Articles on this page are available in 1 other language: Spanish (7) (learn more)

Overview

Brief Summary

Butorides virescens

Smaller and thinner than the American Bittern (Botaurus lentiginosus), the Green Heron is named for its back and wings, which are a dull greenish color in good light but may appear much darker when this heron is hidden well in vegetation. The Green Heron may also be identified by its dark brown neck, white throat, black bill, and black crest. Males and females are similar to one another in all seasons. The Green Heron is found widely across North and South America. In North America, this species breeds across the eastern United States and southern Canada, as well as on the Pacific coast of the U.S.In winter, Green Herons withdraw from the interior and from northern parts of their breeding range, and may be found along the coasts south from California and South Carolina as well as in Mexico and Central America. Coastal populations in the southern U.S.are non-migratory, as are most populations in the tropics. Green Herons breed in a variety of wetland habitats, both freshwater and saltwater, with tall vegetation for cover. In winter, Green Herons utilize similar types of habitats as in summer. Green Herons breeding or wintering in tropical environments also inhabit mangrove habitats. This species primarily eats small fish and amphibians. Due to the Green Heron’s small size and shy nature, individuals standing still in tall vegetation are often difficult to observe. Green Herons are easier to see while walking along the edge of the water, plunging their bills into the water to catch prey, or when flying away from the observer upon being spooked. This species is primarily active during the day, but may also hunt at night to avoid being spotted by its prey.

Threat Status: Least concern

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Unknown

Supplier: DC Birds

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Distribution

Geographic Range

Green herons have a wide range in North America, but are generally found near wetlands. They occur as far north as southern Canada and as far south as northern South America. They are found throughout the eastern United States as far west as North Dakota and the Great Plains states, although some occur on the west coast. During the breeding season they are found mainly in the eastern United States, with some populations in the Pacific Northwest as well. Non-breeding individuals are found in Mexico and Central America, Texas, southern New Mexico and Arizona, and the Caribbean islands. Some populations migrate and others are sedentary (they stay in one place throughout the year). Sedentary populations occur along the east and west coasts of the United States and Central America. Most populations in North America, however, are migratory. After breeding they disperse southwards, in mid-September. The spring, northwards migration occurs from March to April, an earlier arrival than most other herons.

Biogeographic Regions: nearctic (Native ); oceanic islands (Native )

  • Davis, W., J. Kushlan. 1994. The Green Heron. The Birds of North America.
  • Hancock, J., J. Kushlan. 1984. The Herons Handbook. New York City, NY: Harper and Row Publishers.
  • Hancock, J. 1999. Herons and Egrets of the World. London, UK: Academic Press.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Geographic Range

Green herons have a wide range in North America, but are generally found near wetlands. They occur as far north as southern Canada and as far south as northern South America. They are found throughout the eastern United States as far west as North Dakota and the Great Plains states, although some sedentary populations occur on the west coast. During the breeding season they are found primarily in the eastern United States, with some populations in the Pacific Northwest as well. Non-breeding individuals are found in Mexico and Central America, Texas, southern New Mexico and Arizona, and the Caribbean islands. Small vagrant populations winter in Hawaii and the United Kingdom. Some populations migrate and others are sedentary populations. Sedentary populations occur along the east and west coasts of the United States and Central America. Most populations in North America, however, are migratory. After breeding they disperse southwards, in mid-September. Spring migration occurs from March to April, an earlier arrival than most other herons.  (Davis and Kushlan, 1994; Hancock and Kushlan,1984)

Biogeographic Regions: nearctic (Native ); oceanic islands (Native )

  • Davis, W., J. Kushlan. 1994. The Green Heron. The Birds of North America.
  • Hancock, J., J. Kushlan. 1984. The Herons Handbook. New York City, NY: Harper and Row Publishers.
  • Hancock, J. 1999. Herons and Egrets of the World. London, UK: Academic Press.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

occurs (regularly, as a native taxon) in multiple nations

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

National Distribution

Canada

Origin: Native

Regularity: Regularly occurring

Currently: Present

Confidence: Confident

Type of Residency: Breeding

United States

Origin: Native

Regularity: Regularly occurring

Currently: Present

Confidence: Confident

Type of Residency: Year-round

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Global Range: (>2,500,000 square km (greater than 1,000,000 square miles)) BREEDS: southwestern British Columbia, southern Utah, South Dakota, Wisconsin, Michigan, southern Quebec, and New Brunswick south through the eastern U.S., West Indies and Middle America to eastern Panama, islands off the northern coast of Venezuela, and Tobago (AOU 1983, 1993). WINTERS: western Washington (rarely), coastal and southeastern California, southern Arizona, southern Texas, southern Louisiana, northern Florida, and South Carolina south throughout breeding range to northern Colombia and northern Venezuela (AOU 1983, 1993). In the U.S., the highest winter densities occur in Florida and in the San Joaquin Valley of California, especially between Fresno and Bakersfield (Root 1988). Wanders outside usual range (AOU 1983). Rare visitor to Hawaii.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Physical Description

Morphology

Physical Description

Green herons are small and stocky, with legs that are relatively short, compared to other herons. Body length ranges from 41 to 46 cm. Adults have a glossy greenish-black cap and back, wings that are black grading into green and/or blue on the edges, and underparts that are gray. The bill is dark with a long, sharp point and the legs are orange. Females tend to be smaller, with duller and lighter plumage than that seen in males, particularly in the breeding season.

The colors of young herons are different. The neck and chest are striped with white and shades of brown. The back is also brown with white and beige spots. The color patterns of both young and adult birds makes them difficult to see in dense vegetation. (Hancock and Kushlan, 1984; Davis and Kushlan, 1994)

Range length: 41 to 46 cm.

Other Physical Features: endothermic ; homoiothermic; bilateral symmetry

Sexual Dimorphism: male larger; male more colorful

Average mass: 175 g.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Physical Description

Green herons are small and stocky, with legs that are relatively short, compared to other herons. Body length ranges from 41 to 46 cm. Adults have a glossy greenish-black cap and back, wings that are black grading into green and/or blue on the edges, and underparts that are gray. The bill is dark with a long, sharp point and the legs are orange. Female adults tend to be smaller, with duller and lighter plumage than that seen in males, particularly in the breeding season.

Coloration of immature herons is different. The neck and chest are striped with white and shades of brown. The back is also brown with white and beige spots. The coloration of immature and adult birds is quite cryptic in dense vegetation. (Hancock and Kushlan, 1984; Davis and Kushlan, 1994)

Range length: 41 to 46 cm.

Other Physical Features: endothermic ; homoiothermic; bilateral symmetry

Sexual Dimorphism: male larger; male more colorful

Average mass: 175 g.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Size

Length: 46 cm

Weight: 212 grams

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Type Information

Type for Butorides striatus virescens
Catalog Number: USNM 206342
Collection: Smithsonian Institution, National Museum of Natural History, Department of Vertebrate Zoology, Division of Birds
Sex/Stage: Male; Adult
Preparation: Skin: Whole
Collector(s): E. Goldman
Year Collected: 1911
Locality: Rio Indio, Near Gatun, Canal Zone, Colon, Panama, North America
  • Type: Oberholser. August 29, 1912. Proc. U.S. Nat. Mus. 42: 549.
Creative Commons Attribution 3.0 (CC BY 3.0)

© Smithsonian Institution, National Museum of Natural History, Department of Vertebrate Zoology, Division of Birds

Source: National Museum of Natural History Image Collection

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Type for Butorides striatus virescens
Catalog Number: USNM 115883
Collection: Smithsonian Institution, National Museum of Natural History, Department of Vertebrate Zoology, Division of Birds
Sex/Stage: Male; Adult
Preparation: Skin: Whole
Collector(s): H. Parmenter
Year Collected: 1888
Locality: Port Castries, Castries, St. Lucia, North America
  • Type: Oberholser. August 29, 1912. Proc. U.S. Nat. Mus. 42: 561.
Creative Commons Attribution 3.0 (CC BY 3.0)

© Smithsonian Institution, National Museum of Natural History, Department of Vertebrate Zoology, Division of Birds

Source: National Museum of Natural History Image Collection

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Type for Butorides striatus virescens
Catalog Number: USNM 200442
Collection: Smithsonian Institution, National Museum of Natural History, Department of Vertebrate Zoology, Division of Birds
Sex/Stage: Male; Adult
Preparation: Skin: Whole
Collector(s): W. Brown
Year Collected: 1904
Locality: San Miguel Island, Archipielago De Las Perlas, Panama, North America
  • Type: Oberholser. August 29, 1912. Proc. U.S. Nat. Mus. 42: 553.
Creative Commons Attribution 3.0 (CC BY 3.0)

© Smithsonian Institution, National Museum of Natural History, Department of Vertebrate Zoology, Division of Birds

Source: National Museum of Natural History Image Collection

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Type for Butorides striatus virescens
Catalog Number: USNM 80921
Collection: Smithsonian Institution, National Museum of Natural History, Department of Vertebrate Zoology, Division of Birds
Sex/Stage: Male;
Preparation: Skin: Whole
Collector(s): F. Ober
Locality: St. Kitts, St. Kitts and Nevis, North America
  • Type: Oberholser. August 29, 1912. Proc. U.S. Nat. Mus. 42: 561.
Creative Commons Attribution 3.0 (CC BY 3.0)

© Smithsonian Institution, National Museum of Natural History, Department of Vertebrate Zoology, Division of Birds

Source: National Museum of Natural History Image Collection

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Type for Butorides striatus virescens
Catalog Number: USNM 74147
Collection: Smithsonian Institution, National Museum of Natural History, Department of Vertebrate Zoology, Division of Birds
Sex/Stage: Male; Adult
Preparation: Skin: Whole
Collector(s): F. Ober
Year Collected: 1878
Locality: Grenada, North America
  • Type: Oberholser. August 29, 1912. Proc. U.S. Nat. Mus. 42: 568.
Creative Commons Attribution 3.0 (CC BY 3.0)

© Smithsonian Institution, National Museum of Natural History, Department of Vertebrate Zoology, Division of Birds

Source: National Museum of Natural History Image Collection

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Type for Butorides striatus virescens
Catalog Number: USNM 111281
Collection: Smithsonian Institution, National Museum of Natural History, Department of Vertebrate Zoology, Division of Birds
Sex/Stage: unknown; Adult
Preparation: Skin: Whole
Collector(s): C. Townsend
Year Collected: 1887
Locality: Swan Island, = Isla Grande, Isla Grande, Swan Islands, North America
  • Type: Ridgway. August 6, 1888. Proc. U.S. Nat. Mus. 10: 577.
Creative Commons Attribution 3.0 (CC BY 3.0)

© Smithsonian Institution, National Museum of Natural History, Department of Vertebrate Zoology, Division of Birds

Source: National Museum of Natural History Image Collection

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Type for Butorides striatus virescens
Catalog Number: USNM 151366
Collection: Smithsonian Institution, National Museum of Natural History, Department of Vertebrate Zoology, Division of Birds
Sex/Stage: Female; Adult
Preparation: Skin: Whole
Collector(s): C. Kern
Locality: Managua, Nicaragua, North America
  • Type: Oberholser. August 29, 1912. Proc. U.S. Nat. Mus. 42: 548.
Creative Commons Attribution 3.0 (CC BY 3.0)

© Smithsonian Institution, National Museum of Natural History, Department of Vertebrate Zoology, Division of Birds

Source: National Museum of Natural History Image Collection

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Type for Butorides striatus virescens
Catalog Number: USNM 177847
Collection: Smithsonian Institution, National Museum of Natural History, Department of Vertebrate Zoology, Division of Birds
Sex/Stage: Male; Adult
Preparation: Skin: Whole
Collector(s): W. Palmer
Year Collected: 1902
Locality: Palmarito, Oriente, Cuba, North America
  • Type: Oberholser. August 29, 1912. Proc. U.S. Nat. Mus. 42: 557.
Creative Commons Attribution 3.0 (CC BY 3.0)

© Smithsonian Institution, National Museum of Natural History, Department of Vertebrate Zoology, Division of Birds

Source: National Museum of Natural History Image Collection

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Ecology

Habitat

Green herons live along forested water margins, they are generally restricted to areas with wetlands. They are found in both salt and fresh water habitats. Favored habitats are mangrove-lined shores and estuaries, and dense, woody vegetation fringing ponds, rivers, and lakes

Habitat Regions: temperate ; tropical ; terrestrial

Aquatic Biomes: lakes and ponds; rivers and streams; coastal

Wetlands: marsh

Other Habitat Features: riparian ; estuarine

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Habitat and Ecology

Systems
  • Terrestrial
  • Freshwater
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Green herons live along forested water margins. Their general distribution is limited by the availability of wetlands. They frequent both salt and fresh water, showing great flexibility in habitat choice. Favored habitats are mangrove-lined shores and estuaries, and dense, woody vegetation fringing ponds, rivers and lakes (Hancock and Kushlan, 1984).

Habitat Regions: temperate ; tropical ; terrestrial

Aquatic Biomes: lakes and ponds; rivers and streams; coastal

Wetlands: marsh

Other Habitat Features: riparian ; estuarine

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Depth range based on 1 specimen in 1 taxon.

Environmental ranges
  Depth range (m): 0 - 0
 
Note: this information has not been validated. Check this *note*. Your feedback is most welcome.
Public Domain

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Comments: Swamps, mangroves, marshes, and margins of ponds, rivers, lakes, and lagoons. Eggs are laid in platform nest in tree, thicket, or bush over water or sometimes in dry woodland or orchard; nests in both freshwater and brackish situations.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Migration

Non-Migrant: Yes. At least some populations of this species do not make significant seasonal migrations. Juvenile dispersal is not considered a migration.

Locally Migrant: Yes. At least some populations of this species make local extended movements (generally less than 200 km) at particular times of the year (e.g., to breeding or wintering grounds, to hibernation sites).

Locally Migrant: Yes. At least some populations of this species make annual migrations of over 200 km.

Northern populations are migratory; move north mostly in April-May, south August-November. In the western U.S., not all birds migrate. Some birds in the southern U.S. probably are sedentary or nearly so. In the north, apparently migrates by day. In Costa Rica, migrates mostly along the Caribbean coast, September-October and April-May (Stiles and Skutch 1989).

May nest a kilometer away from a foraging area.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Trophic Strategy

Food Habits

Green herons are carnivorous, mainly eating fish and invertebrates. They eat almost anything that they can find and capture. Their invertebrate diet includes: Hirudinea, Oligochaeta, Anisoptera, Anisoptera, Coleoptera, Orthoptera, and Malacostraca. Some of the many fish eaten are: Cyprinidae, Centrarchidae, Ictaluridae, Percidae, eels, and, in urban areas, Carassius auratus. Other vertebrates eaten are Rodentia, Squamata, Anura, Amphibia, and Squamata.

The heavy bill of a green heron enables them to capture large prey. Feeding can take place at any time, day or night. Typically, prey is captured with a darting stroke of the head and neck, lunging the body towards the victim and either grabbing or impaling the prey. The most common feeding technique is to stand in a crouched position with neck and head retracted. Standing often alternates with slow walking in a crouched posture in the water or bordering vegetation. Herons use their feet to stir up animals in the water, making them move and then capturing them. They may also dive from perches head first into deep water, although this isn't a very efficient method. Green herons do best catching prey in shallow water (up to 10 cm deep).

Green herons are one of the few tool-using birds. They use a variety of baits and lures, such as crusts of bread, mayflies, and feathers. They then put the bait on the water surface and wait for prey to attack the bait. They stand motionless near the bait until a small fish or other animal approaches and then grab them.

Animal Foods: mammals; amphibians; reptiles; fish; insects; terrestrial non-insect arthropods; terrestrial worms; aquatic or marine worms

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Food Habits

Green herons are carnivorous, mainly eating fish and invertebrates. They are opportunistic foragers with a broad prey base, depending on the availability of species present. They exploit superabundant food resources, such as breeding frogs. Their invertebrate diet includes: leeches, earthworms, dragonflies, damselflies, waterbugs, grasshoppers, and crayfish. Some of the many fish eaten are: minnows, sunfish, catfish, perch, eels, and, in urban areas, goldfish. Other vertebrates eaten are rodents, lizards, frogs, tadpoles, and snakes.

Their heavy bill enables them to capture large prey. Feeding can take place at any time, day or night. Typically, prey is captured with a darting stroke of the head and neck, lunging the body towards the victim and either grabbing or impaling the prey.

Among North American diurnal herons, green herons exhibit the fewest kinds of feeding behaviors. They are known to use 15 of the 36 heron feeding behaviors. The most common feeding technique is to stand in a crouched position, horizontal to the water surface, with neck and head retracted. They stand still for long periods of time before changing sites. Standing is often interspersed with slow walking in a crouched posture in the water or bordering vegetation. Herons use their feet to cause potential prey to move and then capture them. They may also dive from perches head first into deep water, becoming submerged, although this isn't a very efficient method. The greatest capture success is in shallowest water (0-10 cm) and the poorest success is in deeper water (20-30 cm).

Green herons are one of the few tool-using birds. They use a variety of baits and lures, such as crusts of bread, mayflies, and feathers. They then put the bait on the water surface and wait for prey to attack the bait. They stand motionless near the bait until a small fish or other animal approaches and then grab the prey. Success rates have been highest when live bait was used versus inanimate or dead bait. Juvenile herons are not as adept at baiting prey (Davis and Kushlan, 1994; Hancock and Kushlan, 1984; Hancock, 1999).

Animal Foods: mammals; amphibians; reptiles; fish; insects; terrestrial non-insect arthropods; terrestrial worms; aquatic or marine worms

Primary Diet: carnivore (Piscivore , Insectivore , Eats non-insect arthropods)

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Comments: Eats fishes, crustaceans, insects, and other small animals; usually forages in shallow water (Palmer 1962). May perch motionless on snag low over water while waiting for prey to approach (Raffaele 1983).

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Associations

Ecosystem Roles

Green herons are important predators of fish and invertebrates in the aquatic ecosystems where they live.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Predation

Squamata, Corvus brachyrhynchos, and Quiscalus quiscula are known to eat green heron eggs. Procyon lotor eat nestlings. Adult birds may be preyed on by large Falconiformes. Green herons remain vigilant to protect themselves from predators. They also utter warning calls when predators approach.

Known Predators:

  • raccoons (Procyon_lotor)
  • diurnal birds of prey (Falconiformes)
  • snakes (Serpentes)
  • American crows (Corvus_brachyrhynchos)
  • common grackles (Quiscalus_quiscula)

Anti-predator Adaptations: cryptic

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Ecosystem Roles

Green herons are important predators of fish and invertebrates in the aquatic ecosystems where they live.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Predation

Snakes, crows, and common grackles are known to eat green heron eggs. Raccoons eat nestlings. Adult birds may be preyed on by large birds of prey. Green herons remain vigilant to protect themselves from predators. They also utter warning calls when predators approach.

Known Predators:

Anti-predator Adaptations: cryptic

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Known predators

Butorides virescens is prey of:
Squamata
Quiscalus quiscula
Corvus brachyrhynchos
Procyon lotor
Falconiformes

This list may not be complete but is based on published studies.
Creative Commons Attribution 3.0 (CC BY 3.0)

© SPIRE project

Source: SPIRE

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Known prey organisms

Butorides virescens preys on:
Istiophoridae
Cyprinidae
non-insect arthropods
Actinopterygii
aquatic or marine worms
Annelida
Arthropoda
Insecta
Amphibia
Reptilia
Mammalia
Carassius auratus

Based on studies in:
USA: New York, Long Island (Marine)

This list may not be complete but is based on published studies.
  • G. M. Woodwell, Toxic substances and ecological cycles, Sci. Am. 216(3):24-31, from pp. 26-27 (March 1967).
  • Myers, P., R. Espinosa, C. S. Parr, T. Jones, G. S. Hammond, and T. A. Dewey. 2006. The Animal Diversity Web (online). Accessed February 16, 2011 at http://animaldiversity.org. http://www.animaldiversity.org
Creative Commons Attribution 3.0 (CC BY 3.0)

© SPIRE project

Source: SPIRE

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

General Ecology

Generally solitary or in pairs.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Life History and Behavior

Behavior

Communication and Perception

Green herons use their keen vision, hearing, and sense of touch to perceive their environment. They have especially acute vision that helps them to capture prey. Green herons have an elaborate set of calls and body postures that they use for communicating with other green herons. Examples are their elaborate courtship displays, warning calls when a predator is detected, and territorial displays.

Communication Channels: visual ; acoustic

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Communication and Perception

Green herons use their keen vision, hearing, and sense of touch to perceive their environment. They have especially acute vision that helps them to capture prey. Green herons have an elaborate set of calls and body postures that they use for communicating with other green herons. Examples are their elaborate courtship displays, warning calls when a predator is detected, and territorial displays.

Communication Channels: visual ; acoustic

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Life Expectancy

Lifespan/Longevity

The oldest know wild green heron was a banded bird that was captured when it was almost 8 years old. There is very little information on lifespan in these birds.

Range lifespan

Status: wild:
11.6 (high) years.

Average lifespan

Status: wild:
95 months.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Lifespan/Longevity

The oldest know wild green heron was a banded bird that was captured when it was almost 8 years old. There is very little information on lifespan in these birds.

Range lifespan

Status: wild:
11.6 (high) years.

Average lifespan

Status: wild:
95 months.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Lifespan, longevity, and ageing

Maximum longevity: 11.6 years (wild)
Creative Commons Attribution 3.0 (CC BY 3.0)

© Joao Pedro de Magalhaes

Source: AnAge

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Reproduction

Green herons form mated pairs each breeding season. Courtship displays are elaborate and consist of a specific series of displays. They begin with Flying Around displays resembling natural flight, but oriented to breeding sites with skow calls. This is followed by Pursuit Flight, Circle Flight and Forward displays, where a rasping 'raah-raah' call exposes the red mouth-lining. Next come Crooked-Neck Flight displays, where the neck is partially flexed, legs are dangled, and wingbeats make a noticeable sound. Much like the Crooked-Neck Display, the Flap Flight Display is more intense. Here, the male lurches through the air with exaggerated flapping producing a whoom-whoom-whoom sound in a crooked-neck posture with crest, neck, and shoulder feathers erect and often giving a roo-roo call before landing.

Displays that don't involve flying occur also. In the Snap Display, the male perches, then points body, head, and neck down until his bill tip is at or below the level of his feet and then snaps his mouth together, producing a clicking sound while also erecting his feathers. The Stretch Display involves the male pointing his bill straight up, stretching his neck, and then bending it backwards until the head almost touches its back with the shoulder plumes erect and fanned. In this posture, he sways his neck and head from side to side with crest, breast, and flank feathers sleeked back, eyes bulging, and iris possibly turning from yellow to deep orange while emitting an aaroo-aaroo sound.

Males perform this Stretch Display before a female is allowed to enter the eventual nest area. The female then performs a less intense Stretch silently after the male, which confirms the pair-bond. At this time, the male stops Flight and Snap displays. The pair then nibbles each other's feathers and snap their bills.

Mating System: monogamous

Green herons lay 2 to 4 eggs in a nest at two-day intervals. The eggs are incubated for 19 to 21 days, the young fledge (leave the nest) at 16 to 17 days old and become independent at 30 to 35 days old.

Nests are built in vegetation near water, from ground level up to 20 meters high. The preferred nest spot is a branch in a tree. Nesting pairs normally nest alone, but sometimes nest in small colonies.

Breeding interval: Green herons breed once yearly.

Breeding season: The time of breeding varies considerably geographically, generally breeding begins anytime from March through July.

Average eggs per season: 2-4.

Range time to hatching: 19 to 21 days.

Range time to independence: 30 to 35 days.

Average age at sexual or reproductive maturity (female): 1 years.

Average age at sexual or reproductive maturity (male): 1 years.

Key Reproductive Features: gonochoric/gonochoristic/dioecious (sexes separate); fertilization (Internal )

Average eggs per season: 4.

Both parents feed and brood their young, though less often as the nestlings grow.

Parental Investment: altricial ; male parental care ; female parental care

  • Davis, W., J. Kushlan. 1994. The Green Heron. The Birds of North America.
  • Hancock, J., J. Kushlan. 1984. The Herons Handbook. New York City, NY: Harper and Row Publishers.
  • Hancock, J. 1999. Herons and Egrets of the World. London, UK: Academic Press.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Green herons are seasonally monogamous. Courtship displays are stereotyped. They begin with Flying Around displays resembling natural flight, but oriented to breeding sites with skow calls. From here, courtship becomes aggressive. Pursuit Flight, Circle Flight and Forward displays are used, where a rasping 'raah-raah' call exposes the red mouth-lining. Crooked-Neck Flight displays are more aggressive, where the neck is partially flexed, legs are dangled, and wingbeats are audible. Much like the Crooked-Neck Display, the Flap Flight Display shows the greatest intensity of flight displays. Here, the male lurches through the air with exaggerated flapping producing a whoom-whoom-whoom sound in a crooked-neck posture with crest, neck, and scapular feathers erect and often giving a roo-roo call before landing.

Nonaerial displays are interspersed with display flights. In the Snap Display, the male perches, then points body, head and neck down until bill tip is at or below the level of his feet and then snaps his mandibles together, producing a click while also erecting his feathers. The Stretch Display involves the male pointing his bill straight up, stretching his neck, and then bending it backwards until the head almost touches its back with interscapular plumes erect and fanned. In this posture, he sways his neck and head from side to side with crest, breast, and flank feathers sleeked back, eyes bulging, and iris possibly turning from yellow to deep orange while emitting an aaroo-aaroo sound.

Males perform this Stretch Display before a female is allowed to enter the eventual nest area. The female then performs a less intense Stretch silently after the male, which confirms the pair-bond. At this time, the male stops Flight and Snap displays. The pair then engages in mutual bill-snapping and feather nibbling, though those behaviors are reduced soon thereafter. Copulation occurs on the nest platform during the nest-building stage. It lasts about ten seconds with several hours between copulations. (Davis and Kushlan, 1994; Hancock and Kushlan, 1984)

Mating System: monogamous

After the last egg is laid, copulations cease and incubation persists for 19-21 days. A normal clutch is 2 to 4 eggs, laid in 2-day intervals. Fledging occurs when chicks are 16 to 17 days old, and independence is gained between 30 and 35 days.

Nesting takes place in forest and swamp patches, over water or in plants near water. Nesting pairs normally nest alone, but loose aggregations of mated pairs can form. Nest building is a cooperative effort, with the male participating more in protection versus actual construction. Nest placement can be from ground level to 20 meters, depending on plant height and thickness; branches in trees are favored. There is no attempt at nest sanitation, though chicks void over the edge of the nest once they're able to walk.

Breeding interval: Green herons breed once yearly.

Breeding season: The time of breeding varies considerably geographically, generally breeding begins anytime from March through July.

Average eggs per season: 2-4.

Range time to hatching: 19 to 21 days.

Range time to independence: 30 to 35 days.

Average age at sexual or reproductive maturity (female): 1 years.

Average age at sexual or reproductive maturity (male): 1 years.

Key Reproductive Features: gonochoric/gonochoristic/dioecious (sexes separate); fertilization (Internal )

Average eggs per season: 4.

Both adults feed and brood chicks, though at less frequent intervals as the chicks become more independent.

Parental Investment: altricial ; male parental care ; female parental care

  • Davis, W., J. Kushlan. 1994. The Green Heron. The Birds of North America.
  • Hancock, J., J. Kushlan. 1984. The Herons Handbook. New York City, NY: Harper and Row Publishers.
  • Hancock, J. 1999. Herons and Egrets of the World. London, UK: Academic Press.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Clutch size usually is 4-5 in north, 2-3 in south. Incubation, by both sexes, lasts 19-21 days. Young fly at 21-23 days, but still fed by parents. Sometimes two broods/year. May breed at 1 year. Usually nests singly.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Barcode data: Butorides virescens

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There are 7 barcode sequences available from BOLD and GenBank.  Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.  See the BOLD taxonomy browser for more complete information about this specimen and other sequences.

CCTGTATCTANTCTTCGGAGCATGAGCTGGTATAATTGGAACCGCCCTAAGCCTACTTATCCGAGCTGAACTTGGTCAACCAGGAACACTCCTAGGGGACGACCAAATCTATAATGTAATCGTTACCGCTCATGCTTTCGTAATAATCTTCTTCATAGTAATGCCTATCATAATCGGAGGATTCGGAAACTGATTAGTCCCTCTTATAATTGGCGCCCCCGACATAGCATTCCCCCGCATGAACAACATAAGTTTCTGACTCTTACCACCATCATTCATACTCCTACTAGCCTCATCTACAGTTGAAGCAGGAGCAGGTACAGGCTGAACCGTCTACCCACCATTAGCCGGTAACCTGGCCCACGCCGGAGCCTCAGTTGACCTAGCTATCTTTTCACTTCACTTAGCAGGTGTATCCTCTATCCTAGGGGCAATTAATTTCATTACAACCGCTATTAACATAAAACCCCCATCCCTATCACAATATCAAACTCCCCTATTTGTATGATCCGTCTTAATCACTGCCGTCTTACTCCTACTCTCACTTCCAGTCCTTGCTGCAGGCATTACAATATTACTAACTGACCGAAACCTAAACACCACATTCTTTGATCCCGCTGGAGGTGGAGACCCAGTCCTCTACCAACACCTCTTCTGATTCTTCGGACACCCAGAAGTCTATATCCTAATCCTT
-- end --

Download FASTA File
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Statistics of barcoding coverage: Butorides virescens

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 6
Specimens with Barcodes: 10
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Conservation

Conservation Status

Green herons are not considered threatened or endangered. They are fairly common in appropriate habitats throughout their range. They are killed by fish hatcheries to prevent them eating young fish, suffer as a result of wetland loss to farming and development, and can accumulate poisons in their tissues from pesticide use and toxic releases into waterways.

IUCN Red List of Threatened Species: least concern

US Migratory Bird Act: protected

US Federal List: no special status

CITES: no special status

State of Michigan List: no special status

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

IUCN Red List Assessment


Red List Category
LC
Least Concern

Red List Criteria

Version
3.1

Year Assessed
2009

Assessor/s
BirdLife International

Reviewer/s
Bird, J., Butchart, S.

Contributor/s

Justification
This species has an extremely large range, and hence does not approach the thresholds for Vulnerable under the range size criterion (Extent of Occurrence <20,000 km2 combined with a declining or fluctuating range size, habitat extent/quality, or population size and a small number of locations or severe fragmentation). The population trend is not known, but the population is not believed to be decreasing sufficiently rapidly to approach the thresholds under the population trend criterion (>30% decline over ten years or three generations). The population size has not been quantified, but it is not believed to approach the thresholds for Vulnerable under the population size criterion (<10,000 mature individuals with a continuing decline estimated to be >10% in ten years or three generations, or with a specified population structure). For these reasons the species is evaluated as Least Concern.

History
  • 2008
    Least Concern
  • 2004
    Least Concern
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Human activities have had their effect on the heron. Historically, green herons were sometimes hunted for food. Fish hatcheries kill green herons to regulate their populations and prevent them eating their young fish. Pesticides have been found to accumulate in heron tissues, but no evidence of general reproductive failure has been observed, despite some localized effects to herons in highly polluted areas. Eggshell thinning has been recorded in comparison with pre-1947 egg samples, but it is not considered lethal. Increased recreational and industrial use of river channels leads to decreased use by green herons. Yet this has not led to decreased use of backwater habitats, for example, ponds. The main concern for the heron has been conservation and management of wetlands as a whole, versus the drainage and development that depletes habitat in which they live. No populations are considered threatened or endangered (Davis and Kushlan, 1994).

US Migratory Bird Act: protected

US Federal List: no special status

CITES: no special status

State of Michigan List: no special status

IUCN Red List of Threatened Species: least concern

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

National NatureServe Conservation Status

Canada

Rounded National Status Rank: N4B - Apparently Secure

United States

Rounded National Status Rank: N5B,N5N : N5B: Secure - Breeding, N5N: Secure - Nonbreeding

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

NatureServe Conservation Status

Rounded Global Status Rank: G5 - Secure

Reasons: Large range (southern Canada to northern South America), common in many areas.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Relevance to Humans and Ecosystems

Benefits

Economic Importance for Humans: Negative

Green herons eat fish that may be important economically, but their impact is very small.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Economic Importance for Humans: Positive

Green herons are enjoyed by birdwatchers.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Economic Importance for Humans: Negative

Economic importance is minimal with negative effects on fishing (Davis and Kushlan, 1994).

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Economic Importance for Humans: Positive

Green herons are enjoyed by birdwatchers.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Wikipedia

Green Heron

The Green Heron (Butorides virescens) is a small heron of North and Central America. It was long considered conspecific with its sister species the Striated Heron (Butorides striata), and together they were called "Green-backed Heron". Birds of the nominate subspecies (no matter which taxonomic arrangement is preferred) are extremely rare vagrants to western Europe; individuals from the Pacific coast of North America may similarly stray as far as Hawaii.[2][3][4]

Contents

Description

Breeding plumage in Florida

The Green Heron is relatively small; adult body length is about 44 cm (17 in). The neck is often pulled in tight against the body. Adults have a glossy, greenish-black cap, a greenish back and wings that are grey-black grading into green or blue, a chestnut neck with a white line down the front, grey underparts and short yellow legs. The bill is dark with a long, sharp point. Female adults tend to be smaller than males, and have duller and lighter plumage, particularly in the breeding season. Juveniles are duller, with the head sides, neck and underparts streaked brown and white, tan-splotched back and wing coverts, and greenish-yellow legs and bill. Hatchlings are covered in down feathers, light grey above, and white on the belly.[2][3][4]

The Green Heron's call is a loud and sudden kyow; it also makes a series of more subdued kuk calls. During courtship, the male gives a raah-rahh call with wide-open bill, makes noisy wingbeats and whoom-whoom-whoom calls in flight, and sometimes calls roo-roo to the female before landing again. While sitting, an aaroo-aaroo courtship call is also given.[3][4]

Taxonomy

As noted above, this species was formerly included in B. striata, which at that time was erroneously known as B. striatus. The Early Pleistocene B. validipes, whose fossil remains were discovered in Florida, might have been the ancestor of the Green Heron as the living species seems to replace the extinct relative in the fossil record.

Subspecies distinction is uncertain at best. The color variation between populations is less pronounced than between birds of the same population. Migratory populations are longer-winged than those resident year round, but this cannot be used to delimit subspecies as it is quite obviously is a consequence of differing habits and can be expected to undergo convergent evolution in unrelated populations of this species that just share the same habits. Thus, thorough molecular phylogenetic studies would be required to resolve the question of subspecies delimitation.

The following subspecies are commonly listed, though the validity of most of them is seriously disputed:[2]

Breeds in the USA west of the Rocky Mountains, south to northern Baja California Peninsula, Mexico. Some resident, most migrate to western Mexico in winter.
Bahamas. Resident.
Southern Baja California Peninsula, Mexico. Resident.
Southernmost USA through Central America to central Panama, Caribbean. Resident.
In February, migrant B. v. virescens and resident birds sometimes separated as B. v. maculata occur at Tarpon Springs, Florida.
Breeds from southeastern Canada to central and southern USA east of the Rocky Mountains. Winters from southernmost USA to northern South America.

Much of the dispute hinges upon the distinctness of the Caribbean and Central American populations, the second taxon in this species to be described. To describe the two most extreme views, some authors assemble the bulk of the mainland population in the nominate subspecies but treat the parapatric populations as distinct subspecies, while others place all resident populations in maculata and all migratory ones in virescens.

Ecology

At Everglades National Park

The habitat of the Green Heron is small wetlands in low-lying areas. The species is most conspicuous during dusk and dawn, and if anything these birds are nocturnal rather than diurnal, preferring to retreat to sheltered areas in daytime. They feed actively during the day, however, if hungry or provisioning young. Shore-living individuals adapt to the rhythm of the tides. They mainly eat small fish, frogs and aquatic arthropods, but may take any invertebrate or vertebrate prey they can catch, including such animals like leeches and mice. Green Herons are intolerant of other birds – including conspecifics – when feeding and are not seen to forage in groups. They typically stand still on shore or in shallow water or perch upon branches and await prey. Sometimes they drop food, insects, or other small objects on the water's surface to attract fish, making them one of the few known tool-using species. This feeding method has led some to title the green and closely related Striated Heron as among the world's most intelligent birds.[5] They are able to hover briefly to catch prey.[2][3][4]

The northern population moves to its breeding ranges during March and April; near the northernmost limit of the Green Heron's range, breeding is well underway by the end of May. The migration to the winter quarters starts in September; by late October, the birds are absent from regions where they do not stay all year. At least the northward migration does not seem to be affected by global warming; birds appear in their breeding ranges at the same time they did 100 years ago.[6][2][4][7]

At Chicago's North Pond in Lincoln Park.

Individuals of non-migratory populations abandon their territories after breeding season to roam about the region. They may or may not return to the previous year's breeding location, depending on whether they found better habitat during these wanderings. In these populations, the breeding season is determined by rainfall and consequent prey availability.[2][3][4]

Nestlings near Isla Damas, Costa Rica.

Green Herons are seasonally monogamous. The pairs form in the breeding range, after an intense courtship display by the males, who select the nesting sites and fly in front of the female noisily and with puffed-up head and neck plumage. They nest in forest and swamp patches, over water or in plants near water. Nests are a platform of sticks, often in shrubs or trees, sometimes on the ground. Locations in trees are preferred, with some nests built up to 20 meters off the ground although heights of several meters are more common. Rarely, large numbers of these birds congregate in heronries for nesting.[2][3][4]

The clutch is usually 2–6 pale green eggs,[3] which are laid in 2-day intervals (though the second egg may be laid up to 6 days later than the first).[8] After the last egg has been laid, both parents incubate for about 19–21 days until hatching, and feed the young birds.[9] The frequency of feedings decreases as the offspring near fledging. The young sometimes start to leave the nest at 16 days of age, but are not fully fledged and able to fend for themselves until 30–35 days old. Sometimes – particularly in the tropical parts of its range – the Green Heron breeds twice a year.[2][3][4]

Tool use

Green herons are one of the few species of animal known to use tools. In particular, they commonly use bread crusts, insects, or other items as bait. The bait is dropped onto the surface of a body of water in order to lure fish. When a fish takes the bait, the green heron will then grab and eat the fish.[3]

Gallery

References

  1. ^ BirdLife International (2012). "Butorides virescens". IUCN Red List of Threatened Species. Version 2012.1. International Union for Conservation of Nature. Retrieved 16 July 2012. 
  2. ^ a b c d e f g h Jutglar, Francesc (1992): 33. Green-backed Heron. In: del Hoyo, Josep; Elliott, Andrew & Sargatal, Jordi (eds.): Handbook of Birds of the World (Volume 1: Ostrich to Ducks): 417, plate 28. Lynx Edicions, Barcelona. ISBN 84-87334-10-5
  3. ^ a b c d e f g h i Cornell Lab of Ornithology. "Green Heron". Retrieved 2010-04-08. 
  4. ^ a b c d e f g h Dewey, T. & Butzbaugh, J. (2001): Animal Diversity Web: Butorides virescens. Retrieved 2008-FEB-12.
  5. ^ Amazing Bird Records. trails.com
  6. ^ Henninger, W.F. (1906). "A preliminary list of the birds of Seneca County, Ohio". Wilson Bulletin 18 (2): 47–60. 
  7. ^ Ohio Ornithological Society (2004): Annotated Ohio state checklist.
  8. ^ Cornell Lab of Ornithology. "Green Heron". Retrieved 2011-05-11. 
  9. ^ Seattle Audubon Society. "Green Heron". Retrieved 2010-04-08. 
Creative Commons Attribution Share Alike 3.0 (CC BY-SA 3.0)

 

Source: Wikipedia

Unreviewed

Article rating from 0 people

Average rating: 2.5 of 5

Names and Taxonomy

Taxonomy

Comments: Monroe and Browning (1992) reanalyzed taxonomy of Butorides and concluded that B. striatus (striated heron) and B. virescens (green heron) were separate species; AOU (1993) adopted this change. Previously, Payne (1974) had lumped striatus and virescens, and North American populations were regarded as green-backed heron, B. striatus.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!