Articles on this page are available in 2 other languages: Chinese (Simplified) (8), Dutch (1) (learn more)

Overview

Brief Summary

Great cormorants eat fish and are known for their excellent diving skills. They forage in fresh as well as saline or brackish water. They can rotate their eyes, something most other birds are unable to do. Unlike other water fowl, their plumage is not oily. They absorb lots of water, so they need to spread their wings to dry after a swim. This bird has not had an easy life in the Netherlands. Because it was considered a rival for fishermen, they were shot, poisoned, chased away and even hung in huge numbers,
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© Copyright Ecomare

Source: Ecomare

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Biology

Coastal cormorants make their nest on rocky ledges or islands out of seaweeds; inland tree-nesting birds construct their nest from twigs. The faeces are so acidic that nest-trees usually die within about three years (3). Either 3 or 4 pale blue, chalky eggs are laid, these are incubated for 28-31 days during which time they are placed on the adult's feet and warmed by the body (3). In the first few days of life the chicks feed on liquid regurgitated by the parents, they then take solid food from the parent's throats (3). After 50 days of life the young fledge, and return to the colony to breed at 2-3 years of age (3). During the winter, they roost together each evening, sometimes in their hundreds (9). Cormorants feed exclusively on fish (6), which are caught by means of dives from the surface of the water (6). A wide range of fish is taken, and this bird's efficiency as a predator has brought it into conflict with anglers (3). The cormorant has special feathers, which allow the water to penetrate, enabling the bird to swim well under water. After fishing, cormorants stand in a characteristic pose, with wings out and neck extended (3). This was thought to be to dry their wings, but is now considered to help digestion (9).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Description

This large water bird has a long neck, giving it something of a primitive, reptilian appearance (3). Adults are black with a bluish or green sheen. At the base of the bill is an area of bare, yellow skin surrounded by white (1). During the breeding season there is a white patch on the thigh, and throughout the year a variable amount of white occurs on the crown and back of the neck (1). Juveniles are dark brown and have a white area on the underparts (1). A variety of deep vocalisations are produced in colonies (1). The name cormorant is derived from the Latin 'corvus marinus', which means 'sea crow' (4).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Comprehensive Description

Longueur 80-100 cm, envergure 130-160 cm, poids 1,7-3 kg.

L’habitat est aquatique. Il inclut l’espace maritime côtier, jusqu’en limite du plateau continental, et les eaux douces de toutes sortes, avec une large préférence pour les eaux stagnantes ou calmes. La sous-espèce carbo habite les falaises de la côte atlantique tandis que sinensis niche en colonies arboricoles dans les zones humides intérieures.

Le Grand Cormoran se nourrit de poissons qu’il pêche en plongée. La plupart des proies et notamment les plus grosses sont rapportées à la surface avant d’être avalées.

L’espèce est souvent grégaire et les colonies peuvent compter plusieurs centaines de nids. En dehors de la saison des nids, les groupes se forment en fonction de la disponibilité des ressources. Au moment de la reproduction, les démonstrations du mâle sont silencieuses mais différents signaux visuels attirent l’attention des femelles.

Le nid est un amoncellement de divers matériaux trouvés à proximité (branchages, algues, roseaux, etc.), tapissé d’éléments plus fins. Il peut atteindre 1 m de hauteur. La ponte de 3 ou 4 œufs (max. 6) débute en mars. Une seule nichée est produite. L’incubation dure 1 mois et l’envol a lieu à l’âge de 50 jours environ.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Muséum national d'Histoire naturelle. Service du Patrimoine naturel

Source: Inventaire National du Patrimoine Naturel

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Uiterlijk

Grote zwarte vogel (lengte tot ruim 90 centimeter) met een lange dikke hals. Forse snavel.

Public Domain

Supplier: geron

Unreviewed

Article rating from 0 people

Average rating: 2.5 of 5

It is almost entirely black in plumage, apart from a white and yellow chin and a small white patch on each thigh (absent in winter). The bill is grey and the legs and feet are black. Young birds resemble the adults but are more dusky-brown.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© New Guinea Birds

Source: Birds of Papua New Guinea

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Distribution

Geographic Range

Great cormorants are one of the most widespread of cormorant species, with a cosmopolitan distribution. Great cormorants are found throughout Europe, Asia, Africa, Australia, and in northeastern coastal North America. Populations in the western Atlantic and Europe have increased, with some range expansion, in the last 50 years.

Biogeographic Regions: nearctic (Native ); palearctic (Native ); oriental (Native ); ethiopian (Native ); australian (Native )

Other Geographic Terms: cosmopolitan

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 1 person

Average rating: 4.0 of 5

Global Range: The most widely distributed of all cormorant species. Breeds in North America along Atlantic coast from northern shore of Gulf of St. Lawrence and southwestern Newfoundland south to Prince Edward Island and Nova Scotia, formerly to Bay of Fundy; recently recolonized Maine (Buckley and Buckley 1984); also in Iceland, southwestern Greenland, and much of Old World (see map in Johnsgard 1993). Winters: breeding range and regularly south to North Carolina, sometimes farther south and even to the Gulf Coast. In North America, the highest winter densities occur from Long Island Sound north to the Bay of Fundy and off the southern tip of Nova Scotia (Root 1988). Rangewide, sea level to 3400 m (Johnsgard 1993).

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 1 person

Average rating: 3.0 of 5

occurs (regularly, as a native taxon) in multiple nations

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

National Distribution

Canada

Origin: Native

Regularity: Regularly occurring

Currently: Present

Confidence: Confident

Type of Residency: Year-round

United States

Origin: Native

Regularity: Regularly occurring

Currently: Present

Confidence: Confident

Type of Residency: Year-round

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

North America; Oceania; range extends from Newfoundland to southern North Carolina
  • North-West Atlantic Ocean species (NWARMS)
Creative Commons Attribution 3.0 (CC BY 3.0)

© WoRMS for SMEBD

Source: World Register of Marine Species

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

semi-cosmopolitan
  • UNESCO-IOC Register of Marine Organisms
Creative Commons Attribution 3.0 (CC BY 3.0)

© WoRMS for SMEBD

Source: World Register of Marine Species

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Range Description

The Great Cormorant has an extremely large distribution, being found on every continent except South America and Antarctica. Colonies in North America are restricted to the north-east, although individuals do winter further south up to the tip of Florida (USA). Breeding colonies are also found in in western Greenland (to Denmark). In Europe, the it can be found along most of the Atlantic coast, as well as throught the Mediterranean and in large areas of Eastern Europe. In Africa, it can be found wintering of the northern coast as well as along the Nile, and breeding year-round on the north-west coast, in pockets of central-east Africa and in South Africa. Summer breeding occurs in patches through much of central Asia up to eastern China, year-round wintering occurs in India and southern China, and birds can be found wintering in south-east Asia. Finally, it can be found in most of Australia except central regions, and it also winters in New Zealand1.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Range

This bird occurs around the coastline of Great Britain, but is absent from much of north east Scotland (3). Although typically thought of as a sea bird, inland breeding colonies do occur, these are now increasing after being largely wiped out due to persecution since medieval times (5). Globally this is a very widespread species, occurring in most temperate areas of the Old World (6).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Subspecies and Distribution:


    * carbo (Linnaeus, 1758) - E Canada through Greenland and Iceland to Norway and British Is. * sinensis (Blumenbach, 1798) - C & S Europe E to India and China. * hanedae Nagamichi Kuroda, 1925 - Japan. * maroccanus Hartert, 1906 - NW Africa. * lucidus (Lichtenstein, 1823) - coastal W & S Africa, inland E Africa. * novaehollandiae Stephens, 1826 - Australia, Tasmania, New Zealand, Chatham Is.


Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© New Guinea Birds

Source: Birds of Papua New Guinea

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Physical Description

Morphology

Physical Description

Great cormorants are 84 to 90 cm long, with wingspans of 130 to 160 cm. They weigh from 2.6 to 3.7 kg. Males and females are similar in appearance, but males are 5 to 10% longer and up to 20% heavier. They have dark plumage overall, with a bluish gloss to it. Their wings are slightly more brown and their face and gular region are yellow, bordered with small, white feathers. In the breeding season their heads and necks develop short, white plumes interspersed in their dark plumage. They also develop a white patch on each thigh. During egg-laying adults develop a small yellow to scarlet patch behind and below each eye. Immature individuals may be more brown or mottled in appearance. African great cormorants tend to have extensive white portions of their head and neck.

Great cormorants co-occur with other species of cormorant throughout most of their range, except for Greenland. In eastern North America they may be confused with the more abundant double-crested cormorants (Phalacrocorax auritus), which they commonly roost and nest near. Great cormorants are overall larger and have more white on their head and neck. Great cormorants are easily confused with European shags (Phalacrocorax aristotelis) in Europe.

Great cormorants vary in size and plumage throughout their range. In general, Asian and African populations are smaller than Palearctic and North American populations. The amount of white plumes on the head and neck, the color of skin on the head, and the color of the sheen on the black plumage varies substantially, but the pattern of variation has not been completely described. There are from 6 to 8 subspecies described: P. c. sinensis in Eurasia, P. c. hanedae in the Sea of Japan, P. c. novaehollandiae in Australia and New Zealand, P. c. maroccanus in northwestern Africa, and P. c. lucidus in the remainder of Africa.

Great cormorant resting metabolic rates have been estimated at 3.1 watts per kg. They are able to maintain their body temperatures in cold water and begin to use gular fluttering to lose heat when temperatures go above 20 degrees Celsius.

Range mass: 2.6 to 3.7 kg.

Range length: 84 to 90 cm.

Range wingspan: 130 to 160 cm.

Other Physical Features: endothermic ; homoiothermic; bilateral symmetry

Sexual Dimorphism: male larger

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Size

Length: 91 cm

Weight: 2500 grams

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Diagnostic Description

Description

Length: 80-100 cm. Plumage: generally black with a greenish gloss; cheeks, throat to upper breast white; thigh patches white when breeding. Immature blackish-brown above, off-white below. Bare parts: iris green; lores orange in male, scarlet in female; bill grey--darker above; gular pouch olive to dark green; feet and legs black. Immature with yellow gular pouch. Habitat: marine and inland waters, coastal estuaries.<388><393><391>
  • Brown, L.H., E.K. Urban & K. Newman (1982). The Birds of Africa, Volume I. Academic Press, London.
Creative Commons Attribution 3.0 (CC BY 3.0)

© WoRMS for SMEBD

Source: World Register of Marine Species

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

It is almost entirely black in plumage, apart from a white and yellow chin and a small white patch on each thigh (absent in winter). The bill is grey and the legs and feet are black. Young birds resemble the adults but are more dusky-brown.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© New Guinea Birds

Source: Birds of Papua New Guinea

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Ecology

Habitat

Comments: Lakes, rivers, and seacoasts; in North America, seacoasts and lower parts of large rivers, especially sheltered areas. In North America, nests mostly on higher parts of cliffs or slopes, on flat tops of rocky islands, or in low, dense, stunted spruce (Prince Edward Island). See Johnsgard (1993) for information from Old World.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Habitat and Ecology

Habitat and Ecology
Behaviour Throughout its range the species is sedentary or locally dispersive, with northerly populations also making strong migratory movements (del Hoyo et al. 1992). The timing of breeding varies geographically, occurring all year round (del Hoyo et al. 1992) or coinciding with the rains in the tropics (Johnsgard 1993) and peaking between April and June in the temperate regions of the Northern Hemisphere (del Hoyo et al. 1992). The species breeds in mixed-species colonies (del Hoyo et al. 1992) of 10-500 pairs (Nelson 2005) (occasionally up to 1,000 pairs) (Brown et al. 1982), the size of the colony depending upon the extent of nearby feeding areas (Nelson 2005). It is usually a solitary feeder (Brown et al. 1982) but may form large fishing flocks in some areas (del Hoyo et al. 1992). It also roosts communally at nesting sites or in major feeding areas and flies in flocks of varying sizes (Brown et al. 1982). Off the coasts of eastern Jutland and of Læsø, Denmark, flocks sizes of up to 890 individuals were observed (Petersen et al 2003). Feeding is exclusively diurnal. Habitat The species frequents both coastal and inland habitats (Brown et al. 1982, del Hoyo et al. 1992, Johnsgard 1993, Snow and Perrins 1998, Nelson 2005). In marine environments it occurs in sheltered coastal areas on estuaries (del Hoyo et al. 1992), saltpans, coastal lagoons (del Hoyo et al. 1992, Johnsgard 1993), mangrove swamps, deltas (Johnsgard 1993) and coastal bays (Brown et al. 1982), requiring rocky shores, cliffs and islets for nesting (del Hoyo et al. 1992) but generally avoiding deep water and rarely extending far offshore (Snow and Perrins 1998). It also inhabits fresh, brackish or saline inland wetlands (Nelson 2005) including lakes, reservoirs, wide rivers, flood waters (del Hoyo et al. 1992), deep marshes with open water, swamps and oxbow lakes (Johnsgard 1993), requiring trees, bushes, reedbeds or bare ground for nesting (del Hoyo et al. 1992) and avoiding overgrown, small, very shallow or very deep waters (Nelson 2005). Diet The species' diet consists predominantly of fish, including sculpins, Capelin, gadids (Gremillet et al 2004) and flatfish (Leopold et al 1998) as well as crustaceans, amphibians (del Hoyo et al. 1992), molluscs and nestling birds (Brown et al. 1982). At sea the species preys mostly on bottom-dwelling fish, occasionally also taking shoaling fish in deeper waters (del Hoyo et al. 1992). It is a generalist, having been shown to feed on at least 22 different fish species (Gremillet 1997). Breeding site The nest varies from a depression (Nelson 2005) to a platform of sticks, reeds and seaweed (del Hoyo et al. 1992). On the coast the species nests on inshore islands, cliffs, stacks, amongst boulders and occasionally on artificial structures (del Hoyo et al. 1992), also nesting inland on trees or bushes, in reedbeds or on bare ground (del Hoyo et al. 1992). The species usually nests in mixed-species colonies, often re-using sites and nests from year to year (del Hoyo et al. 1992). Foraging range The Great Cormorant has a largely neritic distribution. At sea, it rarely wanders far from the coast, preferring sheltered areas and estuaries where it normally feeds in shallow water. It preys mainly on benthic fish species. It is rarely observed to dive below 10 m (BirdLife International 2000, Petersen et al 2003, Gremillet et al 2004) although it has been recorded at up to 35 m (Gremillet et al 2004). Several studies have shown that this species is able to forage up to 20-25 km from its wintering roosts or breeding colonies. Most foraging trips are confined to within 10 km of the colony (Gremillet 1997, BirdLife International 2000, Petersen et al 2003), but trips up to a 35 km radius have been recorded (Gremillet 1997). Off the coasts of eastern Jutland and at Læsø, Denmark, 75% of recorded birds were seen within 3 km of the coast (Petersen et al 2003). Preferred habitats include granitic boulder, since this is the favoured habitat of labrids, the commonest prey in the diet (Gremillet 1997). The species is also likely to select sandy areas with a high abundance of flatfish or rocky substrates where gobies, wrasse, sea scorpions and small gadoids occur (BirdLife International 2000).

Systems
  • Terrestrial
  • Freshwater
  • Marine
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Great cormorants are found in shallow, aquatic habitats, such as the coasts of oceans and large lakes and rivers. In North America, great cormorants are strongly associated with marine coastlines, in contrast to their smaller cousins, double-crested cormorants. In Europe, great cormorants are also found in inland, freshwater areas and in coastal estuaries. Nesting habits may vary among subspecies. North American great cormorants (P. c. carbo) nest mainly along coasts. Eurasian subspecies (P. c. sinensis) nest in inland areas, but the two subspecies sometimes occur in nesting colonies together in areas of recent overlap (British Isles).

Habitat Regions: temperate ; tropical ; saltwater or marine ; freshwater

Aquatic Biomes: lakes and ponds; rivers and streams; coastal

Other Habitat Features: estuarine

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Depth range based on 1907 specimens in 2 taxa.
Water temperature and chemistry ranges based on 300 samples.

Environmental ranges
  Depth range (m): 0 - 0
  Temperature range (°C): 2.225 - 13.223
  Nitrate (umol/L): 1.335 - 10.807
  Salinity (PPS): 6.428 - 35.451
  Oxygen (ml/l): 6.057 - 7.967
  Phosphate (umol/l): 0.273 - 0.822
  Silicate (umol/l): 1.720 - 9.916

Graphical representation

Temperature range (°C): 2.225 - 13.223

Nitrate (umol/L): 1.335 - 10.807

Salinity (PPS): 6.428 - 35.451

Oxygen (ml/l): 6.057 - 7.967

Phosphate (umol/l): 0.273 - 0.822

Silicate (umol/l): 1.720 - 9.916
 
Note: this information has not been validated. Check this *note*. Your feedback is most welcome.

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Coastal populations occur in shallow inshore marine waters (6) where there are rocky islands or cliffs (3). Inland colonies nest in trees close to freshwater lakes, reservoirs and gravel pits (3), and these are increasing (5).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

In spite of its preference for extensive areas of permanent freshwater, the Great Cormorant is not confined to these and is often observed on coastal inlets and estuaries.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© New Guinea Birds

Source: Birds of Papua New Guinea

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Migration

Non-Migrant: Yes. At least some populations of this species do not make significant seasonal migrations. Juvenile dispersal is not considered a migration.

Locally Migrant: Yes. At least some populations of this species make local extended movements (generally less than 200 km) at particular times of the year (e.g., to breeding or wintering grounds, to hibernation sites).

Locally Migrant: Yes. At least some populations of this species make annual migrations of over 200 km.

The more northerly populations are migratory. Some individuals migrate far to south for winter.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Trophic Strategy

Comments: Eats almost entirely fishes (e.g., in North America, sculpin, cod, flounder, cunner, pollack); dives from surface of water, usually seeks prey near bottom in 5 or fewer fathoms of water but takes mainly pelagic forms in some areas (Palmer 1962).

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Food Habits

Great cormorants eat almost exclusively fish less than 20 cm in length. They occasionally eat larger fish, up to 75 cm long or 1.5 kg. Some crustaceans are also eaten rarely. Fish are taken mostly in shallow water less than 20 m deep, but they hunt throughout the water column, from the surface to the bottom, depending on the prey. They dive in and pursue fish under the water using vision, eating small fish underwater and bringing larger fish to the surface to swallow. Great cormorants may also follow fishing boats, taking fish discards or capturing prey disturbed by the wake of a boat. Great cormorants may forage alone or in flocks, varying regionally and possibly with subspecies.

Great cormorants eat a wide variety of fish species, but may rely primarily on only a few species that are abundant locally, often bottom-dwelling species. In areas where cormorant species co-occur, they may pursue slightly different kinds of prey. In areas where great cormorants co-occur with double-crested cormorants, they eat more bottom-dwelling fish.

Great cormorants will drink sea water and can rid themselves of excess salt through their salt glands. Adults bring chicks water when they are heat stressed.

Animal Foods: fish; aquatic crustaceans

Primary Diet: carnivore (Piscivore )

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Like other cormorants, the Great Cormorant feeds mainly on fish, supplemented in freshwater by crustaceans, various aquatic insects and frogs. The Great Cormorant is an excellent swimmer and captures its food in shallow underwater dives, normally lasting up to one minute. Underwater, it swims and pursues prey using its feet but not its wings. Outside of the breeding season small groups are formed although birds are often seen fishing alone.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© New Guinea Birds

Source: Birds of Papua New Guinea

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Associations

Ecosystem Roles

Great cormorants nest in mixed-species colonies with other cormorants, gulls, and kittiwakes. Great cormorants are susceptible to Newcastle disease and avian influenza and are parasitized by nematodes (Contracaecum rudolphii) and 11 species of trematodes.

Mutualist Species:

Commensal/Parasitic Species:

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Predation

Most predation is at nesting colonies and the location and physical aspects of the nesting colony determine susceptibility to predation. Predators on eggs and hatchlings include gulls and crows, although they are generally only successful when colonies have been disturbed and adults are flushed from nests. Fledglings have been taken by bald eagles (Haliaeetus leucocephalus), white-tailed eagles (Haliaeetus albicilla), and red foxes (Vulpes vulpes). The presence of humans or large predators will cause adults to leave nests, leaving them vulnerable to predation.

Known Predators:

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Known prey organisms

Phalacrocorax carbo (Phalacrocorax carbo cormorant) preys on:
Paralichthyes albigutta
Strongylura marina
Leiostomus xanthurus
Anguilla anguilla
Pollachius virens
Ammodytes tobianus
Pholis gunnellus
Zoarces viviparus
Pomatoschistus microps
Salmo trutta

Based on studies in:
USA: Florida (Estuarine)
Scotland (Estuarine)

This list may not be complete but is based on published studies.
  • Christian RR, Luczkovich JJ (1999) Organizing and understanding a winter’s seagrass foodweb network through effective trophic levels. Ecol Model 117:99–124
  • Hall SJ, Raffaelli D (1991) Food-web patterns: lessons from a species-rich web. J Anim Ecol 60:823–842
  • Huxham M, Beany S, Raffaelli D (1996) Do parasites reduce the chances of triangulation in a real food web? Oikos 76:284–300
Creative Commons Attribution 3.0 (CC BY 3.0)

© SPIRE project

Source: SPIRE

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Known predators

Phalacrocorax carbo (Phalacrocorax carbo cormorant) is prey of:
Cryptocotyle lingua
Maritrema subdolum

Based on studies in:
Scotland (Estuarine)

This list may not be complete but is based on published studies.
  • Huxham M, Beany S, Raffaelli D (1996) Do parasites reduce the chances of triangulation in a real food web? Oikos 76:284–300
Creative Commons Attribution 3.0 (CC BY 3.0)

© SPIRE project

Source: SPIRE

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

General Ecology

Most foraging is done solitarily. Adults fly up to 32 km from colony to feed (Palmer 1962).

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Life History and Behavior

Behavior

Communication and Perception

Great cormorants use a wide variety of hoarse calls. Males tend to have louder calls than females. Call types include threat calls ("tok-gock-gock"), calls associated with a kink-throating behavior ("curr-curr-curr"), calls associated with hopping ("ah-ah-ah" or "fi-fi-fih"), calls after landing or hopping ("roor"), gargling calls ("fee-he-he-he"), and calls when individuals entwine necks ("rrr"). They produce other sounds associated with courtship behaviors as well. Visual displays are used nest territory defense. Threat postures are when great cormorants hold their bodies horizontally, with their wings spread slightly and the tail fanned, the mouth is held open and the head is moved from side to side. During these threat displays males make a hoarse call and females make a soft huffing sound. Nest territory displays might also involve grabbing a piece of nesting material and shaking it.

Communication Channels: visual ; acoustic

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© New Guinea Birds

Source: Birds of Papua New Guinea

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Cyclicity

Comments: Most active in morning and late afternoon; probably never fishes after dark (Palmer 1962).

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Life Expectancy

Lifespan/Longevity

The oldest wild great cormorant recorded was 22 years old, although it is expected that most do not live beyond 15 years old. After the first year, yearly survival rates are relatively high, approximately 72% in one study and up to 80% for adults in the same study. Most reported mortality in adults is from entanglement in fishing gear or being shot. Young typically die from exposure, predation, starvation, and falling from nests on cliffs.

Range lifespan

Status: wild:
22 (high) years.

Typical lifespan

Status: wild:
15 (high) years.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Lifespan, longevity, and ageing

Maximum longevity: 23.5 years (wild)
Creative Commons Attribution 3.0 (CC BY 3.0)

© Joao Pedro de Magalhaes

Source: AnAge

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Reproduction

Active nests occur mainly late May-early July in Canada. Clutch size averages 4-5 in North America. Incubation, by both sexes, lasts 28-31 days. Both parents feed young, which first fly well at about 7-8 weeks. Young are independent at 12-13 weeks or as early as 8 weeks in some areas. In Nova Scotia, 17 nests produced an average of 1.2 young fledged per nest (see Johnsgard 1993). Reportedly first breeds at 3-5 years; more recent information indicates that the youngest breeders may be 2-3 years old (see Johnsgard 1993). In North America, colonies usually include fewer than 200 pairs.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Male great cormorants choose and defend a nesting territory. Pairs are monogamous and pairs may be reunited in subsequent years, with 11% of pairs remaining together over several years in one study. Males use a wing-waving display to attract females to their nest site; they raise their wing-tips up and out, alternately hiding and exposing white patches on their thighs while they do this. Once a pair has been formed, they greet each other with a gargling display. Male gargling displays are more exaggerated and involve lifting the head, opening the mouth, then dipping the head back towards the tail while waving it back and forth and making a gargling noise. Mated individuals also preen each other, entwine their necks, and performing several other displays in specific contexts (pointing, preflight, postlanding, hop, and kin-throat). Extra-pair copulations have been estimated at up to 16% in some colonies.

Mating System: monogamous

Great cormorant pairs may return to the same nest site year after year if they were successful breeding at that site before. They nest in large colonies, often with other species, including cormorants, gulls, and kittiwakes. Colony sizes vary regionally and with subspecies, from a mean of 117 nests to over 9000. The timing of breeding also varies substantially throughout the range of great cormorants. Colonies in warmer areas breed earlier than those in colder areas. In the tropics they may breed year-round or breed in wet seasons. In North America, great cormorants arrive at breeding colonies in late February and early March and begin to form pairs. A single clutch is laid from late April to early July, although clutches laid after June are often abandoned. If a clutch is lost early in the year, parents will attempt to re-nest. Young are fledged and nesting colonies are deserted by the middle of August. Nests are either on the ground or in trees and are made of sticks and seaweed lined with grass and feathers. Females lay 1 to 7 (typically 3 to 5) chalky, bluish green eggs and begin to incubate them gradually. Eggs hatch 28 to 31 days after incubation begins. Young fledge at 45 to 55 days after hatching and leave the nest soon after that. They join communal roosting areas and are continued to be fed by parents for another 2 to 3 months after fledging. Young males and females typically begin to breed at 3 years old (range 2 to 4 years).

Breeding interval: Great cormorants breed once a year, generally laying a single clutch.

Breeding season: The timing of breeding varies regionally and with subspecies.

Range eggs per season: 1 to 7.

Average eggs per season: 3 to 5.

Range time to hatching: 28 to 31 days.

Range fledging age: 45 to 55 days.

Range time to independence: 105 to 145 days.

Range age at sexual or reproductive maturity (female): 2 to 4 years.

Range age at sexual or reproductive maturity (male): 2 to 4 years.

Key Reproductive Features: seasonal breeding ; year-round breeding ; gonochoric/gonochoristic/dioecious (sexes separate)

Both parents incubate and feed their young. Parents incubate the eggs between their feet and breasts, taking approximately equal incubation shifts. Great cormorant hatchlings are naked and blind at hatching, developing a coat of down by 6 days old. Both parents brood them for about 10 days and at least 1 parent is at the nest until the young are 2 weeks old. Parents then begin to visit the nest primarily for feeding. Parents also help to cool hatchlings by shading them or bringing water. Hatchlings are fed by both parents through regurgitation. As parents approach, the hatchlings beg vigorously and food is deposited in their mouths when they are small. As they develop, they begin to insert their heads into their parents mouth to gather regurgitate from the parent's pharyngeal pouch. Older hatchlings begin to compete in the nest and stronger hatchlings may be fed more. The smallest hatchling often dies within a few weeks, but survival of other young is generally high. After fledging, the young continue to be fed by their parents for 2 to 3 months. Nest colonies are generally abandoned by all birds by the time the young are 70 to 90 days old. Young gather in creches after they leave the nest and parents recognize their young in those aggregations.

Parental Investment: altricial ; pre-fertilization (Provisioning, Protecting: Female); pre-hatching/birth (Provisioning: Female, Protecting: Male, Female); pre-weaning/fledging (Provisioning: Male, Female, Protecting: Male, Female); pre-independence (Provisioning: Male, Female)

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Breeding can occur at any time depending on food supply. Both sexes build the nest, which is a large structure of sticks placed in a low tree or on the ground. Both parents also incubate the eggs and care for the young.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© New Guinea Birds

Source: Birds of Papua New Guinea

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Statistics of barcoding coverage: Phalacrocorax carbo

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 14
Specimens with Barcodes: 20
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Barcode data: Phalacrocorax carbo

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There are 14 barcode sequences available from BOLD and GenBank.  Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.  See the BOLD taxonomy browser for more complete information about this specimen and other sequences.

CTCTTTACCTTATCTTCGGTGCCTGGGCCGGCATAGTCGGAACTGCCCTCAGCCTACTTATCCGTGCAGAACTAGGCCAACCAGGAACCCTCCTAGGAGATGACCAAATCTACAATGTAATTGTCACCGCCCACGCTTTCGTAATAATCTTCTTCATAGTAATGCCAATCATAATCGGAGGATTCGGAAACTGACTGGTCCCCCTCATAATCGGCGCCCCAGACATAGCATTCCCACGTATAAATAACATAAGCTTCTGACTTCTTCCACCATCATTTCTCCTCTTACTGGCCTCCTCTACAGTAGAAGCAGGCGCAGGCACAGGATGAACTGTATATCCACCCCTAGCTGGAAACCTCGCCCATGCTGGAGCCTCAGTCGACCTAGCCATCTTCTCCCTCCATCTAGCAGGGGTGTCCTCAATCCTGGGGGCAATCAACTTCATCACAACTGCTATTAATATAAAACCCCCAGCCTTATCACAATACCAAACCCCATTATTCGTTTGATCCGTACTAATCACTGCAGTCTTACTCTTACTCTCACTCCCAGTACTTGCTGCCGGAATTACCATGCTCCTAACAGATCGAAACCTAAACACGACATTCTTTGACCCTGCTGGCGGGGGAGACCCAGTCCTATACCAACACCTATTCTGATTCTTCGGTCACCCAGAAGTATACATCTTAATTCTTCCAGGA
-- end --

Download FASTA File
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Conservation

Conservation Status

National NatureServe Conservation Status

Canada

Rounded National Status Rank: N4B,N4N : N4B: Apparently Secure - Breeding, N4N: Apparently Secure - Nonbreeding

United States

Rounded National Status Rank: N1B,N4N : N1B: Critically Imperiled - Breeding, N4N: Apparently Secure - Nonbreeding

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

NatureServe Conservation Status

Rounded Global Status Rank: G5 - Secure

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

IUCN Red List Assessment


Red List Category
LC
Least Concern

Red List Criteria

Version
3.1

Year Assessed
2012

Assessor/s
BirdLife International

Reviewer/s
Butchart, S. & Symes, A.

Contributor/s

Justification
This species has an extremely large range, and hence does not approach the thresholds for Vulnerable under the range size criterion (Extent of Occurrence <20,000 km2 combined with a declining or fluctuating range size, habitat extent/quality, or population size and a small number of locations or severe fragmentation). The population trend appears to be increasing, and hence the species does not approach the thresholds for Vulnerable under the population trend criterion (>30% decline over ten years or three generations). The population size is extremely large, and hence does not approach the thresholds for Vulnerable under the population size criterion (<10,000 mature individuals with a continuing decline estimated to be >10% in ten years or three generations, or with a specified population structure). For these reasons the species is evaluated as Least Concern.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Great cormorants are widespread and populations are large, although surveys across their range are not complete. Populations have declined in the past, often as a result of human persecution, especially from commercial fishing. Recoveries from declines have been variable, with some populations remaining at lower levels and some recovering. In general, population increases may be most directly associated with prey availability. They are considered "least concern" by the IUCN.

US Migratory Bird Act: protected

US Federal List: no special status

CITES: no special status

State of Michigan List: no special status

IUCN Red List of Threatened Species: least concern

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Status in Egypt

Regular passage visitor and winter visitor.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Bibliotheca Alexandrina

Source: Bibliotheca Alexandrina - EOL Ar

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Status

Receives general protection under the Wildlife and Countryside Act 1981, and listed under Appendix III of the Bern Convention. Classified as a species of conservation concern by the UK Biodiversity Action Plan, although not a priority species (2). Included in the Birds of Conservation Concern Amber List (medium conservation concern) (8).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Not Threatened.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© New Guinea Birds

Source: Birds of Papua New Guinea

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Population

Population
The global population is estimated to number c.1,400,000-2,900,000 individuals (Wetlands International 2006), while national population estimates include: >c.1,000 wintering individuals in China; c.100-10,000 breeding pairs and >c.1,000 wintering individuals in Korea; c.10,000-100,000 breeding pairs and >c.10,000 wintering individuals in Japan and possibly c.10,000-100,000 breeding pairs and c.1,000-10,000 individuals on migration in Russia (Brazil 2009).

Population Trend
Increasing
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Threats

Comments: Abundance probably has not been greatly affected by humans because the eggs and meat are unpalatable (Root 1988), but in North America may be constrained by limited nesting habitat and disturbance of nesting colonies by humans.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Major Threats
The species is often persecuted by the aquaculture industry and may be shot, drowned or poisoned in attempts to control numbers (Carss 1994). It may also suffer from disturbance from coastal wind farms (wind turbines) (Garthe and Huppop 2004), and is susceptible to avian influenza (Melville and Shortridge 2006) and Newcastle disease (Kuiken 1999) so may be threatened by future outbreaks of these viruses (Kuiken 1999, Melville and Shortridge 2006). Utilisation The species is hunted for recreation and is sold at commercial food markets in Iran (Balmaki and Barati 2006).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

People involved in angling and fisheries are concerned that the increase in numbers of cormorants in the UK is having a negative impact on fish stocks (5), and some are calling for the legal protection of the species to be reduced (3). Conservationists believe that any conflicts can be resolved on each site and are worried that such a move would affect the conservation status of the species (5).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Management

Conservation Actions

Conservation Actions
Conservation Actions Underway
It may be possible to alleviate conflicts between this species and fisheries by using such strategies as preventing birds from landing on fish ponds through disturbance, or creating unsuitable feeding conditions (Kirby et al. 1996).

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Conservation

Like all birds, the cormorant receives protection under the Wildlife and Countryside Act of 1981; it is illegal to kill wild birds and their nests and eggs cannot be taken or destroyed (5).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Relevance to Humans and Ecosystems

Benefits

Economic Importance for Humans: Negative

There are no known adverse effects of great cormorants on humans. They are sometimes suspected of competing or interfering with human commercial and subsistence fishing, but their heavy reliance on small fishes means that it is unlikely they compete directly.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Economic Importance for Humans: Positive

Great cormorants are hunted for sport and are eaten in some areas. Most interestingly, great cormorants are tamed by humans to use to catch fish. This is an ancient practice in east Asia, dating back to the 5th century in China, and is still practiced in China and Japan. In other areas they are sometimes tamed and used in a similar way as a sport. Tamed great cormorants were used for fishing in England and France in the 17th and 19th centuries. A ring or other obstruction is placed around the cormorant's neck so that the fish can capture, but not swallow, a fish. The birds are harnessed and a leash is used to recall them, at which point the fish is removed from the throat. Some great cormorants have been reported to be so well trained as to not need the strap. They simply don't swallow the fish until the 8th fish, which they are allowed to eat. This suggests the potential that they can "count." Great cormorants with clipped wings have also been used on Djoran Lake (between Yugoslavia and Greece) to drive fish into nets.

Positive Impacts: food

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Wikipedia

Great cormorant

The great cormorant (Phalacrocorax carbo), known as the great black cormorant across the Northern Hemisphere, the black cormorant in Australia, the large cormorant in India and the black shag further south in New Zealand, is a widespread member of the cormorant family of seabirds.[2] It breeds in much of the Old World and the Atlantic coast of North America.

Description[edit]

The great cormorant is a large black bird, but there is a wide variation in size in the species wide range. Weight is reported from 1.5 kg (3.3 lbs)[3] to 5.3 kg (11.7 lbs),[4] with a typical range from 2.6 to 3.7 kg (5.7–8.2 lbs).[5] Length can vary from 70 to 102 cm (28–40 in) and wingspan from 121 to 160 cm (48–63 in).[6][7] It has a longish tail and yellow throat-patch. Adults have white thigh patches in the breeding season. In European waters it can be distinguished from the common shag by its larger size, heavier build, thicker bill, lack of a crest and plumage without any green tinge. In eastern North America, it is similarly larger and bulkier than double-crested cormorant, and the latter species has more yellow on the throat and bill. Great cormorants are mostly silent, but they make various guttural noises at their breeding colonies.

Albino in Lake Kerkini, Greece

Variations[edit]

A very rare variation of the great cormorant is caused by albinism. The Phalacrocorax carbo albino suffers from loss of eyesight and/or hearing, thus it rarely manages to survive in the wild.[citation needed]

Distribution[edit]

This is a very common and widespread bird species. It feeds on the sea, in estuaries, and on freshwater lakes and rivers. Northern birds migrate south and winter along any coast that is well-supplied with fish.

The type subspecies, P. c. carbo, is found mainly in Atlantic waters and nearby inland areas: on western European coasts and south to North Africa, the Faroe Islands, Iceland and Greenland; and on the eastern seaboard of North America, though in America it breeds only in the north of its range, in the Canadian maritime provinces.

The subspecies found in Australasian waters, P. carbo novaehollandiae, has a crest. In New Zealand it is known as the black shag or by its Māori name; kawau.[8] The syntype is in the collection of the Museum of New Zealand Te Papa Tongarewa.[9]

The 80–100 cm long white-breasted cormorant P. c. lucidus found in sub-Saharan Africa, has a white neck and breast. It is often treated as a full species, Phalacrocorax lucidus (e.g. Sibley & Monroe, 1990, Sinclair, Hockey and Tarboton, 2002)

In addition to the Australasian and African forms, Phalacrocorax carbo novaehollandiae and P. carbo lucidus mentioned above, other geographically distinct subspecies are recognised, including P. c. sinensis (western Europe to east Asia), P. c. maroccanus (north-western Africa), and P. c. hannedae (Japan).

Some authors[who?] treat all these as allospecies of a P. carbo superspecies group.

Behaviour[edit]

Cormorant swallowing a just caught eel

The great cormorant breeds mainly on coasts, nesting on cliffs or in trees (which are eventually killed by the droppings), but also increasingly inland. Three or four eggs are laid in a nest of seaweed or twigs.

The great cormorant can dive to considerable depths, but often feeds in shallow water. It frequently brings prey to the surface. A wide variety of fish are taken: cormorants are often noticed eating eels, but this may reflect the considerable time taken to subdue an eel and position it for swallowing, rather than any dominance of eels in the diet. In British waters, dive times of 20–30 seconds are common, with a recovery time on the surface around a third of the dive time.

Relationships with humans[edit]

Many fishermen see in the great cormorant a competitor for fish. Because of this it was nearly hunted to extinction in the past. Thanks to conservation efforts its numbers increased. At the moment there are about 1.2 million birds in Europe (based on winter counts; late summer counts would show higher numbers).[10] Increasing populations have once again brought the cormorant into conflict with fisheries.[11][12] For example, in Britain, where inland breeding was once uncommon, there are now increasing numbers of birds breeding inland, and many inland fish farms and fisheries now claim to be suffering high losses due to these birds. In the UK each year some licences are issued to shoot specified numbers of cormorants in order to help reduce predation, it is however still illegal to kill a bird without such a licence.

Cormorant fishing is practised in China, Japan, and elsewhere around the globe. In it, fishermen tie a line around the throats of cormorants, tight enough to prevent swallowing, and deploy them from small boats. The cormorants catch fish without being able to fully swallow them, and the fishermen are able to retrieve the fish simply by forcing open the cormorants' mouths, apparently engaging the regurgitation reflex.

In Norway cormorant is a traditional game bird. Each year c. 10,000 cormorants are shot to be eaten.[13] In North Norway, cormorants are traditionally seen as semi-sacred.[citation needed] It is regarded as good luck to have cormorants gather near your village or settlement. An old legend states that people who die far out at sea, their bodies never recovered, spend eternity on the island Utrøst – which can only occasionally be found by mortals. The inhabitants of Utrøst can only visit their homes in the shape of cormorants.

Various views and plumages[edit]

References[edit]

  1. ^ BirdLife International (2012). "Phalacrocorax carbo". IUCN Red List of Threatened Species. Version 2013.2. International Union for Conservation of Nature. Retrieved 26 November 2013. 
  2. ^ Ali, S. (1993). The Book of Indian Birds. Bombay: Bombay Natural History Society. ISBN 978-0-19-563731-1. 
  3. ^ Ribak, Gal; Weihs, Daniel; Arad, Zeev (2005). "Water retention in the plumage of diving great cormorantsPhalacrocorax carbo sinensis". Journal of Avian Biology 36 (2): 89. doi:10.1111/j.0908-8857.2005.03499.x. 
  4. ^ Cormorant. The Canadian Encyclopedia. Retrieved on 2012-08-21.
  5. ^ Great Cormorant, Identification, All About Birds – Cornell Lab of Ornithology. Birds.cornell.edu. Retrieved on 2012-08-21.
  6. ^ Field Guide to the Birds of East Africa: Kenya, Tanzania, Uganda, Rwanda, Burundi by Stevenson & Fanshawe. Elsevier Science (2001), ISBN 978-0-85661-079-0
  7. ^ Great Cormorant, Life History, All About Birds – Cornell Lab of Ornithology. Allaboutbirds.org. Retrieved on 2012-08-21.
  8. ^ Barrie Heather and Hugh Robertson, "The Field guide to the Birds of New Zealand"(revised edition), Viking, 2005
  9. ^ "Phalacrocorax carbo novaehollandiae; syntype". Collections Online. Museum of New Zealand Te Papa Tongarewa. Retrieved 18 July 2010. 
  10. ^ Wetland International Cormorant Researg Group: Cormorants in the western Palearctic, Distribution and numbers on a wider European scale
  11. ^ FAO publication: Workshop on a European Cormorant management Plan, 20–21 November 2007; EIFAC, European Inland Fisheries Advisory Commission
  12. ^ European Parliament resolution of 4 December 2008: "on the adoption of a European Cormorant Management Plan to minimise the increasing impact of cormorants on fish stocks, fishing and aquaculture"
  13. ^ Reducing the conflict between Cormorants and fisheries on a pan-European scale, REDCAFE, Final Report; p. 12: "Around 10,000 adult Cormorants (of the ‘Atlantic’ carbo race) are hunted legally as game in Norway outside the breeding season."

Further reading[edit]

  • Sibley, C. G., & Monroe, B. L. (1990). Distribution and taxonomy of birds of the world. New Haven CT: Yale University Press.
  • Ian Sinclair, Phil Hockey and Warwick Tarboton, SASOL Birds of Southern Africa (Struik 2002) ISBN 1-86872-721-1
Separation of carbo and sinensis
  • Newson, Stuart, Graham Ekins, Baz Hughes, Ian Russell and Robin Sellers (2005) Separation of North Atlantic and Continental Cormorants Birding World 18(3):107–111
  • Millington, Richard (2005) Identification of North Atlantic and Continental Cormorants Birding World 18(3):112–123
Creative Commons Attribution Share Alike 3.0 (CC BY-SA 3.0)

Source: Wikipedia

Unreviewed

Article rating from 0 people

Average rating: 2.5 of 5

Names and Taxonomy

Taxonomy

Comments: Regarded as conspecific with African P. LUCIDUS by AOU (1983, 1998). Constitutes a superspecies with P. CAPILLATUS (AOU 1998). See Siegel-Causey (1988) for analysis of relationships within family.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!