan

Status: wild:
22 (high) years.

Typical lifespan

Status: wild:
2 to 17 years.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Lifespan, longevity, and ageing

Maximum longevity: 22.8 years (wild) Observations: One banded bird was 22.8 years of age when recovered (http://bna.birds.cornell.edu/).
Creative Commons Attribution 3.0 (CC BY 3.0)

© Joao Pedro de Magalhaes

Source: AnAge

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Reproduction

Breeding begins in late March or early April when the male egrets perform flight displays and sound vocalizations to attract female mates. The most common courtship display is the "Stretch" display, in which the male pumps his body up and down with his bill pointed towards the sky. The male then produces a call to attract females. The changing foot color from yellow to reddish orange indicates the beginning of breeding behaviors. Breeding adults are also characterized by the distinctive display of long, delicate plumes off their breasts. Once a male finds a mate, the pair performs sexual displays and eventually builds a nest for their offspring.

Mating System: monogamous

The male and female pair-bond is maintained through a series of sexual displays. Breeding begins in March or early April. Female egrets usually build nests in the territories defended by the males. Nests are often built in isolated, estuarine habitats and can be located either on the ground or as high as 30 feet in the trees. The nests are composed of woven twigs and small sticks that female egrets collect from the ground or steal from other nests. Egretta thula may also reuse old nests. These egrets are highly social nesters and build nests close to other egrets or herons. No preliminary rituals are performed prior to copulation, which takes place in the nest. Males stand on the backs of females and cloacal cavities come into contact during copulation to fertilize the eggs. The average duration of contact is 10 seconds. Females lay 3-6 eggs at a time (on average); eggs have a pale, greenish blue color. Incubation lasts 24 days on average and the chicks usually fledge 14 days after hatching. Young reach reproductive maturity after 1 to 2 years.

Breeding season: The breeding season begins in March or early April.

Range eggs per season: 2 to 8.

Average eggs per season: 3-6.

Range time to hatching: 22 to 29 days.

Average time to hatching: 24 days.

Range fledging age: 10 to 25 days.

Average fledging age: 14 days.

Range age at sexual or reproductive maturity (female): 1 (low) years.

Average age at sexual or reproductive maturity (female): 2 years.

Range age at sexual or reproductive maturity (male): 1 (low) years.

Average age at sexual or reproductive maturity (male): 2 years.

Key Reproductive Features: seasonal breeding ; gonochoric/gonochoristic/dioecious (sexes separate); fertilization (Internal )

Average eggs per season: 4.

Both parents incubate the eggs and feed the nestlings by dropping food into the nest. Once the eggs hatch, parents remove the eggshells from the nest. Both parents brood their altricial young continuously until the hatchlings are 10 days old. From 10 to 14 days, only one parent is present in the nest to brood the young. After 10 days, parents are only in the nest 50% of the time. However, when storms occur, the young are brooded continuously. During the first five days after hatching, parents feed their young by regurgitating food onto the nest floor for the hatchlings to eat. Sometimes the parents' bill is placed directly into the hatchlings' mouth and food is regurgitated. The younger nestlings are fed before the older hatchlings. Adults keep the nest clean by dumping waste over the sides of the nest.

Parental Investment: no parental involvement; altricial ; pre-fertilization; pre-hatching/birth (Protecting: Male, Female); pre-weaning/fledging (Provisioning: Male, Female, Protecting: Male, Female)

  • Parsons, K., T. Master. 2000. Snowy Egret. The Birds of North America, 489: 1-23.
  • Robbins, C. 1966. A Guide to Field Identification Birds of North America. New York: Western Publishing Company.
  • Bowles, M. 1991. "Snowy Egret" (On-line). Accessed 12/09/03 at http://www.inhs.uiuc.edu/chf/pub/ifwis/birds/snowy-egret.html.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Eggs are laid usually April to May or June in north; nests in Trinidad May-October, May-August in Costa Rica. Clutch size usually is 4-5 in north, 2-4 in south. Incubation lasts 18 days or longer, by both sexes. Young leave nest at 20-25 days. May first breed at one year. Often nests in large colonies.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Barcode data: Egretta thula

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There are 5 barcode sequences available from BOLD and GenBank.  Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.  See the BOLD taxonomy browser for more complete information about this specimen and other sequences.

TCTATACCTAATCTTCGGAGCATGGGCCGGTATAATTGGAACCGCCCTCAGTCTCCTTATCCGAGCTGAACTTGGCCAGCCAGGAACGCTCCTAGGAGACGACCAGATCTATAATGTGATCGTCACCGCTCATGCCTTCGTAATAATCTTCTTCATAGTTATACCAATCATAATTGGGGGATTCGGAAACTGACTAGTACCACTCATAATTGGTGCCCCCGACATAGCATTCCCACGCATAAACAACATAAGTTTCTGACTCCTTCCACCATCATTTATACTCCTACTAGCCTCATCCACAGTCGAAGCAGGAGCAGGTACGGGCTGAACAGTCTACCCACCCTTAGCTGGCAACCTAGCCCATGCCGGAGCCTCAGTTGACCTAGCCATCTTCTCCCTCCACTTAGCAGGGGTGTCTTCCATCCTAGGAGCAATCAACTTCATTACAACCGCCATCAACATAAAACCCCCAACCCTATCACAATACCAAACTCCCCTATTTGTATGATCCGTCCTAATTACCGCCGTTCTACTTCTACTTTCACTCCCAGTTCTCGCTGCAGGTATTACAATACTACTAACTGATCGAAACCTAAACACCACATTCTTTGACCCCGCTGGAGGTGGCGACCCAGTCCTCTATCAACACCTATTCTGATTCTTCGGCCACCCAGAAGTCTATATTCTAATCCTA
-- end --

Download FASTA File
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Statistics of barcoding coverage: Egretta thula

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 7
Specimens with Barcodes: 7
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Conservation

Conservation Status

IUCN Red List Assessment


Red List Category
LC
Least Concern

Red List Criteria

Version
3.1

Year Assessed
2009

Assessor/s
BirdLife International

Reviewer/s
Bird, J., Butchart, S.

Contributor/s

Justification
This species has an extremely large range, and hence does not approach the thresholds for Vulnerable under the range size criterion (Extent of Occurrence <20,000 km2 combined with a declining or fluctuating range size, habitat extent/quality, or population size and a small number of locations or severe fragmentation). The population trend appears to be increasing, and hence the species does not approach the thresholds for Vulnerable under the population trend criterion (>30% decline over ten years or three generations). The population size is very large, and hence does not approach the thresholds for Vulnerable under the population size criterion (<10,000 mature individuals with a continuing decline estimated to be >10% in ten years or three generations, or with a specified population structure). For these reasons the species is evaluated as Least Concern.

History
  • 2008
    Least Concern
  • 2004
    Least Concern
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Populations appear to be declining along the Atlantic coast due to pollution and competition with other bird species. Egretta thula is at risk because of chemical contamination and the decline of wetland environments. Snowy egrets depend on wetland areas for food. Eggs in agricultural areas are contaminated by pesticides, which cause death. Egrets have also died from consumption of styrofoam, plastics, and lead found in the environment. Oil spills have also caused mortality. Egretta thula has been protected in North America since 1916 under the Migratory Bird Treaty Act. The Migratory Bird Treaty Act prohibited the hunting of egrets for their plumes, thus allowing them to return to their previous levels of abundance.

US Migratory Bird Act: protected

US Federal List: no special status

CITES: appendix iii

State of Michigan List: no special status

IUCN Red List of Threatened Species: least concern

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

National NatureServe Conservation Status

Canada

Rounded National Status Rank: N1B - Critically Imperiled

United States

Rounded National Status Rank: N5B,N5N : N5B: Secure - Breeding, N5N: Secure - Nonbreeding

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

NatureServe Conservation Status

Rounded Global Status Rank: G5 - Secure

Reasons: Very large range (U.S. to southern South America), relatively secure on a global level; threatened in some areas by loss/degradation of wetland habitat.

Other Considerations: Colonial nesting behavior increases risk.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Threats

Degree of Threat: B : Moderately threatened throughout its range, communities provide natural resources that when exploited alter the composition and structure of the community over the long-term, but are apparently recoverable

Comments: Threats include clearing of flood plain forests, loss and degradation of wetlands. Reduced reproductive success in Idaho was attributed to DDE residues accumulated in the nonbreeding season in Mexico (Findholt 1984).

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Management

Global Protection: Unknown whether any occurrences are appropriately protected and managed

Needs: Protect breeding sites and foraging areas.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Relevance to Humans and Ecosystems

Benefits

Economic Importance for Humans: Negative

There are no known adverse affects of snowy egrets on humans.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Economic Importance for Humans: Positive

In the United States from 1880 to 1910, adult egrets were shot by plume hunters. Egretta thula was hunted for its delicate back plumes that were used to decorate women's hats and clothing. In 1886, plumes were valued at $32 per ounce, which was twice the price of gold at the time. In 1910, most hunting ceased due to citizens' requests to stop the slaughter of egrets. However, hunting still continued in Central and South America due to the European demand for plumes.

Positive Impacts: body parts are source of valuable material

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Wikipedia

Snowy Egret

The Snowy Egret (Egretta thula) is a small white heron. It is the American counterpart to the very similar Old World Little Egret, which has established a foothold in the Bahamas.

In flight

Adults are typically 61 centimetres (24 in) long and weigh 375 grams (0.83 lb) They have a slim black bill and long black legs with yellow feet. The area of the upper bill, in front of the eyes, is yellow but turns red during the breeding season, when the adults also gain recurved plumes on the back, making for a "shaggy" effect. The juvenile looks similar to the adult, but the base of the bill is paler, and a green or yellow line runs down the back of the legs.

Plumage displayed

Their breeding habitat is large inland and coastal wetlands from the lower Great Lakes and southwestern United States to South America. The breeding range in eastern North America extends along the Atlantic and Gulf Coasts from Maine to Texas, and inland along major rivers and lakes. They nest in colonies, often with other waders, usually on platforms of sticks in trees or shrubs. Their flat, shallow nests are made of sticks and lined with fine twigs and rushes. Three to four greenish-blue, oval eggs are incubated by both adults. The young leave the nest in 20 to 25 days and hop about on branches near the nest before finally departing.

In warmer locations, some Snowy Egret are permanent residents; northern populations migrate to Central America and the West Indies. They may wander north after the breeding season, very rarely venturing to western Europe—the first bird sighted in Britain wintered in Scotland from 2001–2002.

The birds eat fish, crustaceans, insects and small reptiles. They stalk prey in shallow water, often running or shuffling their feet, flushing prey into view, as well "dip-fishing" by flying with their feet just over the water. Snowy Egrets may also stand still and wait to ambush prey, or hunt for insects stirred up by domestic animals in open fields.

At one time, the beautiful plumes of the Snowy Egret were in great demand by market hunters as decorations for women's hats. This reduced the population of the species to dangerously low levels.[citation needed]

Now protected in the USA by law, under the Migratory Bird Treaty Act, this bird's population has rebounded.

References

Creative Commons Attribution Share Alike 3.0 (CC BY-SA 3.0)

 

Source: Wikipedia

Unreviewed

Article rating from 0 people

Average rating: 2.5 of 5

Names and Taxonomy

Taxonomy

Comments: May constitute a superspecies with E. GARZETTA, E. GULARIS, and Dimorpha (AOU 1998). Frequently placed in genus LEUCOPHOYX (AOU 1983).

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!