Articles on this page are available in 2 other languages: Chinese (Simplified) (6), Spanish (7) (learn more)

Overview

Brief Summary

The Great Frigatebird (Fregata minor) is a large dispersive seabird in the frigatebird family. Major nesting populations are found in the Pacific (including Galapagos Islands) and Indian Oceans, as well as a population in the South Atlantic.

The Great Frigatebird is a lightly built large seabird up to 105 cm long with predominantly black plumage. The species exhibits sexual dimorphism; the female is larger than the adult male and has a white throat and breast, and the male's scapular feathers have a purple-green sheen. In breeding season, the male is able to distend its striking red gular sac. The species feeds on fish taken in flight from the ocean's surface (mostly flyingfish), and indulges in kleptoparasitismless frequently than other frigatebirds. They feed in pelagic waters within 80 km (50 mi) of their breeding colony or roosting areas.

Creative Commons Attribution Share Alike 3.0 (CC BY-SA 3.0)

© Wikipedia editors and contributors

Supplier: Cyndy Parr

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Distribution

Range Description

Major breeding populations of the Greater Frigatebird are found in tropical waters of the Pacific and Indian Ocean, as well as one population in the South Atlantic (Trinidade and Martim Vaz, Brazil). It is predominately sedentary, with immature and non-breeding individuals dispersing throughout the tropical seas with the exception of the east and central Atlantic.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Geographic Range

Great frigatebirds are found in tropical waters globally. They occur between 25 degrees north and 25 degrees south. Nesting colonies are known from offshore islands throughout the tropical Pacific, western Atlantic, and south Indian oceans. Most of what is known about great frigatebirds is known from nesting colonies and there is little information about their range and movements outside of the breeding season. Males and females may occupy separate ranges outside of the breeding season. Great frigatebirds are considered sedentary, although individuals disperse from nesting areas to broader ranges when not breeding.

Biogeographic Regions: indian ocean (Native ); atlantic ocean (Native ); pacific ocean (Native )

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

occurs (regularly, as a native taxon) in multiple nations

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

National Distribution

United States

Origin: Native

Regularity: Regularly occurring

Currently: Present

Confidence: Confident

Type of Residency: Breeding

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Global Range: (>2,500,000 square km (greater than 1,000,000 square miles)) BREEDS: islands in tropical Pacific, Atlantic (where least numerous), and Indian oceans, including: Hawaii (Kure east to Nihoa, also one breeding record for Moku Manu islet off Oahu); Revillagigedo Islands; Cocos Island off Costa Rica; Galapagos Islands. RANGES AT SEA: mainly near breeding islands (young may roam more widely).

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Physical Description

Morphology

Physical Description

Great frigatebirds have highly specialized for life in flight. They have the highest ratio of wing are to body mass of any bird. They have exceptionally long wings for soaring, long, forked tails for maneuverability in flight, and very small legs and feet. Their legs and feet are so small that they cannot walk on them, only perching between flights. Great frigatebirds are also one of few seabird species that are sexually dimorphic in both size and plumage. Males are smaller than females and are entirely black, with a greenish-purple sheen dorsally. Females are larger, with a black head and black feathers dorsally, but with a white chin and chest that merges into their white belly. Males have a large, red, inflatable gular sac that becomes enlarged during the breeding season and is used in courtship displays. Male gular sacs become smaller and fades in color outside of the breeding season. Immature individuals are similar to females in plumage, but with light rufous feathers on the head and between the grey chin and chest and white belly. Great frigatebirds are distinctive birds, most often seen soaring above the water, where their long, forked tail and long, pointed wings held in a "W" shape make them easy to identify. They have long bills with a strongly hooked tip. They are from 85 to 105 cm in body length, from 205 to 230 cm in wingspan, and from 1 to 1.8 kg mass.

Great frigatebirds are likely to be confused only with other frigatebirds, especially in their immature or juvenile plumages. Incomplete understanding of regional variation in plumage patterns, vocalizations, and soft body parts in widespread species, such as great, lesser, and magnificent frigatebirds may also complicate identifications.

There are 5 recognized subspecies of great frigatebirds. Subspecies vary in body size, plumage, eye ring color, and bill color, but patterns of variation have not been well described. Subspecies are defined geographically and banding studies suggest that there may be little migration of individuals among regions. Subspecies are: F. m. minor in the eastern Indian Ocean and Australia, F. m. aldabra in the western Indian Ocean, F. m. palmerstoni throughout western and central Pacific, F. m. ridgwayi in the eastern Pacific, and F. m. nicolli in the western Atlantic.

Great frigatebirds seem to maintain body temperatures of about 40 degrees Celsius, shivering at lower temperatures. Nestlings are dependent on parents to protect them from the heat of the tropical sun. They use a variety of body postures to help radiate or absorb heat.

Range mass: 1 to 1.8 kg.

Range length: 85 to 105 cm.

Range wingspan: 205 to 230 cm.

Other Physical Features: endothermic ; homoiothermic; bilateral symmetry

Sexual Dimorphism: female larger; sexes colored or patterned differently; male more colorful; ornamentation

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Size

Length: 93 cm

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Diagnostic Description

Description

Length: 86-100 cm. Plumage: Male entirely black. Female black with grey throat, white breast. Immature brown; head and lower neck white spotted or streaked rufous; throat pure white separated from white lower breast by dark broad rusty band. Bare parts: iris blackish; bill slate blue with a scarlet throat patch in male, no throat patch in female; feet and legs reddish brown or black in male, pink or reddish pink in female.
  • Brown, L.H., E.K. Urban & K. Newman (1982). The Birds of Africa, Volume I. Academic Press, London.
Creative Commons Attribution 3.0 (CC BY 3.0)

© WoRMS for SMEBD

Source: World Register of Marine Species

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Ecology

Habitat

Habitat and Ecology

Habitat and Ecology
The Greater Frigatebird breeds on small, remote tropical and sub-tropical islands, in mangroves or bushes and occaisionally on bare ground (del Hoyo et al. 1992). Fish, squid and chicks of other bird species (e.g. Sooty Terns) have all been identified as prey (Weimerskirch et al. 2004). It is frequently observed attempting to steal food from other bird species (kleptoparasitism) (Vickery and Brooke 1994). However, this behaviour represents a minor source of energy (Vickery and Brooke 1994, Weimerskirch et al. 2004), and they are frequently observed foraging at the coast or inland at most places where they breed (Weimerskirch et al. 2004).


Systems
  • Terrestrial
  • Marine
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Great frigatebirds are found over open, tropical ocean waters and near offshore, oceanic nesting islands. Males and females may occupy different ranges outside of the breeding season, which may be influenced by their different wing loading characteristics and the nature of winds over different areas of the ocean. When not breeding, great frigatebirds wander widely to feed on fish and squid in areas with high concentrations of prey, such as at ocean upwellings, divergences, and convergences. Great frigatebirds breed on islands without predators. They nest in trees and shrubs, such as beach naupaka (Scaevola sericea), beach heliotrope (Tournefortia argentea), pisonia (Pisonia grandis), and mangroves (Bruguiera and Rhizophora species). Nests are usually above 0.5 m and may be several kilometers inland on larger islands. Great frigatebirds are superb soaring birds and do not need to come to land frequently to roost. They can soar for long period of time, including overnight.

Habitat Regions: tropical ; saltwater or marine

Aquatic Biomes: pelagic

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Depth range based on 3 specimens in 1 taxon.
Water temperature and chemistry ranges based on 3 samples.

Environmental ranges
  Depth range (m): 0 - 0
  Temperature range (°C): 25.920 - 27.540
  Nitrate (umol/L): 0.050 - 0.276
  Salinity (PPS): 34.984 - 35.924
  Oxygen (ml/l): 4.641 - 4.834
  Phosphate (umol/l): 0.167 - 0.228
  Silicate (umol/l): 1.386 - 3.344

Graphical representation

Temperature range (°C): 25.920 - 27.540

Nitrate (umol/L): 0.050 - 0.276

Salinity (PPS): 34.984 - 35.924

Oxygen (ml/l): 4.641 - 4.834

Phosphate (umol/l): 0.167 - 0.228

Silicate (umol/l): 1.386 - 3.344
 
Note: this information has not been validated. Check this *note*. Your feedback is most welcome.

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Comments: Pelagic. May visit inland ponds to drink (Pratt et al. 1987). Nests in tops of trees or bushes, usually on remote, predator-free islands (Pratt et al. 1987). May nest on ground or on prostrate vegetation in some areas.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Migration

Non-Migrant: No. All populations of this species make significant seasonal migrations.

Locally Migrant: Yes. At least some populations of this species make local extended movements (generally less than 200 km) at particular times of the year (e.g., to breeding or wintering grounds, to hibernation sites).

Locally Migrant: Yes. At least some populations of this species make annual migrations of over 200 km.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Trophic Strategy

Food Habits

Great frigatebirds are best known for their kleptoparasitic habits; they frequently steal food from other sea birds by harassing them until they drop their prey or regurgitate a recent meal. They pursue other birds, especially near nesting colonies, diving at them and grabbing them until they release their food. Great frigatebirds then dive rapidly to catch the released prey or regurgitate before it hits the water. Bird species commonly harassed by great frigatebirds are boobies (Sula), tropicbirds (Phaethon), and petrels (Pterodroma). However, great frigatebirds capture most of their food themselves, by grabbing fish at or just below the water's surface.

Great frigatebirds eat mainly flying fish (Exocoetidae) and squid (Ommastrephidae) found within 15 cm of the ocean surface. Most foraging occurs over deep, ocean waters in areas where upwelling, divergence, or convergence brings nutrient rich water close to the surface. They may also feed over schools of large, predatory fish (Katsuwonus and Euthynnus species ) or dolphins (Stenella, Delphinus, and Steno species) that drive smaller fish to the surface. Great frigatebirds will also feed opportunistically in coastal areas on turtle hatchlings, fish scraps from commercial fishing operations, and on seabird nestlings in breeding colonies, including great frigatebird nestlings from their own nesting colonies. They are often seen foraging in large, mixed-species flocks, especially flocking with sooty terns (Sterna fuscata) and wedge-tailed shearwaters (Puffinus pacificus). Great frigatebirds occasionally drink fresh water by dipping their bill into water while in flight.

Animal Foods: birds; reptiles; fish; mollusks

Primary Diet: carnivore (Piscivore , Molluscivore )

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Comments: Pursues boobies (sometimes terns and shearwaters) in flight, "steals" disgorged food (e.g., see Vickery and Brooke, 1994, Condor 96:331-340); also takes fish from surface of water, and may eat hatchling sea turtles and young sea birds.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Associations

Ecosystem Roles

Great frigatebirds commonly forage and nest with other species of seabirds. They will steal food from other seabirds as well, especially from boobies, tropicbirds, and petrels. Parasites reported include feather lice (Phthiraptera), including the species Colopocephalum angulaticeps, Fregatiella aurifasciata, and Pectinopygus gracilicornis, and hippoboscid flies (Olfersia spinifera).

Species Used as Host:

  • boobies (Sula)
  • tropicbirds (Phaethon)
  • petrels (Pterodroma)

Commensal/Parasitic Species:

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Predation

There are no reported natural predators of adults, although humans will capture adults, eggs, and young to eat. Eggs and nestlings may be preyed on by other frigatebirds (Fregata), owls (Strigiformes), and introduced predators such as rats (Rattus) and domestic cats (Felis catus). Bristle-thighed curlews (Numenius tahitiensis) have been reported eating their eggs.

Known Predators:

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Life History and Behavior

Behavior

Communication and Perception

Great frigatebirds are generally quiet, but they make a variety of sounds in different contexts, especially at breeding colonies. They snap their bills and squawk at birds that are too close to them in breeding colonies. Hatchlings use a harsh begging call, along with bobbing of their heads and spread wings. Adults call to young as they return also, to let them know they are coming with food. Males call more than females but there are no songs. There are 3 kinds of calls: landing calls, warbling, and reeling calls. Landing calls occur when adults are returning to the breeding colony, although females are usually quiet. Warbling and reeling calls are used by males during courtship displays, along with bill-rattling. These calls may be used when flying over potential female mates or when engaging in mutual head-waving as part of courtship. Great frigatebirds also use bill-snapping or rattling and vibrations of their mandibles to make sounds. Bill-snapping is used in agressive interactions, rattling and vibrations are used in courtship.

Communication Channels: visual ; acoustic

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Life Expectancy

Lifespan/Longevity

There is little available information on longevity in great frigatebirds. The oldest banded bird lived to 37 years and a maximum age of 40 years is estimated and from 25 to 30 years is considered a typical lifespan. At one site, during a productive year, between 60 and 70% of eggs laid were successfully raised to fledging. But complete failure, or failure rates of up to 81% are reported from El Niño years when food is scarce.

Range lifespan

Status: wild:
37 (high) years.

Typical lifespan

Status: wild:
40 (high) years.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Lifespan, longevity, and ageing

Maximum longevity: 43 years (wild)
Creative Commons Attribution 3.0 (CC BY 3.0)

© Joao Pedro de Magalhaes

Source: AnAge

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Reproduction

Great frigatebirds form monogamous, mated pairs yearly. If a pair is unsuccessful in mating, then they may divorce and select a new mate to attempt breeding. Extra-pair copulations are frequent and males often attempt to copulate with mated females when their mates are absent.

Males display in tight groups on a shrub or tree, often only 1 to 1.5 meters apart. They display continuously for several days until they acquire a mate. Females soar above display sites to assess males. Courtship displays involve a male inflating his bright red gular sac, pointing his head and bill upwards, vibrating the wings while they are extended, and using a warble vocalization and bill-rattling. Males orient themselves towards females that are soaring above. Courtship display then proceeds to reeling vocalization and rolling the head from side to side. Once a female chooses a male, they spend several days close to each other and occasionally engaging in mutual head waving.

Mating System: monogamous

Great frigatebird females breed only every 2 years or less often. Males occasionally breed yearly, but typically breed only as often as every 2 years. The timing of breeding varies substantially with region and the breeding season is extended. Breeding is seasonal in a region, but breeding is recorded from December through September throughout their range. Eggs are typically laid in a 5 to 6 month period, but eggs have been observed throughout the year. Seasonality of breeding in a region is probably linked to regional food availability. In nest clusters within a colony, egg-laying and hatching may be fairly synchronous. Once a pair bond has formed, a nest has been prepared, and an egg is laid, mates do not interact much, even when they exchange caretaking responsibilities. Time from courtship to nest building may be as little as a few days or as long as 4 weeks. Nests are generally platforms built of twigs, sticks, and other collected materials on the same trees or bushes that were used by males for courtship displays, resulting in clustered nesting colonies of 3 to 50 nests and 0.6 to 1.4 m between nests. Nests are generally sheltered from the wind but in full sun. Occasional nests are built on the ground. Generally a single, white egg is laid, but rare nests with 2 eggs or nestlings have been observed. It is possible that the eggs were laid by more than one female. Females may lay a second egg in a season if the first fails or is destroyed. Eggs are incubated immediately after laying and are never left unattended. Young begin to fly at 150 days old. They remain on the nest for 150 to 428 days after fledging, where they continue to be fed and protected by their parents. Fledglings remain near the nest for 10 to 16 months after hatching, at which point they disperse to the ocean. Great frigatebirds have an extended period of adolescence and attain sexual maturity between 5 and 7 years old. Occasionally individuals with immature plumage have been observed breeding.

Breeding interval: Great frigatebirds breed as often as every 2 years, but generally mate less often.

Breeding season: Breeding is seasonal in a region, but breeding is recorded from December through September throughout their range.

Range eggs per season: 1 to 1.

Range fledging age: 150 (low) days.

Range time to independence: 300 to 578 days.

Range age at sexual or reproductive maturity (female): 5 to 7 years.

Range age at sexual or reproductive maturity (male): 5 to 7 years.

Key Reproductive Features: seasonal breeding ; gonochoric/gonochoristic/dioecious (sexes separate)

Once a mated pair is formed, one or the other of the parents stays at the nest site until the nestling is 4 to 6 weeks old. Both parents incubate the egg and brood the nestling. Parents take turns incubating the egg from 3 to 18 days at a time. Typical incubation shift lengths are from 4.1 to 6.4 days long, but they vary regionally and are probably related to the distance the other parent has to travel to be able to forage. Females incubate for longer than males, in general. Young are altricial at hatching, naked and with their eyes closed. They grow very slowly, possibly as an adaptation to low or variable food availability. Growth rates vary with the availability of food. They are fed 2 to 4 times a day in their first few weeks and only every 1 to 2 days later in their deelopment. Nestlings are not left unattended by a parent until they are about 1 month old. By 14 days old nestlings are covered in white down and they develop flight plumage and begin flying by 150 days after hatching. They remain in the nest for 150 to 428 days after fledging and continue to be cared for by their parents during that time.

Parental Investment: altricial ; pre-fertilization (Provisioning, Protecting: Female); pre-hatching/birth (Provisioning: Female, Protecting: Male, Female); pre-weaning/fledging (Provisioning: Male, Female, Protecting: Male, Female); pre-independence (Provisioning: Male, Female, Protecting: Male, Female)

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Variable nesting season in Hawaii, most eggs laid January-June; possibly year-round nesting on Cocos Island (Stiles and Skutch 1989). Clutch size is 1. Incubation, by both sexes, lasts probably about 40 days. Young usually fledge by October. First breeds probably at 5 years. See Reville (1988) for information on breeding on Aldabra Atoll, Seychelles. Nests usually in clusters of 10-25 pairs on Cocos Island (Stiles and Skutch 1989).

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Barcode data: Fregata minor

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There are 4 barcode sequences available from BOLD and GenBank.  Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.  See the BOLD taxonomy browser for more complete information about this specimen and other sequences.

TTTATACTTAATCTTCGGTGCATGAGCTGGTATAGTTGGAACCGCCCTCAGCCTTCTCATCCGAGCAGAGCTTGGCCAACCAGGAACCCTCCTAGGAGATGACCAAATCTACAACGTAATCGTTACTGCTCACGCCTTCGTAATAATCTTCTTCATAGTAATACCAATCATGATCGGAGGATTTGGAAACTGACTTCTCCCACTTATAATTGGCGCCCCAGACATAGCATTCCCACGAATAAACAACATAAGCTTCTGACTACTTCCACCATCCTTCCTACTCCTACTAGCCTCTTCTACCGTCGAAGCAGGAGCAGGCACAGGGTGAACCGTATACCCCCCACTAGCTGGTAACCTAGCCCATGCTGGAGCATCCGTAGACCTCGCCATCTTCTCTCTTCACCTAGCAGGTGTCTCCTCTATTCTAGGAGCAATCAACTTCATCACAACTGCCACTAATATAAAACCTCCTGCTCTCTCACAATACCAAACACCCCTATTCGTATGATCCGTCCTCATCACTGCTGTCCTACTCCTACTCTCACTCCCAGTCCTCGCTGCCGGCATCACCATACTACTAACAGACCGAAACCTAAATACCACATTCTTTGACCCGGCCGGAGGAGGAGACCCAGTACTGTACCAACACCTTTTCTGATTCTTCGGCCACCCTGAAGTCTACATTCTAATTCTC
-- end --

Download FASTA File
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Statistics of barcoding coverage: Fregata minor

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 4
Specimens with Barcodes: 5
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Conservation

Conservation Status

IUCN Red List Assessment


Red List Category
LC
Least Concern

Red List Criteria

Version
3.1

Year Assessed
2012

Assessor/s
BirdLife International

Reviewer/s
Butchart, S. & Symes, A.

Contributor/s

Justification
Although this species may have a restricted range, it is not believed to approach the thresholds for Vulnerable under the range size criterion (Extent of Occurrence <20,000 km2 combined with a declining or fluctuating range size, habitat extent/quality, or population size and a small number of locations or severe fragmentation). Despite the fact that the population trend appears to be decreasing, the decline is not believed to be sufficiently rapid to approach the thresholds for Vulnerable under the population trend criterion (>30% decline over ten years or three generations). The population size is very large, and hence does not approach the thresholds for Vulnerable under the population size criterion (<10,000 mature individuals with a continuing decline estimated to be >10% in ten years or three generations, or with a specified population structure). For these reasons the species is evaluated as Least Concern.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Great frigatebirds are considered "least concern" by the IUCN because of their large population sizes and range. Populations have historically declined, primarily because of disturbance at historical breeding colonies and destruction of nesting habitats. In addition, introduced predators can seriously impact nesting populations. Populations may still be declining, but there is little data to understand the pattern of decline. They are protected by the U.S. Migratory Bird Treaty Act. Great frigatebird adults and young are captured and eaten by humans and die when they collide with man-made structures.

US Migratory Bird Act: protected

US Federal List: no special status

CITES: no special status

IUCN Red List of Threatened Species: least concern

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

National NatureServe Conservation Status

United States

Rounded National Status Rank: NNRB - Unranked

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

NatureServe Conservation Status

Rounded Global Status Rank: G4 - Apparently Secure

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Population

Population Trend
Decreasing
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Relevance to Humans and Ecosystems

Benefits

Economic Importance for Humans: Negative

There are no adverse effects of great frigatebirds on humans. They live on remote, offshore islands and over open ocean. They may take fish scraps from commercial fishing operations or steal small fish from nets or baited hooks.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Economic Importance for Humans: Positive

Great frigatebirds are important members of pelagic ocean ecosystems. Adults, nestlings, and eggs are collected for food in some areas. On islands in the Pacific young frigatebirds were sometimes raised as pets and used to convey messages from traveling islanders to their homes. Nesting colonies contribute to guano deposits.

Positive Impacts: food ; produces fertilizer

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Wikipedia

Great Frigatebird

The Great Frigatebird (Fregata minor) is a large deceptive seabird in the frigatebird family. Major nesting populations are found in the Pacific (including Galapagos Islands) and Indian Oceans, as well as a population in the South Atlantic.

The Great Frigatebird is a lightly built large seabird up to 105 cm long with predominantly black plumage. The species exhibits sexual dimorphism; the female is larger than the adult male and has a white throat and breast, and the male's scapular feathers have a purple-green sheen. In breeding season, the male is able to distend its striking red gular sac. The species feeds on fish taken in flight from the ocean's surface (mostly flyingfish), and indulges in kleptoparasitism less frequently than other frigatebirds. They feed in pelagic waters within 80 km (50 mi) of their breeding colony or roosting areas.

Taxonomy[edit]

Its scientific name of Fregata minor arose because when it was first discovered, it was thought to be a small pelican, and so named Pelecanus minor by the German naturalist Johann Friedrich Gmelin in 1789. Due to the rules of taxonomy, its species name of minor was retained despite being placed in a separate genus. This has led to the discrepancy between minor, Latin for 'smaller' in contrast with its common name. In Hawaii this species is also known as the Iwa (or 'thief' in Hawaiian).[2]

It is one of five closely related species of Frigatebird that make up their own genus (Fregata) and family (Fregatidae). Its closest relative within the group is the Christmas Island Frigatebird (F. andrewsii).

Description[edit]

Male, showing feathers on gular sac

The Great Frigatebird is the second largest frigatebird after the Magnificent Frigatebird, measuring 85 to 105 centimetres (33 to 41 in) in length with long pointed wings of 205–230 cm (80.5–90.5 in) and long forked tails.[3] The Great Frigatebird weighs from 640–1,550 g (1.4–3.4 lb).[4]

The frigatebirds have the highest ratio of wing area to body mass and the lowest wing loading of any bird. This has been hypothesized to enable the birds to utilize marine thermals created by small differences between tropical air and water temperatures. Male Great Frigatebirds are smaller than females, but the extent of the variation varies geographically.[5] The plumage of males is black with scapular feathers that have a green iridescence when they refract sunlight. Females are black with a white throat and breast and have a red eye ring. Juveniles are black with a rust-tinged white face, head, and throat.

Distribution and habitat[edit]

The Great Frigatebird has a wide distribution throughout the world’s tropical seas. Hawaii is the northernmost extent of their range in the Pacific Ocean, with around 10,000 pairs nesting mostly in the Northwestern Hawaiian Islands. In the Central and South Pacific, colonies are found on most islands Groups from Wake Island to the Galapagos Islands to New Caledonia with a few pairs nesting on Australian possessions in the Coral Sea. Colonies are also found on numerous Indian Ocean islands including Aldabra, Christmas Island, Maldives and Mauritius. The small populations in the Western Atlantic Ocean may still persist but are very small if they do. Great Frigatebirds undertake regular migrations across their range, both regular trips and more infrequent widespread dispersals. Birds marked with wing tags on Tern Island in French Frigate Shoals were found to regularly travel to Johnston Atoll (873 km), one was reported in Quezon City in the Philippines.[6] Despite their far ranging birds also exhibit philopatry, breeding in their natal colony even if they travel to other colonies.[7]

Behaviour[edit]

Feeding[edit]

An immature Great Frigatebird performing a surface snatch on a Sooty Tern chick dropped by another bird

The Great Frigatebird forages in pelagic waters within 80 km (50 mi) of the breeding colony or roosting areas. Flyingfish from the family Exocoetidae are the most common item in the diet of the Great Frigatebird; other fish species and squid may be eaten as well. Prey is snatched while in flight, either from just below the surface or from the air in the case of flyingfish flushed from the water. Great Frigatebirds will make use of schools of predatory tuna or pods of dolphins that push schooling fish to the surface.[8] Like all frigatebirds they will not alight on the water surface and are usually incapable of taking off should they accidentally do so.

Great Frigatebirds will also hunt seabird chicks at their breeding colonies, taking mostly the chicks of Sooty Terns, Spectacled Terns, Brown Noddies and Black Noddies. Studies show that only females (adults and immatures) hunt in this fashion, and only a few individuals account for most of the kills.[9]

Great Frigatebirds will attempt kleptoparasitism, chasing other nesting seabirds (boobies and tropicbirds in particular) in order to make them regurgitate their food. This behaviour is not thought to play a significant part of the diet of the species, and is instead a supplement to food obtained by hunting. A study of Great Frigatebirds stealing from Masked Boobies estimated that the frigatebirds could at most obtain 40% of the food they needed, and on average obtained only 5%.[10]

Breeding[edit]

Male collecting twigs for the nest
Breeding pair
Chick begging from female parent

Great Frigatebirds are seasonally monogamous, with a breeding season that can take two years from mating to the end of parental care. The species is colonial, nesting in bushes and trees (and on the ground in the absence of vegetation) in colonies of up to several thousand pairs. Nesting bushes are often shared with other species, especially Red-footed Boobies and other species of frigatebirds.

Both sexes have a patch of red skin at the throat that is the gular sac; in male Great Frigatebirds this is inflated in order to attract a mate. Groups of males sit in bushes and trees and force air into their sac, causing it to inflate over a period of 20 minutes into a startling red balloon. As females fly overhead the males waggle their heads from side to side, shake their wings and call. Females will observe many groups of males before forming a pair bond. Having formed a bond the pair will sometimes select the display site, or may seek another site, to form a nesting site; once a nesting site has been established both sexes will defend their territory (the area surrounding the nest that can be reached from the nest) from other frigatebirds.

Pair bond formation and nest-building can be completed in a couple of days by some pairs and can take a couple of weeks (up to four) for other pairs. Males collect loose nesting material (twigs, vines, flotsam) from around the colony and off the ocean surface and return to the nesting site where the female builds the nest. Nesting material may be stolen from other seabird species (in the case of Black Noddies the entire nest may be stolen) either snatched off the nesting site or stolen from other birds themselves foraging for nesting material. Great Frigatebird nests are large platforms of loosely woven twigs that quickly become encrusted with guano. There is little attempt to maintain the nests during the breeding season and nests may disintegrate before the end of the season.

A single dull chalky-white egg measuring 68 x 48 mm is laid during each breeding season.[11] If the egg is lost the pair bond breaks; females may acquire a new mate and lay again in that year. Both parents incubate the egg in shifts that last between 3–6 days; the length of shift varies by location, although female shifts are longer than those of males. Incubation can be energetically demanding, birds have been recorded losing between 20–33% of their body mass during a shift.

Incubation lasts for around 55 days. Great Frigatebird chicks begin calling a few days before hatching and rub their egg tooth against the shell. The altricial chicks are naked and helpless, and lie prone for several days after hatching. Chicks are brooded for two weeks after hatching after which they are covered in white down, and guarded by a parent for another fortnight after that. Chicks are given numerous meals a day after hatching, once older they are fed every one to two days. Feeding is by regurgitation, the chick sticks its head inside the adults mouth.

Parental care is prolonged in Great Frigatebirds. Fledging occurs after 4–6 months, the timing dependent on oceanic conditions and food availability.[3] After fledging chicks continue to receive parental care for between 150–428 days; frigatebirds have the longest period of post-fledging parental care of any bird. The length of this care depends on oceanic conditions, in bad years (particularly El Niño years) the period of care is longer. The diet of these juvenile birds is provided in part by food they obtained for themselves and in part from their parents. Young fledglings will also engage in play; with one bird picking up a stick and being chased by one or more other fledglings. After the chick drops the stick the chaser attempts to catch the stick before it hits the water, after which the game starts again. This play is thought to be important in developing the aerial skills needed to fish.

Male in flight, Galapagos Islands
Flight
Female in flight, Lady Elliot Island, Qld


References[edit]

  1. ^ BirdLife International (2012). "Fregata minor". IUCN Red List of Threatened Species. Version 2013.2. International Union for Conservation of Nature. Retrieved 26 November 2013. 
  2. ^ Eliot, John L. and Blair, Jonathan (1978). "Hawaii's Far-flung Wildlife Paradise". National Geographic (National Geographic Society) 153 (5): 679. ISSN 0027-9358. 
  3. ^ a b Metz, V. G., & E. A. Schreiber. (2002). Great Frigatebird (Fregata minor). In The Birds of North America, No. 681 (A. Poole and F. Gill, eds.). The Birds of North America, Inc., Philadelphia, PA.
  4. ^ CRC Handbook of Avian Body Masses by John B. Dunning Jr. (Editor). CRC Press (1992), ISBN 978-0-8493-4258-5.
  5. ^ Schreiber E & Schreiber R (1988). "Great Frigatebird Size Dimorphism on Two Central Pacific Atolls". Condor 90 (1): 90–99. doi:10.2307/1368437. 
  6. ^ Dearborn, D., Anders, A., Schreiber, E., Adams, R. & Muellers, U. (2003). "Inter Island movements and population differentiation in a pelagic seabird". Molecular Ecology 12 (10): 2835–2843. doi:10.1046/j.1365-294X.2003.01931.x. PMID 12969485. 
  7. ^ Harrison C. (1990). Seabirds of Hawaii: natural history and conservation. Cornell Univ. Press, Ithaca, NY. ISBN 0-8014-2449-6
  8. ^ Au, D.W.K. & Pitman, R.L. (1986). "Seabird interactions with Dolphins and Tuna in the Eastern Tropical Pacific". Condor 88 (3): 304–317. doi:10.2307/1368877. 
  9. ^ Megyesi JL, Griffin CR (1996). "Brown noddy chick predation by great frigatebirds in the northwestern Hawaiian islands". Condor 98 (2): 322–327. doi:10.2307/1369150. 
  10. ^ Vickery, J & Brooke, M. (1994). "The Kleptoparasitic Interactions between Great Frigatebirds and Masked Boobies on Henderson Island, South Pacific". Condor 96 (2): 331–340. doi:10.2307/1369318. 
  11. ^ Beruldsen, G (2003). Australian Birds: Their Nests and Eggs. Kenmore Hills, Qld: self. pp. 186–87. ISBN 0-646-42798-9. 
Creative Commons Attribution Share Alike 3.0 (CC BY-SA 3.0)

Source: Wikipedia

Unreviewed

Article rating from 0 people

Average rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!