Articles on this page are available in 1 other language: Spanish (8) (learn more)

Overview

Distribution

Range

Humid montane forests of Costa Rica and w Panama.

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Ecology

Habitat

Habitat and Ecology

Systems
  • Terrestrial
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Barcode data: Selasphorus scintilla

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There are 2 barcode sequences available from BOLD and GenBank.  Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.  See the BOLD taxonomy browser for more complete information about this specimen and other sequences.

CCTATACATAATCTTTGGAGCATGGGCTGGAATAGTTGGAACCTCCCTAAGCCTGCTAATCCGAGCAGAACTCGGCCAACCAGGCACCCTGCTAGGGGACGATCAAATTTACAATGTGATCGTCACTGCCCATGCCTTTGTAATAATCTTCTTCATAGTCATGCCAATCATAATCGGAGGCTTTGGAAACTGATTAATTCCCCTCATAATTGGGGCCCCCGATATAGCATTCCCACGTATAAATAACATAAGCTTCTGACTCCTGCCACCGTCATTCCTCTTACTCCTTGCTTCCTCTACCGTAGAAGCAGGCGCAGGTACAGGATGAACCGTATACCCCCCTCTGGCCGGCAATCTAGCCCACGCAGGAGCATCAGTAGACCTAGCCATCTTCTCCTTACACCTGTCAGGCATCTCATCAATCCTAGGAGCAATTAACTTCATTACCACCGCAATCAATATAAAACCACCTGCCCTGTCACAATACCAAACCCCCCTATTCGTTTGATCTGTGCTTATTACTGCCGTCCTACTTCTTCTCTCACTCCCAGTACTTGCCGCTGGAATCACCATACTACTCACAGACCGAAACCTAAACACCACATTTTTCGACCCCGCTGGAGGAGGAGACCCCATCCTTTACCAACACTTA
-- end --

Download FASTA File
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Statistics of barcoding coverage: Selasphorus scintilla

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 2
Specimens with Barcodes: 2
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Conservation

Conservation Status

IUCN Red List Assessment


Red List Category
LC
Least Concern

Red List Criteria

Version
3.1

Year Assessed
2012

Assessor/s
BirdLife International

Reviewer/s
Butchart, S. & Symes, A.

Contributor/s

Justification
Although this species may have a small range, it is not believed to approach the thresholds for Vulnerable under the range size criterion (Extent of Occurrence <20,000 km2 combined with a declining or fluctuating range size, habitat extent/quality, or population size and a small number of locations or severe fragmentation). The population trend appears to be stable, and hence the species does not approach the thresholds for Vulnerable under the population trend criterion (>30% decline over ten years or three generations). The population size has not been quantified, but it is not believed to approach the thresholds for Vulnerable under the population size criterion (<10,000 mature individuals with a continuing decline estimated to be >10% in ten years or three generations, or with a specified population structure). For these reasons the species is evaluated as Least Concern.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Population

Population
The global population size has not been quantified, but this species is described as 'common' (Stotz et al. (1996).

Population Trend
Stable
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Wikipedia

Scintillant Hummingbird

The Scintillant Hummingbird (Selasphorus scintilla) is the smallest hummingbird within its range, which includes only the mountains of Costa Rica and western Panama.

This tiny bird inhabits brushy forest edges, coffee plantations and sometimes gardens at altitudes from 900–2,000 m (3,000–6,600 ft), and up to 2,500 m (8,200 ft) when not breeding. It is only 6.5–8 cm (2.6–3.1 in) long, including the bill.[2] The male weighs 2 g (0.071 oz) and the female 2.3 g (0.081 oz). This is one of the smallest birds in existence, marginally larger than the Bee Hummingbird.[3] The black bill is short and straight.

The adult male Scintillant Hummingbird has bronze-green upperparts and a rufous and black-striped tail. The throat is brilliant red, separated from the cinnamon underparts by a white neck band. The female is similar, but her throat is buff with small green spots and the flanks are richer rufous. Young birds resemble the female but have rufous fringes to the upperpart plumage.

female

The female Scintillant Hummingbird is entirely responsible for nest building and incubation. She lays two white eggs in her tiny plant-floss cup nest 1–4 m (3 ft 3 in–13 ft 1 in) high in a scrub. Incubation takes 15–19 days, and fledging another 20–26.

The food of this species is nectar, taken from a variety of small flowers, including Salvia and species normally pollinated by insects. Like other hummingbirds it also takes some small insects as an essential source of protein. In the breeding season, Scintillant Hummingbird males perch conspicuously in open areas with Salvia and defend their feeding territories aggressively with diving displays. The call of this rather quiet species is a liquid tsip.

This species is replaced at higher elevations by its relative, the Volcano Hummingbird, Selasphorus flammula.

Gallery[edit]

References[edit]

  1. ^ BirdLife International (2012). "Selasphorus scintilla". IUCN Red List of Threatened Species. Version 2013.2. International Union for Conservation of Nature. Retrieved 26 November 2013. 
  2. ^ The Birds of Costa Rica: A Field Guide by Richard Garrigues & Robert Dean. Cornell University Press (2007), ISBN 978-0-8014-7373-9.
  3. ^ Wood, The Guinness Book of Animal Facts and Feats. Sterling Pub Co Inc (1983), ISBN 978-0-85112-235-9
Creative Commons Attribution Share Alike 3.0 (CC BY-SA 3.0)

Source: Wikipedia

Unreviewed

Article rating from 0 people

Default rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!